Previous Contig 001247:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF026G20Sequence536001247 (14)gb:AY239610_21444205e-52Synthetic construct 26S proteasome subunit RPN2A (RPN2A) gene, partial cds.718009446 (2)pir|T00795|T007953e-4426S proteasome regulatory subunit [imported] - Arabidopsis thaliana>gb:AC003974_
JMFS017D01Sequence633001247 (14)gb:AY239610_21444202e-68Synthetic construct 26S proteasome subunit RPN2A (RPN2A) gene, partial cds.
JMFS040E11Sequence619001247 (14)gb:AY239610_21444209e-68Synthetic construct 26S proteasome subunit RPN2A (RPN2A) gene, partial cds.
JMFS044D09Sequence627001247 (14)gb:AY242527_15923828e-46Arabidopsis thaliana 26S proteasome subunit RPN2b (RPN2b) mRNA, partial cds.
JMFS067C12Sequence626001247 (14)gb:AY239610_21444206e-79Synthetic construct 26S proteasome subunit RPN2A (RPN2A) gene, partial cds.
JMFS081F02Sequence615001247 (14)gb:AY239610_21444206e-70Synthetic construct 26S proteasome subunit RPN2A (RPN2A) gene, partial cds.
JMFS090C03Sequence613001247 (14)gb:AY239610_21444201e-76Synthetic construct 26S proteasome subunit RPN2A (RPN2A) gene, partial cds.
JMFS095D04Sequence635001247 (14)gb:AY242527_15923824e-55Arabidopsis thaliana 26S proteasome subunit RPN2b (RPN2b) mRNA, partial cds.
JMFS106E08Sequence627001247 (14)gb:AY242527_15923821e-58Arabidopsis thaliana 26S proteasome subunit RPN2b (RPN2b) mRNA, partial cds.
JMFS120F09Sequence627001247 (14)gb:AY239610_21444204e-80Synthetic construct 26S proteasome subunit RPN2A (RPN2A) gene, partial cds.
JMFS126E12Sequence593001247 (14)gb:AY239610_21444205e-63Synthetic construct 26S proteasome subunit RPN2A (RPN2A) gene, partial cds.
JMFS129A02Sequence466001247 (14)gb:AY239610_21444205e-35Synthetic construct 26S proteasome subunit RPN2A (RPN2A) gene, partial cds.
JMFS146D01Sequence627001247 (14)gb:AY239610_21444204e-80Synthetic construct 26S proteasome subunit RPN2A (RPN2A) gene, partial cds.
JMSF023D01Sequence649001247 (14)gb:AY239610_21444201e-80Synthetic construct 26S proteasome subunit RPN2A (RPN2A) gene, partial cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS044D09+ AACAGACTGCTTAATTGTCTTGAGAATTAGGAGAT
                      ____________________________________________________________
consensus AACAGACTGCTTAATTGTCTTGAGAATTAGGAGAT
 
. : . : . : . : . : . :
JMFS044D09+ CCGATCTATATGAGAATATCAAGAATATGAATACTAATTATTTGACAAGTCAAACAACAA
                      ____________________________________________________________
consensus CCGATCTATATGAGAATATCAAGAATATGAATACTAATTATTTGACAAGTCAAACAACAA
 
. : . : . : . : . : . :
JMFS044D09+ AATTTAGCACATGGAAATTGAGAAATTGATAAGAGCCTTACTTATTATGTCTATACAAGA
JMFS106E08+ TTATTATGTCTATACAAGA
                      ____________________________________________________________
consensus AATTTAGCACATGGAAATTGAGAAATTGATAAGAGCCTTACTTATTATGTCTATACAAGA
 
. : . : . : . : . : . :
JMFS044D09+ ACTGCAAGGTCAACTGTATTGCAGTTTCTCCAGATAAAATGCCTTTTATTTTTGCCAACC
JMFS106E08+ ACTGCAAGGTCAACTGTATTGCAGTTTCTCCAGATAAAATGCCTTTTATTTTTGCCAACC
                      ____________________________________________________________
consensus ACTGCAAGGTCAACTGTATTGCAGTTTCTCCAGATAAAATGCCTTTTATTTTTGCCAACC
 
