Previous Contig 001245:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF004E05Sequence614001245 (85)gb:AY157315_15854251e-78Stevia rebaudiana elongation factor 1 alpha mRNA, complete cds.657001245 (85)gb:AF464925_18020283e-86Elaeis oleifera elongation factor 1-alpha mRNA, complete cds.
JMFF004I09Sequence574001245 (85)gb:AY378166_16038252e-88Cichorium intybus elongation factor 1-alpha mRNA, complete cds.660001245 (85)gb:AF464925_18020281e-87Elaeis oleifera elongation factor 1-alpha mRNA, complete cds.
JMFF005E02Sequence478001245 (85)pir|S17434|S174348e-69translation elongation factor eEF-1 alpha chain (gene tefS1) - soybean658001245 (85)gb:AF464925_18020282e-82Elaeis oleifera elongation factor 1-alpha mRNA, complete cds.
JMFF007I05Sequence577001245 (85)gb:AY378166_16038253e-90Cichorium intybus elongation factor 1-alpha mRNA, complete cds.682001245 (85)gb:AF464925_18020281e-92Elaeis oleifera elongation factor 1-alpha mRNA, complete cds.
JMFF008I12Sequence622001245 (85)gb:AB061263_15220241e-98Solanum tuberosum EF-1-alpha mRNA for Elongation factor 1-alpha, complete cds.715001245 (85)gb:AF464925_18020282e-96Elaeis oleifera elongation factor 1-alpha mRNA, complete cds.
JMFF011P18Sequence581001245 (85)gb:AY378166_16038258e-90Cichorium intybus elongation factor 1-alpha mRNA, complete cds.672001245 (85)gb:AF464925_18020286e-87Elaeis oleifera elongation factor 1-alpha mRNA, complete cds.
JMFF014C04Sequence546001245 (85)gb:AY378166_16038251e-84Cichorium intybus elongation factor 1-alpha mRNA, complete cds.673001245 (85)gb:AF464925_18020287e-86Elaeis oleifera elongation factor 1-alpha mRNA, complete cds.
JMFF014G02Sequence576001245 (85)gb:AY378166_16038253e-90Cichorium intybus elongation factor 1-alpha mRNA, complete cds.673001245 (85)gb:AF464925_18020286e-87Elaeis oleifera elongation factor 1-alpha mRNA, complete cds.
JMFF015B06Sequence573001245 (85)gb:AY378166_16038251e-87Cichorium intybus elongation factor 1-alpha mRNA, complete cds.686001245 (85)gb:AF464925_18020281e-92Elaeis oleifera elongation factor 1-alpha mRNA, complete cds.
JMFF015L15Sequence564001245 (85)gb:AY378166_16038253e-76Cichorium intybus elongation factor 1-alpha mRNA, complete cds.
JMFF016E05Sequence575001245 (85)gb:AY378166_16038256e-89Cichorium intybus elongation factor 1-alpha mRNA, complete cds.707001245 (85)gb:AF464925_18020282e-98Elaeis oleifera elongation factor 1-alpha mRNA, complete cds.
JMFF016M22Sequence551001245 (85)gb:AY378166_16038257e-84Cichorium intybus elongation factor 1-alpha mRNA, complete cds.651001245 (85)gb:AF464925_18020284e-86Elaeis oleifera elongation factor 1-alpha mRNA, complete cds.
JMFF017B20Sequence575001245 (85)gb:AY378166_16038254e-89Cichorium intybus elongation factor 1-alpha mRNA, complete cds.669001245 (85)gb:AF464925_18020282e-86Elaeis oleifera elongation factor 1-alpha mRNA, complete cds.
JMFF017D06Sequence578001245 (85)gb:AY378166_16038253e-90Cichorium intybus elongation factor 1-alpha mRNA, complete cds.718001245 (85)gb:AF464925_18020288e-99Elaeis oleifera elongation factor 1-alpha mRNA, complete cds.
