Previous Contig 001248:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF015M09Sequence602001248 (6)gb:AB010699_15112417e-66Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MSN9.>gb:BT010402_16403726001248 (6)gb:AB010699_15112412e-68Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MSN9.>gb:BT010402_16403
JMFF026H12Sequence590001248 (6)gb:AK175978_18179663e-38Arabidopsis thaliana mRNA, complete cds, clone: RAFL22-67-F20.699001248 (6)gb:AB010699_15112415e-40Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MSN9.>gb:BT010402_16403
JMFN028J14Sequence580001248 (6)gb:AB010699_15112419e-67Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MSN9.>gb:BT010402_16403
JMFN044P20Sequence514001248 (6)gb:AB010699_15112415e-35Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MSN9.>gb:BT010402_16403

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF026H12- CTTTGCT
                      ____________________________________________________________
consensus CTTTGCT
 
. : . : . : . : . : . :
rJMFF026H12- ACCAATTGCCAAATAATGGAAATGACAGATGTCCTGAAACAACAATCTTCAGGTGATTTA
                      ____________________________________________________________
consensus ACCAATTGCCAAATAATGGAAATGACAGATGTCCTGAAACAACAATCTTCAGGTGATTTA
 
. : . : . : . : . : . :
rJMFF026H12- AATGCTTTATGCCAATAAAAGTTTCAGACCCACACAAAAACCGGTAAATATAAATTATAA
                      ____________________________________________________________
consensus AATGCTTTATGCCAATAAAAGTTTCAGACCCACACAAAAACCGGTAAATATAAATTATAA
 
. : . : . : . : . : . :
JMFN044P20+ ACTCCCAACCCAACTTAGATATCCAATATGAGCAATGAT
rJMFF026H12- AGAGGATATGAATCCTATTATACTCCCAACCCAACTTAGATATCCAATATGAGCAATGAT
                      ____________________________________________________________
consensus AGAGGATATGAATCCTATTATACTCCCAACCCAACTTAGATATCCAATATGAGCAATGAT
 
. : . : . : . : . : . :
JMFN044P20+ CATATGATAGAAAAGGGGGTAAAACAAAACTAAAATGTAAAATGACATAAATGTTGAAGT
rJMFF026H12- CATATGATAGAAAAGGGGGTAAAACAAAACTAAAATGTAAAATGACATAAATGTTGAAGT
rJMFF015M09- AGGGGGTAAAACAAAACTAAAATGTAAAATGACATAAATGTTGAAGT
                      ____________________________________________________________
consensus CATATGATAGAAAAGGGGGTAAAACAAAACTAAAATGTAAAATGACATAAATGTTGAAGT
 
. : . : . : . : . : . :
JMFN044P20+ GAAACAAGGCCTAATTTGGCAACTATAGCAACACAGTTACACTCTACACTTAGTTTCTAG
rJMFF026H12- GAAACAAGGCCTAATTTGGCAACTATAGCAACACAGTTACACTCTACACTTAGTTTCTAG
rJMFF015M09- GAAACAAGGCCTAATTTGGCAACTATAGCAACACAGTTACACTCTACACTTAGTTTCTAG
                      ____________________________________________________________
consensus GAAACAAGGCCTAATTTGGCAACTATAGCAACACAGTTACACTCTACACTTAGTTTCTAG
 
. : . : . : . : . : . :
JMFN044P20+ AGGAACAGTTATATAACTGACACCAAAGTGTAAAACAGATCTACACATTTCGAAACATCA
rJMFF026H12- AGGAACAGTTATATAACTGACACCAAAGTGTAAAACAGATCTACACATTTCGAAACATCA
rJMFF015M09- AGGAACAGTTATATAACTGACACCAAAGTGTAAAACAGATCTACACATTTCGAAACATCA
                      ____________________________________________________________
consensus AGGAACAGTTATATAACTGACACCAAAGTGTAAAACAGATCTACACATTTCGAAACATCA
 
. : . : . : . : . : . :
JMFN044P20+ CGGTTCAACTGTATTACCAAGTGCAAACGAGAACACTTCACGAACTGGAGGATACTCGAC
rJMFF026H12- CGGTTCAACTGTATTACCAAGTGCAAACGAGAACACTTCACGAACTGGAGGATACTCGAC
rJMFF015M09- CGGTTCAACTGTATTACCAAGTGCAAACGAGAACACTTCACGAACTGGAGGATACTCGAC
JMFF015M09+ CCAAGTGCAAACGAGAACACTTCACGAACTGGAGGATACTCGAC
JMFN028J14+ ATACTCGAC
                      ____________________________________________________________
consensus CGGTTCAACTGTATTACCAAGTGCAAACGAGAACACTTCACGAACTGGAGGATACTCGAC
 