. : . : . : . : . : . :
JMFS044D09+ TCTCTGCATAAGTTGCTTCCTTTGGATCCACAATAGGTACATCCCTGCTTGACGCTTGGG
JMFS106E08+ TCTCTGCATAAGTTGCTTCCTTTGGATCCACAATAGGTACATCCCTGCTTGACGCTTGGG
JMFS095D04+ GCATAAGTTGCTTCCTTCGGATCCACAATTGATACATCCCTGCTTGACACTTGGG
                      ____________________________________________________________
consensus TCTCTGCATAAGTTGCTTCCTTTGGATCCACAATAGGTACATCCCTGCTTGACGCTTGGG
 
. : . : . : . : . : . :
JMFS044D09+ AATCTTCTGCCATCTGAACATCCTCAGGAGCATCCGTGTTTCCAGTTTCTGCAGTGCCTG
JMFS106E08+ AATCTTCTGCCATCTGAACATCCTCAGGAGCATCCGTGTTTCCAGTTTCTGCAGTGCCTG
JMFS095D04+ AATCATCCATCATCTGAGCATCCTCATGGGCATCGGTATTTCCAGCTTGTGCTGTGCCTG
                      ____________________________________________________________
consensus AATCTTCTGCCATCTGAACATCCTCAGGAGCATCCGTGTTTCCAGTTTCTGCAGTGCCTG
 
. : . : . : . : . : . :
JMFS044D09+ GCTCAGTGGGACCCGCCTGCACAGGTTCTGAAGGTTGTATCATGGGACTAGAAAGTCGGT
JMFS106E08+ GCTCAGTGGGACCCGCCTGCACAGGTTCTGAAGGTTGTATCATGGGACTAGAAAGTCGGT
JMFS095D04+ GATTAGTGGAGTTGGATTGTACAGGTTCTGAAGTTTGTAGCTTGGGACTGGAAAGTCGGT
                      ____________________________________________________________
consensus GCTCAGTGGGACCCGCCTGCACAGGTTCTGAAGGTTGTATCATGGGACTAGAAAGTCGGT
 
. : . : . : . : . : . :
JMFS044D09+ CTCTCACACTAAGTAGAAAAACTTGATTTTCACTCTCTAAAAGCTAAAAAGCTATTTGAA
JMFS106E08+ CTCTCACACTAAGTAGAAAAACTTGATTTTCACTCTCTAAAAGCTCAAAAGCTATTTGAA
JMFS095D04+ CTCTCACACTGAGTAGAAAAACTTGATTTTCACTCTCTACAAGCTCAAAAGCTATTTGAA
                      ____________________________________________________________
consensus CTCTCACACTAAGTAGAAAAACTTGATTTTCACTCTCTAAAAGCTCAAAAGCTATTTGAA
 
. : . : . : . : . : . :
JMFS044D09+ ATGCCATCAGAGCATCATTCCTATCATCTGAGCGCAGAAGTTTCTCCAGTATGGCTGCAG
JMFS106E08+ ATGCCATCAGAGCATCATTCCTATCATCTGAGCGCAGAAGTTTCTCCAGTATGGCTGCAG
JMFS095D04+ ATGCCATTAGAGCATCATTCCTATTATCTGAGCGCAGAAGTTTCTCTAATATGGCTGCAG
JMFS090C03+ TATGGCTGCAG
                      ____________________________________________________________
consensus ATGCCATCAGAGCATCATTCCTATCATCTGAGCGCAGAAGTTTCTCCAGTATGGCTGCAG
 
. : . : . : . : . : . :
JMFS044D09+ CATCATTTGGTTTATCTAGGAACATAAGCCACTGACAAATGCTCAAATAATTGGGTGATG
JMFS106E08+ CATCATTTGGTTTATCTAGGAACATAAGCCACTGACAAATGCTCAAATAATTGGGTGATG
JMFS095D04+ CATCATTTGGTTTATCCAGGAACATAAGCCACTGACAAATGCTTAAATAATTGGGAGATG
JMFS090C03+ CATCATTTGGTTTATCCAGGAACATAAGCCACTGACAAATGCTTAAATAATTGGGAGATG
                      ____________________________________________________________
consensus CATCATTTGGTTTATCTAGGAACATAAGCCACTGACAAATGCTTAAATAATTGGGTGATG
 