JMFF017H01Sequence547001245 (85)gb:AY378166_16038251e-84Cichorium intybus elongation factor 1-alpha mRNA, complete cds.755001245 (85)gb:TOBBY2A_17253671e-99Nicotiana tabacum mRNA for elongation factor-1 alpha, complete cds.
JMFF018B02Sequence582001245 (85)gb:AY378166_16038252e-85Cichorium intybus elongation factor 1-alpha mRNA, complete cds.671001245 (85)gb:AF464925_18020286e-87Elaeis oleifera elongation factor 1-alpha mRNA, complete cds.
JMFF018I02Sequence551001245 (85)gb:AY378166_16038254e-84Cichorium intybus elongation factor 1-alpha mRNA, complete cds.
JMFF019B09Sequence581001245 (85)gb:AY378166_16038253e-90Cichorium intybus elongation factor 1-alpha mRNA, complete cds.653001245 (85)gb:AF464925_18020282e-86Elaeis oleifera elongation factor 1-alpha mRNA, complete cds.
JMFF019I10Sequence577001245 (85)gb:AY378166_16038253e-90Cichorium intybus elongation factor 1-alpha mRNA, complete cds.610001245 (85)gb:AB106676_15266838e-75Avicennia marina EF1-A mRNA for elongation factor 1A, complete cds.
JMFF022C20Sequence519001245 (85)gb:AY378166_16038256e-77Cichorium intybus elongation factor 1-alpha mRNA, complete cds.697001245 (85)gb:AF464925_18020284e-97Elaeis oleifera elongation factor 1-alpha mRNA, complete cds.
JMFF024F06Sequence473001245 (85)pir|S17434|S174342e-68translation elongation factor eEF-1 alpha chain (gene tefS1) - soybean747001245 (85)gb:AY157315_1585425e-103Stevia rebaudiana elongation factor 1 alpha mRNA, complete cds.
JMFF025C19Sequence380001245 (85)gb:AF464925_18020281e-32Elaeis oleifera elongation factor 1-alpha mRNA, complete cds.
JMFF025E17Sequence551001245 (85)gb:AY378166_16038254e-84Cichorium intybus elongation factor 1-alpha mRNA, complete cds.
JMFF026G11Sequence519001245 (85)gb:AY378166_16038256e-77Cichorium intybus elongation factor 1-alpha mRNA, complete cds.639001245 (85)gb:AF464925_18020282e-86Elaeis oleifera elongation factor 1-alpha mRNA, complete cds.
JMFF026G12Sequence545001245 (85)gb:AY378166_16038258e-83Cichorium intybus elongation factor 1-alpha mRNA, complete cds.749001245 (85)gb:AY157315_1585425e-101Stevia rebaudiana elongation factor 1 alpha mRNA, complete cds.
JMFF028B23Sequence277001245 (85)pir|S17434|S174347e-15translation elongation factor eEF-1 alpha chain (gene tefS1) - soybean389001245 (85)gb:AF464925_18020288e-35Elaeis oleifera elongation factor 1-alpha mRNA, complete cds.
JMFF028K22Sequence548001245 (85)gb:AY378166_16038251e-84Cichorium intybus elongation factor 1-alpha mRNA, complete cds.632001245 (85)gb:AF464925_18020285e-85Elaeis oleifera elongation factor 1-alpha mRNA, complete cds.
JMFF030K23Sequence549001245 (85)gb:AY378166_16038254e-85Cichorium intybus elongation factor 1-alpha mRNA, complete cds.611001245 (85)gb:AF464925_18020283e-78Elaeis oleifera elongation factor 1-alpha mRNA, complete cds.
JMFF031G20Sequence547001245 (85)gb:AY378166_16038252e-83Cichorium intybus elongation factor 1-alpha mRNA, complete cds.653001245 (85)gb:AF464925_18020282e-86Elaeis oleifera elongation factor 1-alpha mRNA, complete cds.
