Previous Contig 001252:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF022B06Sequence490001252 (12)gb:AP004837_18457493e-53Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P048658001252 (12)gb:AP004837_18457493e-67Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P048
JMFF026I17Sequence564001252 (12)sp|O81361|RS8_PRUAR8e-5440S ribosomal protein S8.>gb:AF071889_1765813 Prunus armeniaca 40S ribosomal pro772021257gb:AP004837_18457498e-76Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P048
JMFN008G23Sequence632001252 (12)gb:AP004837_18457496e-71Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P048
JMFN013L23Sequence619001252 (12)gb:AP004837_18457495e-79Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P048
JMFN028B09Sequence642001252 (12)gb:OSJN00241_11909584e-53Oryza sativa (japonica cultivar-group) chromosome 4 clone OSJNBa0038P21, *** SEQ
JMFN028C07Sequence602001252 (12)gb:AP004837_18457496e-70Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P048
JMFS097D10Sequence587001252 (12)sp|O81361|RS8_PRUAR1e-6040S ribosomal protein S8.>gb:AF071889_1765813 Prunus armeniaca 40S ribosomal pro
JMSF010D18Sequence298001252 (12)gb:AP004837_18457492e-27Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P048763001252 (12)gb:AP004837_18457498e-79Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P048
JMSF019K06Sequence524001252 (12)sp|O81361|RS8_PRUAR3e-5340S ribosomal protein S8.>gb:AF071889_1765813 Prunus armeniaca 40S ribosomal pro766001252 (12)gb:AP004837_18457495e-74Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P048

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF010D18- ATTCAGTACAATAAAGAAGAGTTAAATGTCATCA
rJMSF019K06- AAATTCAGTACAATAAAGAAGAGTTAAATGTCATCA
                      ____________________________________________________________
consensus AAATTCAGTACAATAAAGAAGAGTTAAATGTCATCA
 
. : . : . : . : . : . :
rJMSF010D18- CCAACTATAAATATAAGGAGAGAAAGAAGTTCCCAAATCAAATTCTCATATTTTTTAGGT
rJMSF019K06- CCAACTATAAATATAAGGAGAGAAAGAAGTTCCCAAATCAAATTCTCATATTTTTTAGGT
                      ____________________________________________________________
consensus CCAACTATAAATATAAGGAGAGAAAGAAGTTCCCAAATCAAATTCTCATATTTTTTAGGT
 
. : . : . : . : . : . :
rJMSF010D18- AAAGTACAGCAAACTAAAAGATTTAACTTGATCAAAAATCTTGACTGCAAAATTAAGCAG
JMFN028B09- AATTAAGCAG
JMFN013L23+ TGACTGCANAATTAAGCAG
rJMSF019K06- AAAGTACAGCAAACTAAAAGATTTAACTTGATCAAAAATCTTGACTGCAAAATTAAGCAG
                      ____________________________________________________________
consensus AAAGTACAGCAAACTAAAAGATTTAACTTGATCAAAAATCTTGACTGCAAAATTAAGCAG
 
. : . : . : . : . : . :
rJMSF010D18- CAGCACCGCTACCCTTGCCCTTCTTTCTTTGGATTTTCTTCATATAGAACTCGAGCTCTT
JMFN028B09- CAGCACCGCTACCCTTGCCCTTCTTTCTTTGGATTTTCTTCATATAGAACTCGAGCTCTT
JMFN013L23+ CAGCACCGCTACCCTTGCCCTTCTTTCTTTGGATTTTCTTCATATAGAACTCGAGCTCTT
rJMSF019K06- CAGCACCGCTACCCTTGCCCTTCTTTCTTTGGATTTTCTTCATATAGAACTCGAGCTCTT
                      ____________________________________________________________
consensus CAGCACCGCTACCCTTGCCCTTCTTTCTTTGGATTTTCTTCATATAGAACTCGAGCTCTT
 
. : . : . : . : . : . :
rJMSF010D18- TTCCTTCCAAAATATATCCATCGGCTCTGCCACATTGACCAGGTCTGGATGAGATGCAGG
JMFN028B09- TTCCTTCCAAAATATATCCATCGGCTCTGCCACATTGACCAGGTCTGGATGAGATGCAGG
JMFN013L23+ TTCCTTCCAAAATATATCCATCGGCTCTGCCACATTGACCAGGTCTGGATGAGATGCAGG
rJMSF019K06- TTCCTTCCAAAATATATCCATCGGCTCTGCCACATTGACCAGGTCTGGATGAGATGCAGG
JMFN028C07+ TCCAAAATATATCCATCGGCTCTGCCACATTGACCAGGTCTGGATGAGATGCAGG
rJMFF022B06- TCGGCTCTGCCACATTGACCAGGTCTGGATGAGATGCAGG
JMFN008G23+ CTTCCAAAATATATCCATCGGCTCTGCCACATTGACCAGGTCTGGATGAGATGCAGG
JMFS097D10+ TGCAGG
                      ____________________________________________________________
consensus TTCCTTCCAAAATATATCCATCGGCTCTGCCACATTGACCAGGTCTGGATGAGATGCAGG
 