. : . : . : . : . : . :
JMFS044D09+ CAGACTTCTGGTACACATCAACAAGGAGACGGAGCACCT
JMFS106E08+ CAGACTTCTGGTACACATCAACAAGGAGACGGAGCACCTCACGTCTAAATTCCCTACGGT
JMFS095D04+ CTGACTTCTGGTACACATCAACAAGGAGTCGGAGCACCTCACGTCTAAATTCCCTACGGT
JMFS090C03+ CTGACTTCTGGTACACATCAACAAGGAGTCGGAGCACCTCACGTCTAAATTCCCTACGGT
JMFS146D01+ CGGT
JMFS120F09+ CGGT
JMSF023D01+ ACGGT
                      ____________________________________________________________
consensus CTGACTTCTGGTACACATCAACAAGGAGTCGGAGCACCTCACGTCTAAATTCCCTACGGT
 
. : . : . : . : . : . :
JMFS106E08+ TGACAAAGTTGTGGGACACATTACTGCAATACATCAAAGCTGCATCAAGATTATCACTC
JMFS095D04+ TAACAAAGTTGTGGGACACATTACTGCAATACGTCAAAGCTGCATCAAGATTATCACTCC
JMFS090C03+ TAACAAAGTTGTGGGACACATTACTGCAATACGTCAAAGCTGCATCAAGATTATCACTCC
JMFS146D01+ TAACAAAGTTGTGGGACACATTACTGCAATACGTCAAAGCTGCATCAAGATTATCACTCC
JMFS120F09+ TAACAAAGTTGTGGGACACATTACTGCAATACGTCAAAGCTGCATCAAGATTATCACTCC
JMFS067C12+ AAAGTTGTGGGACACATTACTGCAATACGTCAAAGCTGCATCAAGATTATCACTCC
JMSF023D01+ TAACAAAGTTGTGGGACACATTACTGCAATACGTCAAAGCTGCATCAAGATTATCACTCC
JMFS017D01+ CC
                      ____________________________________________________________
consensus TAACAAAGTTGTGGGACACATTACTGCAATACGTCAAAGCTGCATCAAGATTATCACTCC
 
. : . : . : . : . : . :
JMFS095D04+ TTACAATTGCTTCAGCAACTTTATCTAACCT-CCGGCACTCTATTGCCATTCCAATGGCC
JMFS090C03+ TTACAATTGCTTCAGCAACTTTATCTAACCT-CCGGCACTCTATTGCCATTCCAATGGCC
JMFS146D01+ TTACAATTGCTTCAGCAACTTTATCTAACCT-CCGGCACTCTATTGCCATTCCAATGGCC
JMFS120F09+ TTACAATTGCTTCAGCAACTTTATCTAACCT-CCGGCACTCTATTGCCATTCCAATGGCC
JMFS067C12+ TTACAATTGCTTCAGCAACTTTATCTAACCT-CCGGCACTCTATTGCCATTCCAATGGCC
JMSF023D01+ TTACAATTGCTTCAGCAACTTTATCTAACCT-CCGGCACTCTATTGCCATTCCAATGGCC
JMFS081F02+ TTCAGCAACTTTATCTAACCT-CCGGCACTCTATTGCCATTCCAATGGCC
JMFS017D01+ TTACAATTGCTTCAGCAAC-TTATCTAACCTCCCGGCACTCTATTGCCATTCCAATGGCC
JMFS040E11+ ATCTAACCT-CCGGCACTCTATTGCCATTCCAATGGCC
JMFS126E12+ TGGCC
                      ____________________________________________________________
consensus TTACAATTGCTTCAGCAACTTTATCTAACCT-CCGGCACTCTATTGCCATTCCAATGGCC
 