JMFF033C01Sequence582001245 (85)gb:AY378166_16038253e-90Cichorium intybus elongation factor 1-alpha mRNA, complete cds.755001245 (85)gb:TOBBY2A_1725367e-108Nicotiana tabacum mRNA for elongation factor-1 alpha, complete cds.
JMFF035M15Sequence549001245 (85)gb:AY378166_16038257e-84Cichorium intybus elongation factor 1-alpha mRNA, complete cds.714001245 (85)gb:TOBBY2A_17253671e-98Nicotiana tabacum mRNA for elongation factor-1 alpha, complete cds.
JMFF035N04Sequence546001245 (85)gb:AY378166_16038251e-84Cichorium intybus elongation factor 1-alpha mRNA, complete cds.577001245 (85)gb:AY651886_16201732e-75Glycine max elongation factor 1A SMV resistance-related protein mRNA, partial cd
JMFF036P09Sequence546001245 (85)gb:AY378166_16038251e-84Cichorium intybus elongation factor 1-alpha mRNA, complete cds.653001245 (85)gb:AF464925_18020282e-86Elaeis oleifera elongation factor 1-alpha mRNA, complete cds.
JMFF037A04Sequence583001245 (85)gb:AY378166_16038252e-85Cichorium intybus elongation factor 1-alpha mRNA, complete cds.654001245 (85)gb:AF464925_18020282e-86Elaeis oleifera elongation factor 1-alpha mRNA, complete cds.
JMFF037N23Sequence554001245 (85)gb:AY378166_16038258e-80Cichorium intybus elongation factor 1-alpha mRNA, complete cds.327001245 (85)gb:AF360167_17911232e-49Arabidopsis thaliana putative translation elongation factor eEF-1 alpha chain A4
JMFF038I23Sequence578001245 (85)gb:AY378166_16038253e-90Cichorium intybus elongation factor 1-alpha mRNA, complete cds.655001245 (85)gb:AF464925_18020281e-86Elaeis oleifera elongation factor 1-alpha mRNA, complete cds.
JMFF041P19Sequence695001245 (85)gb:AY550990_1613318e-106Elaeis guineensis elongation factor 1-alpha 1 (EF1-a1) mRNA, complete cds.627001245 (85)gb:AY651886_16201733e-62Glycine max elongation factor 1A SMV resistance-related protein mRNA, partial cd
JMFF044O13Sequence664001245 (85)gb:AY550990_1613318e-106Elaeis guineensis elongation factor 1-alpha 1 (EF1-a1) mRNA, complete cds.625001807 (126)gb:TOBCBP57B_17253762e-38Tobacco mRNA for cytokinin binding protein CBP57, complete cds.
JMFF045A12Sequence647001245 (85)gb:AB061263_15220247e-96Solanum tuberosum EF-1-alpha mRNA for Elongation factor 1-alpha, complete cds.656001245 (85)gb:AY651886_16201731e-72Glycine max elongation factor 1A SMV resistance-related protein mRNA, partial cd
JMFF046A05Sequence635001245 (85)gb:AB061263_1522024e-100Solanum tuberosum EF-1-alpha mRNA for Elongation factor 1-alpha, complete cds.604001245 (85)gb:AY651886_16201737e-71Glycine max elongation factor 1A SMV resistance-related protein mRNA, partial cd
JMFF046P14Sequence446001245 (85)pir|S17434|S174344e-60translation elongation factor eEF-1 alpha chain (gene tefS1) - soybean433001245 (85)gb:AF464925_18020281e-37Elaeis oleifera elongation factor 1-alpha mRNA, complete cds.
JMFN007J07Sequence428001245 (85)gb:AF464925_18020282e-31Elaeis oleifera elongation factor 1-alpha mRNA, complete cds.
JMFN009N08Sequence543001245 (85)gb:AY651886_16201731e-58Glycine max elongation factor 1A SMV resistance-related protein mRNA, partial cd
JMFN011O06Sequence602001245 (85)gb:AB061263_15220242e-90Solanum tuberosum EF-1-alpha mRNA for Elongation factor 1-alpha, complete cds.