. : . : . : . : . : . :
rJMSF010D18- CCATCAACCTACCAGAGCCAAACTGCTCCTCAAGGTGAGAGTCAAGTTTACGTTCCTTCT
JMFN028B09- CCATCAACCTACCAGAGCCAAACTGCTCCTCAAGGTGAGAGTCAAGTTTACGTTCCTTCT
JMFN013L23+ CCATCAACCTACCAGAGCCAAACTGCTCCTCAAGGTGAGAGTCAAGTTTACGTTCCTTCT
rJMSF019K06- CCATCAACCTACCAGAGCCAAACTGCTCCTCAAGGTGAGAGTCAAGTTTACGTTCCTTCT
JMFN028C07+ CCATCAACCTACCAGAGCCAAACTGCTCCTCAAGGTGAGAGTCAAGTTTACGTTCCTTCT
rJMFF022B06- CCATCAACCTACCAGAGCCAAACTGCTCCTCAAGGTGAGAGTCAAGTTTACGTTCCTTCT
JMFN008G23+ CCATCAACCTACCAGAGCCAAACTGCTCCTCAAGGTGAGAGTCAAGTTTACGTTCCTTCT
JMFS097D10+ CCATCAACCTACCAGAGCCAAACTGCTCCTCAAGGTGAGAGTCAAGTTTACGTTCCTTCT
JMFF026I17+ GAGAGTCAAGTTTACGTTCCTTCT
                      ____________________________________________________________
consensus CCATCAACCTACCAGAGCCAAACTGCTCCTCAAGGTGAGAGTCAAGTTTACGTTCCTTCT
 
. : . : . : . : . : . :
rJMSF010D18- GCCGCTTCTCAAGTTTCCTTTGGACATGGTTGCTCTTCTTTGTCTCCTCAGCAGCTACAC
JMFN028B09- GCCGCTTCTCAAGTTTCCTTTGGACATGGTTGCTCTTCTTTGTCTCCTCAGCAGCTACAC
JMFN013L23+ GCCGCTTCTCAAGTTTCCTTTGGACATGGTTGCTCTTCTTTGTCTCCTCAGCAGCTACAC
rJMSF019K06- GCCGCTTCTCAAGTTTCCTTTGGACATGGTTGCTCTTCTTTGTCTCCTCAGCAGCTACAC
JMFN028C07+ GCCGCTTCTCAAGTTTCCTTTGGACATGGTTGCTCTTCTTTGTCTCCTCAGCAGCTACAC
rJMFF022B06- GCCGCTTCTCAAGTTTCCTTTGGACATGGTTGCTCTTCTTTGTCTCCTCAGCAGCTACAC
JMFN008G23+ GCCGCTTCTCAAGTTTCCTTTGGACATGGTTGCTCTTCTTTGTCTCCTCAGCAGCTACAC
JMFS097D10+ GCCGCTTCTCAAGTTTCCTTTGGACATGGTTGCTCTTCTTTGTCTCCTCAGCAGCTACAC
JMSF019K06+ TTCCTTTGGACATGGTTGCTCTTCTTTGTCTCCTCAGCAGCTACAC
JMFF026I17+ GCCGCTTCTCAAGTTTCCTTTGGACATGGTTGCTCTTCTTTGTCTCCTCAGCAGCTACAC
                      ____________________________________________________________
consensus GCCGCTTCTCAAGTTTCCTTTGGACATGGTTGCTCTTCTTTGTCTCCTCAGCAGCTACAC
 