. : . : . : . : . : . :
JMFS095D04+ TGTTGATATTTTCCATCCACTATGCACTTATCAAGCATTCTTTCAACAATGGCTTCCATC
JMFS090C03+ TGTTGATATTTTCCATCCACTATGCACTTATCAAGCATTCTTTCAACAATGGCTTCCATC
JMFS146D01+ TGTTGATATTTTCCATCCACTATGCACTTATCAAGCATTCTTTCAACAATGGCTTCCATC
JMFS120F09+ TGTTGATATTTTCCATCCACTATGCACTTATCAAGCATTCTTTCAACAATGGCTTCCATC
JMFS067C12+ TGTTGATATTTTCCATCCACTATGCACTTATCAAGCATTCTTTCAACAATGGCTTCCATC
JMSF023D01+ TGTTGATATTTTCCATCCACTATGCACTTATCAAGCATTCTTTCAACAATGGCTTCCATC
JMFS081F02+ TGTTGATATTTTCCATCCACTATGCACTTATCAAGCATTCTTTCAACAATGGCTTCCATC
JMFS129A02+ CAATGGCTTCCATC
JMFS017D01+ TGTTGATATTTTCCATCCACTATGCACTTATCAAGCATTCTTTCAACAATGGCTTCCATC
JMFS040E11+ TGTTGATATTTTCCATCCACTATGCACTANTCAAGCATTCTTTCAACAATGGCTTCCATC
JMFS126E12+ TGTTGATATTTTCCATCCACTATGCACTTATCAAGCATTCTTTCAACAATGGCTTCCATC
                      ____________________________________________________________
consensus TGTTGATATTTTCCATCCACTATGCACTTATCAAGCATTCTTTCAACAATGGCTTCCATC
 
. : . : . : . : . : . :
JMFS095D04+ CTAGGATCCACATCAGCTGCCTCATCATTTGACTCAGCAG
JMFS090C03+ CTAGGATCCACATCAGCTGCCTCATCATTTGACTCAGCAGCCTTAGTCTTTCTGCTAGCA
JMFS146D01+ CTAGGATCCACATCAGCTGCCTCATCATTTGACTCAGCAGCCTTAGTCTTTCTGCTAGCA
JMFS120F09+ CTAGGATCCACATCAGCTGCCTCATCATTTGACTCAGCAGCCTTAGTCTTTCTGCTAGCA
JMFS067C12+ CTAGGATCCACATCAGCTGCCTCATCATTTGACTCAGCAGCCTTAGTCTTTCTGCTAGCA
JMSF023D01+ CTAGGATCCACATCAGCTGCCTCATCATTTGACTCAGCAGCCTTAGTCTTTCTGCTAGCA
JMFS081F02+ CTAGGATCCACATCAGCTGCCTCATCATTTGACTCAGCAGCCTTAGTCTTTCTGCTAGCA
JMFS129A02+ GTAGGATCCACATCAGCTGCCTCATCATTTGGTGCAGCAGCGGTAGTCGGTCTGGTAGCA
JMFS017D01+ CTAGGATCCACATCAGCTGCCTCATCATTTGACTCAGCAGCCTTAGTCTTTCTGCTAGCA
JMFS040E11+ CTAGGATCCACATCAGCTGCCTCATCATTTGACTCAGCAGCCTTAGTCTTTCTGCTAGCA
JMFS126E12+ CTAGGATCCACATCAGCTGCCTCATCATTTGACTCAGCAGCCTTAGTCTTTCTGCTAGCA
JMFF026G20+ CTAGGATCCACATCAGCTGCCTCATCATTTGACTCAGCAGCCTTAGTCTTTCTGCTAGCA
                      ____________________________________________________________
consensus CTAGGATCCACATCAGCTGCCTCATCATTTGACTCAGCAGCCTTAGTCTTTCTGCTAGCA
 
. : . : . : . : . : . :
JMFS090C03+ TATTCATCTAGTGCTTTAGCAAGAAGAGTATGGACATAATCAGACTCCTCAGAAACATCA
JMFS146D01+ TATTCATCTAGTGCTTTAGCAAGAAGAGTATGGACATAATCAGACTCCTCAGAAACATCA
JMFS120F09+ TATTCATCTAGTGCTTTAGCAAGAAGAGTATGGACATAATCAGACTCCTCAGAAACATCA
JMFS067C12+ TATTCATCTAGTGCTTTAGCAAGAAGAGTATGGACATAATCAGACTCCTCAGAAACATCA
JMSF023D01+ TATTCATCTAGTGCTTTAGCAAGAAGAGTATGGACATAATCAGACTCCTCAGAAACATCA
JMFS081F02+ TATTCATCTAGTGCTTTAGCAAGAAGAGTATGGACATAATCAGACTCCTCAGAAACATCA
JMFS129A02+ TATTCATGTAGTACTTTAGCAAGAAGAGTATGGACATATTCAGACTCCTCAGGGGCATCA
JMFS017D01+ TATTCATCTAGTGCTTTAGCAAGAAGAGTATGGACATAATCAGACTCCTCAGAAACATCA
JMFS040E11+ TATTCATCTAGTGCTTTAGCAAGAAGAGTATGGACATAATCAGACTCCTCAGAAACATCA
JMFS126E12+ TATTCATCTAGTGCTTTAGCAAGAAGAGTATGGACATAATCAGACTCCTCAGAAACATCA
JMFF026G20+ TATTCATCTAGTGCTTTAGCAAGAAGAGTATGGACATAATCAGACTCCTCAGAAACATCA
                      ____________________________________________________________
consensus TATTCATCTAGTGCTTTAGCAAGAAGAGTATGGACATAATCAGACTCCTCAGAAACATCA
 