. : . : . : . : . : . :
JMFN044P20+ GAGAGCAATATCCATCGCATAGCCAGAAACAGGCAATTTCAAGTCCCTTAATACAGTAAA
rJMFF026H12- GAGAGCAATATCCATCGCATAGCCAGAAACAGGCAATTTCAAGTCCCTTAATACAGTAAA
rJMFF015M09- GAGAGCAATATCCATCGCATAGCCAGAAACAGGCAA--TCAAGTCCCTTAATACAGTAAA
JMFF015M09+ GAGAGCAATATCCATCGCATAGCCAGAAACAGGCAA--TCAAGTCCCTTAATACAGTAAA
JMFN028J14+ GAGAGCAATATCCATCGCATAGCCAGAAACAGGCAATTTCAAGTCCCTTAATACAGTAAA
                      ____________________________________________________________
consensus GAGAGCAATATCCATCGCATAGCCAGAAACAGGCAATTTCAAGTCCCTTAATACAGTAAA
 
. : . : . : . : . : . :
JMFN044P20+ AGCCTCGGCCATACGAGTCTTGGGCACTTCTTCAGCTACCGGGCAATAGGGAAGCCACAT
rJMFF026H12- AGCCTCGGCCATACGAGTCTTGGGCACTTCTTCAGCTACCGGGCAATAGGGAAGCCACAT
rJMFF015M09- AGCCTCGGCCATACGAGTCTTGGGCACTTCTTCAGCTACCGGGCAATAGGGAAGCCACAT
JMFF015M09+ AGCCTCGGCCATACGAGTCTTGGGCACTTCTTCAGCTACCGGGCAATAGGGAAGCCACAT
JMFN028J14+ AGCCTCGGCCATACGAGTCTTGGGCACTTCTTCAGCTACCGGGCAATAGGGAAGCCACAT
                      ____________________________________________________________
consensus AGCCTCGGCCATACGAGTCTTGGGCACTTCTTCAGCTACCGGGCAATAGGGAAGCCACAT
 
. : . : . : . : . : . :
JMFN044P20+ GTCGGGGCGATACTCCTCCCCGATTTCAAGCCCTTCCTTTCTCATCGAATCAAACAACTG
rJMFF026H12- GTCGGGGCGATACTCCTCCCCGATTTCAAGCCCTTCCTTTCTCATCGAATCAAACAACTG
rJMFF015M09- GTCGGGGCGATACTCCTCCCCGATTTCAAGCCCTTCCTTTCTCATCGAATCAAACAACTG
JMFF015M09+ GTCGGGGCGATACTCCTCCCCGATTTCAAGCCCTTCCTTTCTCATCGAATCAAACAACTG
JMFN028J14+ GTCGGGGCGATACTCCTCCCCGATTTCAAGCCCTTCCTTTCTCATCGAATCAAACAACTG
                      ____________________________________________________________
consensus GTCGGGGCGATACTCCTCCCCGATTTCAAGCCCTTCCTTTCTCATCGAATCAAACAACTG
 
. : . : . : . : . : . :
JMFN044P20+ CGAATGAAACTGGAGGAGAGACAAGGTCGGGGTGGGGGCGAGAAAGAGAACATTG
rJMFF026H12- CGAATGAAACTGGAGGAGAGACAAGGTCGGGGTGGGGGCGAGAAAGAGAACATTGTTGTC
rJMFF015M09- CGAATGAAACTGGAGGAGAGACAAGGTCGGGGTGGGGGCGAGAAAGAGAACATTGTTGTC
JMFF015M09+ CGAATGAAACTGGAGGAGAGACAAGGTCGGGGTGGGGGCGAGAAAGAGAACATTGTTGTC
JMFN028J14+ CGAATGAAACTGGAGGAGAGACAAGGTCGGGGTGGGGGCGAGAAAGAGAACATTGTTGTC
JMFF026H12+ TGGAGGAGAGACAAGGTCGGGGTGGGGGCGAGAAAGAGAACATTGTTGTC
                      ____________________________________________________________
consensus CGAATGAAACTGGAGGAGAGACAAGGTCGGGGTGGGGGCGAGAAAGAGAACATTGTTGTC
 
. : . : . : . : . : . :
rJMFF026H12- ACTCGAGAGGCTCCCGATTGAAGCAAATGACA
rJMFF015M09- ACTCGAGAGGCTCCCGATTGAAGCAAATGACAGGGGCAAAGGTTCTTGCTTTGATGCGAA
JMFF015M09+ ACTCGAGAGGCTCCCGATTGAAGCAAATGACAGGGGCAAAGGTTCTTGCTTTGATGCGAA
JMFN028J14+ ACTCGAGAGGCTCCCGATTGAAGCAAATGACAGGGGCAAAGGTTCTTGCTTTGATGCGAA
JMFF026H12+ ACTCGAGAGGCTCCCGATTGAAGCAAATGACAGGGGCAAAGGTTCTTGCTTTGATGCGAA
                      ____________________________________________________________
consensus ACTCGAGAGGCTCCCGATTGAAGCAAATGACAGGGGCAAAGGTTCTTGCTTTGATGCGAA
 