. : . : . : . : . : . :
rJMSF010D18- CCTCGGTTTCCTCAGCAGTTTCCTTCTTGGCAGCCGCCTTCTTCTTCCTGCCAATGTCAA
JMFN028B09- CCTCGGTTTCCTCAGCAGTTTCCTTCTTGGCAGCCGCCTTCTTCTTCCTGCCAATGTCAA
JMFN013L23+ CCTCGGTTTCCTCAGCAGTTTCCTTCTTGGCAGCCGCCTTCTTCTTCCTGCCAATGTCAA
rJMSF019K06- CCTCGGTTTCCTCAGCAGTTTCCTTCTTGGCAGCCGCCTTCTTCTTCCTGCCAATGTCAA
JMFN028C07+ CCTCGGTTTCCTCAGCAGTTTCCTTCTTGGCAGCCGCCTTCTTCTTCCTGCCAATGTCAA
rJMFF022B06- CCTCGGTTTCCTCAGCAGTTTCCTTCTTGGCAGCCGCCTTCTTCTTCCTGCCAATGTCAA
JMFF022B06+ TCCTCAGCAGTTTCNTTCTTGGCAGCCGCCTTCTTCTTCCTGCCAATGTCAA
JMFN008G23+ CCTCGGTTTCCTCAGCAGTTTCCTTCTTGGCAGCCGCCTTCTTCTTCCTGCCAATGTCAA
JMFS097D10+ CCTCGGTTTCCTCAGCAGTTTCCTTCTTGGCAGCCGCCTTCTTCTTCCTGCCAATGTCAA
JMSF019K06+ CCTCGGTTTCCTCAGCAGTTTCCTTCTTGGCAGCCGCCTTCTTCTTCCTGCCAATGTCAA
JMFF026I17+ CCTCGGTTTCCTCAGCAGTTTCCTTCTTGGCAGCCGCCTTCTTCTTCCTGCCAATGTCAA
                      ____________________________________________________________
consensus CCTCGGTTTCCTCAGCAGTTTCCTTCTTGGCAGCCGCCTTCTTCTTCCTGCCAATGTCAA
 
. : . : . : . : . : . :
rJMSF010D18- AACCATAGTGCTGAAGGTACCACTGCTTAAAGGGAGCTGCATCAACCTGAACAATTGCAC
JMFN028B09- CACCATAGTGCTGAAGGTACCACTGCTTAAAGGGAGCTGCATCAACCTGAACAATTGCAC
JMFN013L23+ CACCATAGTGCTGAAGGTACCACTGCTTAAAGGGAGCTGCATCAACCTGAACAATTGCAC
rJMSF019K06- AACCATAGTGCTGAAGGTACCACTGCTTAAAGGGAGCTGCATCAACCTGAACAATTGCAC
JMFN028C07+ CACCATAGTGCTGAAGGTACCACTGCTTAAAGGGAGCTGCATCAACCTGAACAATTGCAC
rJMFF022B06- CACCATAGTGCTGAAGGTACCACTGCTTAAAGGGAGCTGCATCAACCTGAACAATTGCAC
JMFF022B06+ CACCATAGTGCTGAAGGTACCACTGCTTAAAGGGAGCTGCATCAACCTGAACAATTGCAC
JMFN008G23+ CACCATAGTGCTGAAGGTACCACTGCTTAAAGGGAGCTGCATCAACCTGAACAATTGCAC
JMFS097D10+ CACCATAGTGCTGAAGGTACCACTGCTTAAAGGGAGCTGCATCAACCTGAACAATTGCAC
JMSF019K06+ AACCATAGTGCTGAAGGTACCACTGCTTAAAGGGAGCTGCATCAACCTGAACAATTGCAC
JMFF026I17+ CACCATAGTGCTGAAGGTACCACTGCTTAAAGGGAGCTGCATCAACCTGAACAATTGCAC
                      ____________________________________________________________
consensus CACCATAGTGCTGAAGGTACCACTGCTTAAAGGGAGCTGCATCAACCTGAACAATTGCAC
 
. : . : . : . : . : . :
rJMSF010D18- TCTTCACCAGAGTTTGTGTTCGAACAAGTTCATTGTTTGAGGCATTGTAAACCACATCAA
JMFN028B09- TCTTCACCAGAGTTTGTGTTCGAACAAGTTCATTGTTTGAGGCATTGTAAACCACATCAA
JMFN013L23+ TCTTCACCAGAGTTTGTGTTCGAACAAGTTCATTGTTTGAGGCATTGTAAACCACATCAA
rJMSF019K06- TCTTCACCAGAGTTTGTGTTCGAACAAGTTCATTGTTTGAGGCATTGTAAACCACATCAA
JMFN028C07+ TCTTCACCAGAGTTTGTGTTTGAACAAGTTCATTGTTTGAGGCATTGTAAACCACATCAA
rJMFF022B06- TCTTCACCAGAGTTTGTGTTCGAACAAGTTCATTGTTTGAGGCATTGTAAACCACATCAA
JMFF022B06+ TCTTCACCAGAGTTTGTGTTNGAACAAGTTCATTGTTTGAGGCATTGTAAACCACATCAA
JMFN008G23+ TCTTCACCAGAGTTTGTGTTCGAACAAGTTCATTGTTTGAGGCATTGTAAACCACATCAA
JMFS097D10+ TCTTCACCAGAGTTTGTGTTCGAACAAGTTCATTGTTTGAGGCATTGTAAACCACATCAA
JMSF019K06+ TCTTCACCAGAGTTTGTGTTCGAACAAGTTCATTGTTTGAGGCATTGTAAACCACATCAA
JMFF026I17+ TCTTCACCAGAGTTTGTGTTCGAACAAGTTCATTGTTTGAGGCATTGTAAACCACATCAA
                      ____________________________________________________________
consensus TCTTCACCAGAGTTTGTGTTCGAACAAGTTCATTGTTTGAGGCATTGTAAACCACATCAA
 