JMFN014A13Sequence611001245 (85)sp|P17786|EF1A_LYCESe-111Elongation factor 1-alpha (EF-1-alpha).>pir|S10507|S10507 translation elongation
JMFN030M08Sequence633001245 (85)gb:AY550990_1613318e-107Elaeis guineensis elongation factor 1-alpha 1 (EF1-a1) mRNA, complete cds.
JMSF012F18Sequence504001245 (85)pir|F86214|F862146e-75protein T6D22.2 [imported] - Arabidopsis thaliana>gb:AE005172_889801 Arabidopsis709022488gb:LCO579910_16840265e-07Lotus corniculatus var. japonicus mRNA for NIN-like protein 1.
JMSF046N23Sequence734001245 (85)gb:AY550990_1613318e-122Elaeis guineensis elongation factor 1-alpha 1 (EF1-a1) mRNA, complete cds.655001245 (85)gb:AF464925_18020281e-93Elaeis oleifera elongation factor 1-alpha mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF046P14- GACAACACGAAAAAGCTTTTCAAGTACAAACCAAGTAAAAT
rJMFF025C19- GTAAAAT
JMFN009N08+ GACAACACGAAAAAGCTTTTCAAGTACAAACCAAGTAAAAT
rJMFF046A05- CAACACGAAAAAGCTTTTCAAGTACAAACCAAGTAAAAT
rJMFF041P19- ATAGACAACACAAAAAAGCTTTTCTAGTCCCACCCATGTAAAAT
rJMFF014C04- TTTTCAGTACAAACCAAGTAAAAT
rJMFF011P18- TTTTCAGTACAAACCAAGTAAAAT
rJMFF018B02- TTTTCAGTACAAACCAAGTAAAAT
rJMFF017B20- TTTTCAGTACAAACCAAGTAAAAT
rJMFF016M22- AAAT
rJMFF014G02- TTTTCAGTACAAACCAAGTAAAAT
rJMFF005E02- AAGTAAAAT
rJMFF028B23- AAGTAAAAT
rJMFF004E05- AAGTAAAAT
rJMFF037A04- AAGTAAAAT
rJMFF031G20- AGTAAAAT
rJMFF036P09- AAGTAAAAT
rJMFF019B09- AAGTAAAAT
rJMFF038I23- TAAAAT
rJMFF030K23- AGTAAAAT
rJMFF019I10- AAAT
rJMFF004I09- AAGTAAAAT
rJMFF015B06- AAGTAAAAT
rJMFF008I12- AGTAAAAT
rJMFF016E05- T
rJMFF007I05- AAAT
rJMFF017D06- AGTAAAAT
rJMFF026G12- AAAT
rJMFF035M15- T
rJMFF017H01- AAAT
rJMFF033C01- T
                      ____________________________________________________________
consensus ATAGACAACACGAAAAAGCTTTTTCAGTACAAACCAAGTAAAAT
 
. : . : . : . : . : . :
rJMFF046P14- AGTTCAACACCGATGAGCTATAAATGTCTTAGAAGAAACTACTG-TAATGGCAAATGGTA
rJMFF025C19- AGTTCNACACCGATGAGCTATAAATGTCTTAGAAGAAACTACTG-TAATGGCAAATGGTA
JMFN009N08+ AGTTCAACACCGATGAGCTATAAATGTCTTAGAAGAAACTACTG-TAATGGCAAATGGTA