. : . : . : . : . : . :
rJMFF015M09- ATTTTTCACTATGGTCTCCAGCTTCAAGGGATCACAGAAAGTGCTCGAGAACAGGGTAAT
JMFF015M09+ ATTTTTCACTATGGTCTCCAGCTTCAAGGGATCACAGAAAGTGCTCGAGAACAGGGTAAT
JMFN028J14+ ATTTTTCACTATGGTCTCCAGCTTCAAGGGATCACAGAAAGTGCTCGAGAACAGGGTAAT
JMFF026H12+ ATTTTTCACTATGGTCTCCAGCTTCAAGGGATCACAGAAAGTGCTCGAGAACAGGGTAAT
                      ____________________________________________________________
consensus ATTTTTCACTATGGTCTCCAGCTTCAAGGGATCACAGAAAGTGCTCGAGAACAGGGTAAT
 
. : . : . : . : . : . :
rJMFF015M09- GTGCGGTCTAGATTCGATTTCAATAAGCTGAGTGCTGATCTGTCGTCTAGCCAACACATT
JMFF015M09+ GTGCGGTCTAGATTCGATTTCAATAAGCTGAGTGCTGATCTGTCGTCTAGCCAACACATT
JMFN028J14+ GTGCGGTCTAGATTCGATTTCAATAAGCTGAGTGCTGATCTGTCGTCTAGCCAACACATT
JMFF026H12+ GTGCGGTCTAGATTCGATTTCAATAAGCTGAGTGCTGATCTGTCGTCTAGCCAACACATT
                      ____________________________________________________________
consensus GTGCGGTCTAGATTCGATTTCAATAAGCTGAGTGCTGATCTGTCGTCTAGCCAACACATT
 
. : . : . : . : . : . :
rJMFF015M09- CCAGGCCTTCAAGACCTGGTTCTCAAGTGCAGGATCAAAGTAAAGCTCAATTGCATAGCC
JMFF015M09+ CCAGGCCTTCAAGACCTGGTTCTCAAGTGCAGGATCAAAGTAAAGCTCAATTGCATAGCC
JMFN028J14+ CCAGGCCTTCAAGACCTGGTTCTCAAGTGCAGGATCAAAGTAAAGCTCAATTGCATAGCC
JMFF026H12+ CCAGGCCTTCAAGACCTGGTTCTCAAGTGCAGGATCAAAGTAAAGCTCAATTGCATAGCC
                      ____________________________________________________________
consensus CCAGGCCTTCAAGACCTGGTTCTCAAGTGCAGGATCAAAGTAAAGCTCAATTGCATAGCC
 
. : . : . : . : . : . :
rJMFF015M09- CTGCGACATTGCCTCCAATTC
JMFF015M09+ CTGCGACATTGCCTCCAATTCAGATTAGAGGCAAATAAGGGGGAAAAGAACCTGAAGACG
JMFN028J14+ CTGCGACATTGCCTCCAATTCAGATTAGAGGCAAATAA--GGGAAAAGAACCTGAAGACG
JMFF026H12+ CTGCGACATTGCCTCCAATTCAGATTAGAGGCAAATAAGGGGGAAAAGAACCTGAAGACG
                      ____________________________________________________________
consensus CTGCGACATTGCCTCCAATTCAGATTAGAGGCAAATAAGGGGGAAAAGAACCTGAAGACG
 
. : . : . : . : . : . :
JMFF015M09+ AGATCCCAATAATTGGAAAC
JMFN028J14+ AGATCCCAATAATTGGAAACGAGGAAAAATGGC
JMFF026H12+ AGATCCCAATAATTGGAAACGAGGAAAAATGGCAAAAATTATAGGGTTAACAGAGAGTGA
                      ____________________________________________________________
consensus AGATCCCAATAATTGGAAACGAGGAAAAATGGCAAAAATTATAGGGTTAACAGAGAGTGA
 
. : . : . : . : . : . :
JMFF026H12+ GGAAGTACGGGTTAAAGAAAACTGGGAGATTGAAATCCGAAAAGGACAGAGGGAATATGG
                      ____________________________________________________________
consensus GGAAGTACGGGTTAAAGAAAACTGGGAGATTGAAATCCGAAAAGGACAGAGGGAATATGG
 
. : . : . : . : . : . :
JMFF026H12+ AGTGGTAATAAAGAGCGAGAAGAGGGAGTGTCCCAAAGGAAAAGTTTTTGACAAAGGGGA
                      ____________________________________________________________
consensus AGTGGTAATAAAGAGCGAGAAGAGGGAGTGTCCCAAAGGAAAAGTTTTTGACAAAGGGGA
 
. : . : . : . : . : . :
JMFF026H12+ GTGTTAATGCAGGGTCGGAAAGACTCCAAGAACTTGTCTTCTACTCTTTTGTGTTCCTAT
                      ____________________________________________________________
consensus GTGTTAATGCAGGGTCGGAAAGACTCCAAGAACTTGTCTTCTACTCTTTTGTGTTCCTAT