. : . : . : . : . : . :
JMFS090C03+ AATAGAGGGCCGGCCCCAAGCGCATAAGATAATGAATCATTAAGATCTCCCAAATAATAG
JMFS146D01+ AATAGAGGGCCGGCCCCAAGCGCATAAGATAATGAATCATTAAGATCTCCCAAATAATAG
JMFS120F09+ AATAGAGGGCCGGCCCCAAGCGCATAAGATAATGAATCATTAAGATCTCCCAAATAATAG
JMFS067C12+ AATAGAGGGCCGGCCCCAAGCGCATAAGATAATGAATCATTAAGATCTCCCAAATAATAG
JMSF023D01+ AATAGAGGGCCGGCCCCAAGCGCATAAGATAATGAATCATTAAGATCTCCCAAATAATAG
JMFS081F02+ AATAGAGGGCCGGCCCCAAGCGCATAAGATAATGAATCATTAAGATCTCCCAAATAATAG
JMFS129A02+ AATAGAGGGCCGGCCCCAAGCGCATAAGATAATGCATCATTAAGATCTCCCAAATAATAG
JMFS017D01+ AATAGAGGGCCGGCCCCAAGCGCATAAGATAATGAATCATTAAGATCTCCCAAATAATAG
JMFS040E11+ AATAGAGGGCCGGCCCCAAGCGCATAAGATAATGAATCATTAAGATCTCCCAAATAATAG
JMFS126E12+ AATAGAGGGCCGGCCCCAAGCGCATAAGATAATGAATCATTAAGATCTCCCAAATAATAG
JMFF026G20+ AATAGAGGGCCGGCCCCAAGCGCATAAGATAATGAATCATTAAGATCTCCCAAATAATAG
                      ____________________________________________________________
consensus AATAGAGGGCCGGCCCCAAGCGCATAAGATAATGAATCATTAAGATCTCCCAAATAATAG
 
. : . : . : . : . : . :
JMFS090C03+ AAGACCTTAGAAACAAGTAATGCAGCA-AGTTGTCTC-TG-ATCAAATTCCTCATCCTCA
JMFS146D01+ AAGACCTTAGAAACAAGTAATGCAGCA-AGTTGTCTC-TG-ATCAAATTCCTCATCCTCA
JMFS120F09+ AAGACCTTAGAAACAAGTAATGCAGCA-AGTTGTCTC-TG-ATCAAATTCCTCATCCTCA
JMFS067C12+ AAGACCTTAGAAACAAGTAATGCAGCA-AGTTGTCTC-TG-ATCAAATTCCTCATCCTCA
JMSF023D01+ AAGACCTTAGAAACAAGTAATGCAGCA-AGTTGTCTC-TG-ATCAAATTCCTCATCCTCA
JMFS081F02+ AAGACCTTAGAAACAAGTAATGCAGCA-AGTTGTCTC-TG-ATCAAATTCCTCATCCTCA
JMFS129A02+ AAGACGTTAGAAGCAAGTAATGCAGCAGAGTTGTCTCATGTATCAAATTCCTCATCGTCA
JMFS017D01+ AAGACCTTAGAAACAAGTAATGCAGCA-AGTTGTCTC-TG-ATCAAATTCCTCATCCTCA
JMFS040E11+ AAGACCTTAGAAACAAGTAATGCAGCA-AGTTGTCTC-TG-ATCAAATTCCTCATCCTCA
JMFS126E12+ AAGACCTTAGAAACAAGTAATGCAGCA-AGTTGTCTC-TG-ATCAAATTCCTCATCCTCA
JMFF026G20+ AAGACCTTAGAAACAAGTAATGCAGCA-AGTTGTCTC-TG-ATCAAATTCCTCATCCTCA
                      ____________________________________________________________
consensus AAGACCTTAGAAACAAGTAATGCAGCA-AGTTGTCTC-TG-ATCAAATTCCTCATCCTCA
 