. : . : . : . : . : . :
rJMSF010D18- GGATACGTGTTTTCCTAGTAACTGCCTCACTACCCCATGAATAATTTCCTGTATCCAACC
JMFN028B09- GGATACGTGTTTTCCTAGTAACTGCCTCACTACCCCATGAATAATTTCCT
JMFN013L23+ GGATACGTGTTTTCCTAGTAACTGCCTCACTACCCCATGAATAATTTCCTGTATCCAACC
rJMSF019K06- GGATACGTGTTTTCCTAGTAACTGCCTCACTACCCCATGAATAATTTCCTGTATCCAACC
JMFN028C07+ GGATACGTGTTTTCCTAGTAACTGCCTCACTACCCCATGAATAATTTCCTGTATCCAACC
rJMFF022B06- GGATACGTGTTTTCCTAGTAACTGCCTCACTACCCCATGAATAATTTCCTGTATCCAACC
JMFF022B06+ GGATACGTGTTTTCCTAGTAACTGCCTCACTACCCCATGAATAATTTCCTGTATCCAACC
JMFN008G23+ GGATACGTGTTTTCCTAGTAACTGCCTCACTACCCCATGAATAATTTCCTGTATCCAACC
JMFS097D10+ GGATACGTGTTTTCCTAGTAACTGCCTCACTACCCCATGAATAATTTCCTGTATCCAACC
JMSF019K06+ GGATACGTGTTTTCCTAGTAACTGCCTCACTACCCCATGAATAATTTCCTGTATCCAACC
JMSF010D18+ GGATACGTGTTTTCCTAGTAACTGCCTCACTACCCCATGAATAATTTCCTGTATCCAACC
JMFF026I17+ GGATACGTGTTTTCCTAGTAACTGCCTCACTACCCCATGAATAATTTCCTGTATCCAACC
                      ____________________________________________________________
consensus GGATACGTGTTTTCCTAGTAACTGCCTCACTACCCCATGAATAATTTCCTGTATCCAACC
 
. : . : . : . : . : . :
rJMSF010D18- TCAGTGCCCTCCACTTCACATTGCCCCCTCGTACACGAATTCGTCTCACTGTTTTGTTGC
JMFN013L23+ TCAGTGCCCTCCACTTCACATTGCCCCCTCGTACACGAATTCGTCTCACTGTTTTGTTGC
rJMSF019K06- TCAGTGCCCTCCACTTCACATTGCCCCCTCGTACACGAATTCGTCTCACTGTTTTGTTGC
JMFN028C07+ TCAGTGCCCTCCACTTCACATTGCCCCCTCGTACACGAATTCGTCTCACTGTTTTGTTGC
rJMFF022B06- TCAGTGCCCTCCACTTCACATTGCCCCCTCGTACACGAATTCGTCTCACTGTTTTGTTGC
JMFF022B06+ TCAGTGCCCTCCACTTCACATTGCCCCCTCGTACACGAATTCGTCTCACTGTTTTGTTGC
JMFN008G23+ TCAGTGCCCTCCACTTCACATTGCCCCCTCGTACACGAATTCGTCTCACTGTTTTGTTGC
JMFS097D10+ TCAGTGCCCTCCACTTCACATTGCCCCCTCGTACACGAATTCGTCTCACTGTTTTGTTGC
JMSF019K06+ TCAGTGCCCTCCACTTCACATTGCCCCCTCGTACACGAATTCGTCTCACTGTTTTGTTGC
JMSF010D18+ TCAGTGCCCTCCACTTCACATTGCCCCCTCGTACACGAATTCGTCTCACTGTTTTGTTGC
JMFF026I17+ TCAGTGCCCTCCACTTCACATTGCCCCCTCGTACACGAATTCGTCTCACTGTTTTGTTGC
                      ____________________________________________________________
consensus TCAGTGCCCTCCACTTCACATTGCCCCCTCGTACACGAATTCGTCTCACTGTTTTGTTGC
 