rJMFF046A05- AGTTCAACACCGATGAGCTATAAATGTCTTAGAAGAAACTACTG-TAATGGCAAATGGTA
rJMFF041P19- AGTTCAACCCCGATGAGCTATAAATGGCTTATAAGAAACTACTG-TGATGGCAACTGGTC
rJMFF014C04- AGTTCAACACCGATGAGCTATAAATGTCTTAGAAGAAACTACTG-TAATGGCAAATGGTA
rJMFF011P18- AGTTCAACACCGATGAGCTATAAATGTCTTAGAAGAAACTACTG-TAATGGCAAATGGTA
rJMFF018B02- AGTTCAACACCGATGAGCTATAAATGTCTTAGAAGAAACTACTG-TAATGGCAAATGGTA
rJMFF017B20- AGTTCAACACCGATGAGCTATAAATGTCTTAGAAGAAACTACTG-TAATGGCAAATGGTA
rJMFF016M22- AGTTCAACACCGATGAGCTATAAATGTCTTAGAAGAAACTACTG-TAATGGCAAATGGTA
rJMFF014G02- AGTTCAACACCGATGAGCTATAAATGTCTTAGAAGAAACTACTG-TAATGGCAAATGGTA
rJMFF005E02- AGTTCAACACCGATGAGCTATAAATGTCTTAGAAGAAACTACTG-TAATGGCAAATGGTA
rJMFF028B23- AGTTCAACACCGATGAGCTATAAATGTCTTAGAAGAAACTACTG-TAATGGCAAATGGTA
rJMFF004E05- AGTTCAACACCGATGAGCTATAAATGTCTTAGAAGAAACTACTG-TAATGGCAAATGGTA
rJMFF037A04- AGTTCAACACCGATGAGCTATAAATGTCTTAGAAGAAACTACTG-TAATGGCAAATGGTA
rJMFF031G20- AGTTCAACACCGATGAGCTATAAATGTCTTAGAAGAAACTACTG-TAATGGCAAATGGTA
rJMFF036P09- AGTTCAACACCGATGAGCTATAAATGTCTTAGAAGAAACTACTG-TAATGGCAAATGGTA
rJMFF019B09- AGTTCAACACCGATGAGCTATAAATGTCTTAGAAGAAACTACTG-TAATGGCAAATGGTA
rJMFF038I23- AGTTCAACACCGATGAGCTATAAATGTCTTAGAAGAAACTACTG-TAATGGCAAATGGTA
rJMFF026G11- CACCGATGAGCTATAAATGTCTTAGAAGAAACTACTG-TAATGGCAAATGGTA
rJMFF028K22- ACACCGATGAGCTATAAATGTCTTAGAAGAAACTACTG-TAATGGCAAATGGTA
rJMFF030K23- AGTTCAACACCGATGAGCTATAAATGTCTTAGAAGAAACTACTG-TAATGGCAAATGGTA
rJMFF035N04- CACCGATGAGCTATAAATGTCTTAGAAGAAACTACTG-TAATGGCAAATGGTA
rJMFF019I10- AGTTCAACACCGATGAGCTATAAATGTCTTANAAGAAACTACTG-TAATGGCAAATGGTA
rJMFF004I09- AGTTCAACACCGATGAGCTATAAATGTCTTAGAAGAAACTACTG-TAATGGCAAATGGTA
rJMFF015B06- AGTTCAACACCGATGAGCTATAAATGTCTTAGAAGAAACTACTG-TAATGGCAAATGGTA
rJMFF008I12- AGTTCAACACCGATGAGCTATAAATGTCTTAGAAGAAACTACTG-TAATGGCAAATGGTA
rJMFF022C20- CACCGATGAGCTATAAATGTCTTAGAAGAAACTACTG-TAATGGCAAATGGTA
rJMSF046N23- GTCTTAGAAGAAACTACTGNTAATGGCAAATGGTA
rJMFF016E05- AGTTCAACACCGATGAGCTATAAATGTCTTAGAAGAAACTACTG-TAATGGCAAATGGTA
rJMFF007I05- AGTTCAACACCGATGAGCTATAAATGTCTTAGAAGAAACTACTG-TAATGGCAAATGGTA
rJMFF017D06- AGTTCAACACCGATGAGCTATAAATGTCTTAGAAGAAACTACTG-TAATGGCAAATGGTA