. : . : . : . : . : . :
JMFS090C03+ TACAAACTTTCTATGACGGGGACCGAGGTAGAGATCTCTGGCCAGAAGTAATCGACAAAT
JMFS146D01+ TACAAACTTTCTATGACGGGGACCGAGGTAGAGATCTCTGGCCAGAAGTAATCGACAAAT
JMFS120F09+ TACAAACTTTCTATGACGGGGACCGAGGTAGAGATCTCTGGCCAGAAGTAATCGACAAAT
JMFS067C12+ TACAAACTTTCTATGACGGGGACCGAGGTAGAGATCTCTGGCCAGAAGTAATCGACAAAT
JMSF023D01+ TACAAACTTTCTATGACGGGGACCGAGGTAGAGATCTCTGGCCAGAAGTAATCGACAAAT
JMFS081F02+ TACAAACTTTCTATGACGGGGACCGAGGTAGAGATCTCTGGCCAGAAGTAATCGACAAAT
JMFS129A02+ TGCCAACTTTGTATGCCGGGGACCGAGGTAGAGATCTATGGCCAGAAGTAATGGACAAAT
JMFS017D01+ TACAAACTTTCTATGACGGGGACCGAGGTAGAGATCTCTGGCCAGAAGTAATCGACAAAT
JMFS040E11+ TACAAACTTTCTATGACGGGGACCGAGGTAGAGATCTCTGGCCAGAAGTAATCGACAAAT
JMFS126E12+ TACAAACTTTCTATGACGGGGACCGAGGTAGAGATCTCTGGCCAGAAGTAATCGACAAAT
JMFF026G20+ TACAAACTTTCTATGACGGGGACCGAGGTAGAGATCTCTGGCCAGAAGTAATCGACAAAT
                      ____________________________________________________________
consensus TACAAACTTTCTATGACGGGGACCGAGGTAGAGATCTCTGGCCAGAAGTAATCGACAAAT
 
. : . : . : . : . : . :
JMFS090C03+ GT
JMFS146D01+ GTGTTGAGATTAGTGAGCGCATGGAGTTTGAGCGCCGGGTGGCTCTC-GTTGAGCATCGC
JMFS120F09+ GTGTTGAGATTAGTGAGCGCATGGAGTTTGAGCGCCGGGTGGCTCTC-GTTGAGCATCGC
JMFS067C12+ GTGTTGAGATTAGTGAGCGCATGGAGTTTGAGCGCCGGGTGGCTCTC-GTTGAGCATCGC
JMSF023D01+ GTGTTGAGATTAGTGAGCGCATGGAGTTTGAGCGCCGGGTGGCTCTC-GTTGAGCATCGC
JMFS081F02+ GTGTTGAGATTAGTGAGCGCATGGAGTTTGAGCGCCGGGTGGCTCTC-GTTGAGCATCGC
JMFS129A02+ GTGTTGAGATTAGTCAGCGCATGGAGTTTGAGTGCCGGGTGGCTCTCTCTTGAGCATCGC
JMFS017D01+ GTGTTGAGATTAGTGAGCGCATGGAGTTTGAGCGCCGGGTGGCTCTC-GTTGAGCATCGC
JMFS040E11+ GTGTTGAGATTAGTGAGCGCATGGAGTTTGAGCGCCGGGTGGCTCTC-GTTGAGCATCGC
JMFS126E12+ GTGTTGAGATTAGTGAGCGCATGGAGTTTGAGCGCCGGGTGGCTCTC-GTTGAGCATCGC
JMFF026G20+ GTGTTGAGATTAGTGAGCGCATGGAGTTTGAGCGCCGGGTGGCTCTC-GTTGAGCATCGC
                      ____________________________________________________________
consensus GTGTTGAGATTAGTGAGCGCATGGAGTTTGAGCGCCGGGTGGCTCTC-GTTGAGCATCGC
 