. : . : . : . : . : . :
rJMSF010D18- TAGACAGCTTAGTATTTGCAGGCTGACGTCCANGCTCATACTTTCGCTTCTTCCTCCACG
JMFN013L23+ TAGACAGCTTAGTATTTGCAGGCTGACGTCCAAGCTCATACTTTCGCTTCTTCCTCCACG
rJMSF019K06- TAGACAGCTTAGTATTTGCAGGCTGACGTCCAAGCTCATACTTTCGCTTCTTCCTCCACG
JMFN028C07+ TAGACAGCTTAGTATTTGCAGGCTGACGTCCAAGCTCATACTTTCGCTTCTTCCTCCACG
rJMFF022B06- TAGACAGCTTAGTATTTGCAGGCTGACGTCCAAGCTCATACTTTCGCTTCTTCCTCCACG
JMFF022B06+ TAGACAGCTTAGTATTTGCAGGCTGACGTCCAAGCTCATACTTTCGCTTCTTCCTCCACG
JMFN008G23+ TAGACAGCTTAGTATTTGCAGGCTGACGTCCAAGCTCATACTTTCGCTTCTTCCTCCACG
JMFS097D10+ TAGACAGCTTAGTATTTGCAGGCTGACGTCCAAGCTCATACTTTCGCTTCTTCCTCCACG
JMSF019K06+ TAGACAGCTTAGTATTTGCAGGCTGACGTCCAAGCTCATACTTTCGCTTCTTCCTCCACG
JMSF010D18+ TAGACAGCTTAGTATTTGCAGGCTGACGTCCAAGCTCATACTTTCGCTTCTTCCTCCACG
JMFF026I17+ TAGACAGCTTAGTATTTGCAGGCTGACGTCCAAGCTCATACTTTCGCTTCTTCCTCCACG
                      ____________________________________________________________
consensus TAGACAGCTTAGTATTTGCAGGCTGACGTCCAAGCTCATACTTTCGCTTCTTCCTCCACG
 
. : . : . : . : . : . :
rJMSF010D18- CCTTCTTCT
rJMSF019K06- CCTTCTTCTT
JMFN028C07+ CCTTCTTCTTGCCACCAGTGGCACGCCTCTTGTGCATTGAATCCCTAGAGATACCCATGG
rJMFF022B06- CCTTCTTCTTGCCACCAGTGGCACGCCTCTTGTGCATTGAATCCCTAGAGATACCCATG
JMFF022B06+ CCTTCTTCTTGCCACCAGTGGCACGCCTCTTGTGCATTGAATCCCTAGAGATACCCATG
JMFN008G23+ CCTTCTTCTTGCCACCAGTGGCACGCCTCTTGTGCATTGAATCCCTAGAGATACCCATGG
JMFS097D10+ CCTTCTTCTTGCCACCAGTGGCACGCCTCTTGTGCATTGAATCCCTAGAGATACCCATGG
JMSF019K06+ CCTTCTTCTTGCCACCAGTGGCACGCCTCTTGTGCATTGAATCCCTAGAGATACCCATGG
JMSF010D18+ CCTTCTTCTTGCCACCAGTGGCACGCCTCTTGTGCATTGAATCCCTAGAGATACCCATGG
JMFF026I17+ CCTTCTTCTTGCCACCAGTGGCACGCCTCTTGTGCATTGAATCCCTAGAGATACCCATGG
                      ____________________________________________________________
consensus CCTTCTTCTTGCCACCAGTGGCACGCCTCTTGTGCATTGAATCCCTAGAGATACCCATGG
 
. : . : . : . : . : . :
JMFN028C07+ CGAGAGC
JMFN008G23+ CGAGAGCGTAGCAGCTAGAAGAGCTATATGCAGCG
JMFS097D10+ CGAGAGCGTAGCAGCTAGAAGAGCTATATGCAGCGTATCCT
JMSF019K06+ CGAGAGCGTAGCAGCTAGAAGAGCTATATGCAGCGTATCCTTACCAGTCCTCGCAA
JMSF010D18+ CGAGAGCGTAGCAGCTAGAAGAGCTATATGCAGCGTATCCTTACCAGTCCTCGCAA
JMFF026I17+ CGAGAGCGTAGCAGCTAGAAGAGCTATATGCAGCGTATCCTTACCAGTCCTCGCAAGAGG
                      ____________________________________________________________
consensus CGAGAGCGTAGCAGCTAGAAGAGCTATATGCAGCGTATCCTTACCAGTCCTCGCAAGAGG