. : . : . : . : . : . :
JMFS146D01+ CAATAGTCCTCCAGCTGAGGACACCATCGTCGCTGTCGATGCCATCGTGGTTAAAATTCA
JMFS120F09+ CAATAGTCCTCCAGCTGAGGACACCATCGTCGCTGTCGATGCCATCGTGGTTAAAATTCA
JMFS067C12+ CAATAGTCCTCCAGCTGAGGACACCATCGTCGCTGTCGATGCCATCGTGGTTAAAATTCA
JMSF023D01+ CAATAGTCCTCCAGCTGAGGACACCATCGTCGCTGTCGATGCCATCGTGGTTAAAATTCA
JMFS081F02+ CAATAGTCCTCCAGCTGAGGACACCATCGTCGCTGTCGATGCCATCGTGGTTAAAATTCA
JMFS129A02+ CGATAGTCTTCCAGTTGTGGTCGCCGGCGTCGCCGTTGATGCCATCGTGGTTAAAATGCA
JMFS017D01+ CAATAGTCCTCCAGCTGAGGACACCATCGTCGCTGTCGATGCCATCGTGGTTAAAATTCA
JMFS040E11+ CAATAGTCCTCCAGCTGAGGACACCATCGTCGCTGTCGATGCCATCGTGGTTAAAATTCA
JMFS126E12+ CAATAGTCCTCCAGCTGAGGACACCATCGTCGCTGTCGATGCCATCGTGGTTAAAATTCA
JMFF026G20+ CAATAGTCCTCCAGCTGAGGACACCATCGTCGCTGTCGATGCCATCGTGGTTAAAATTCA
                      ____________________________________________________________
consensus CAATAGTCCTCCAGCTGAGGACACCATCGTCGCTGTCGATGCCATCGTGGTTAAAATTCA
 
. : . : . : . : . : . :
JMFS146D01+ GTTTCTTGCACGATAGATATATAAACTA
JMFS120F09+ GTTTCTTGCACGATAGATATATAAACTA
JMFS067C12+ GTTTCTTGCACGATAGATATATAAACTAGCGAGAG
JMSF023D01+ GTTTCTTGCACGATAGATATATAAACTAGCGAGAGGGTTTGGATCGGC
JMFS081F02+ GTTTCTTGCACGATAGATATATAAACTAGCGAGAGGGTTTGGATCGGCAGAAGAAAGGTT
JMFS129A02+ GTTTCTCGCTCGATGTATATATAAAC
JMFS017D01+ GTTTCTTGCACGATAGATATATAAACTAGCGAGAGGGTTTGGATCGGCAGAAGAAAGGTT
JMFS040E11+ GTTTCTTGCACGATAGATATATAAACTAGCGAGAGGGTTTGGATCGGCAGAAGAAAGGTT
JMFS126E12+ GTTTCTTGCACGATAGATATATAAACTAGCGAGAGGGTTTGGATCGGCAGAAGAAAGGTT
JMFF026G20+ GTTTCTTGCACGATAGATATATAAACTAGCGAGAGGGTTTGGATCGGCAGAAGAAAGGTT
                      ____________________________________________________________
consensus GTTTCTTGCACGATAGATATATAAACTAGCGAGAGGGTTTGGATCGGCAGAAGAAAGGTT
 
. : . : . : . : . : . :
JMFS081F02+ TCTACCGTGAAATGGAAACCCTATTTAAAA
JMFS017D01+ TCTACCGTGAAATGGAAACCCTATTTAAAAGTTTTC
JMFS040E11+ TCTACCGTGAAATGGAAACCCTATTTAAAAGTTTTCTTGTTG
JMFS126E12+ TCTACCGTGAAATGGAAACCCTATTTAAAAGTTTTCTTGTTG
JMFF026G20+ TCTACCGTGAAATGGAAACCCTATTTAAAAGTTTTCTTGTTGACAGGGAAAAGTCCCAAC
                      ____________________________________________________________
consensus TCTACCGTGAAATGGAAACCCTATTTAAAAGTTTTCTTGTTGACAGGGAAAAGTCCCAAC