rJMFF026G12- AGTTCAACACCGATGAGCTATAAATGTCTTAGAAGAAACTACTG-TAATGGCAAATGGTA
rJMFF035M15- AGTTCAACACCGATGAGCTATAAATGTCTTAGAAGAAACTACTG-TAATGGCAAATGGTA
rJMFF017H01- AGTTCAACACCGATGAGCTATAAATGTCTTAGAAGAAACTACTG-TAATGGCAAATGGTA
rJMFF024F06- ACACCGATGAGCTATAAATGTCTTAGAAGAAACTACTG-TAATGGCAAATGGTA
rJMFF033C01- AGTTCAACACCGATGAGCTATAAATGTCTTAGAAGAAACTACTG-TAATGGCAAATGGTA
                      ____________________________________________________________
consensus AGTTCAACACCGATGAGCTATAAATGTCTTAGAAGAAACTACTG-TAATGGCAAATGGTA
 
. : . : . : . : . : . :
rJMFF046P14- AAACGTTCACAACAAAATTAGAAAACTATAATTAAAGAAACATATTCTCAGCACAGTGCT
rJMFF025C19- AAACGTTCACAACAAAATTANAAAACTATAATTAAAGAAACATATTCTCAGCACAGTGCT
JMFN009N08+ AAACGTTCACAACAAAATTAGAAAACTATAATTAAAGAAACATATTCTCAGCACAGTGCT
rJMFF046A05- AAACGTTCACAACAAAATTAGAAAACTATAATTAAAGAAACATATTCTCAGCACAGTGCT
rJMFF041P19- AAACGTTCTCCACAAACTTAGAAAGCTATAATTACAGAAACATATCCTCAGCACAGGGCT
rJMFF014C04- AAACGTTCACAACAAAATTAGAAAACTATAATTAAAGAAACATATTCTCAGCACAGTGCT
rJMFF011P18- AAACGTTCACAACAAAATTAGAAAACTATAATTAAAGAAACATATTCTCAGCACAGTGCT
rJMFF018B02- AAACGTTCACAACAAAATTAGAAAACTATAATTAAAGAAACATATTCTCAGCACAGTGCT
rJMFF017B20- AAACGTTCACAACAAAATTAGAAAACTATAATTAAAGAAACATATTCTCAGCACAGTGCT
rJMFF016M22- AAACGTTCACAACAAAATTAGAAAACTATAATTAAAGAAACATATTCTCAGCACAGTGCT
rJMFF014G02- AAACGTTCACAACAAAATTAGAAAACTATAATTAAAGAAACATATTCTCAGCACAGTGCT
rJMFF005E02- AAACGTTCACAACAAAATTAGAAAACTATAATTAAAGAAACATATTCTCAGCACAGTGCT
rJMFF045A12- TGCT
rJMFF028B23- AAACGTTCACAACAAAATTAGAAAACTATAATTAAAGAAAAATATTCTCAGCACAGTGCT
JMFN007J07+ TGCT
rJMFF004E05- AAACGTTCACAACAAAATTAGAAAACTATAATTAAAGAAAAATATTCTCAGCACAGTGCT
rJMFF037A04- AAACGTTCACAACAAAATTAGAAAACTATAATTAAAGAAACATATTCTCAGCACAGTGCT
rJMFF031G20- AAACGTTCACAACAAAATTAGAAAACTATAATTAAAGAAACATATTCTCAGCACAGTGCT
rJMFF036P09- AAACGTTCACAACAAAATTAGAAAACTATAATTAAAGAAACATATTCTCAGCACAGTGCT
rJMFF019B09- AAACGTTCACAACAAAATTAGAAAACTATAATTAAAGAAACATATTCTCAGCACAGTGCT
rJMFF038I23- AAACGTTCACAACAAAATTAGAAAACTATAATTAAAGAAACATATTCTCAGCACAGTGCT
rJMFF026G11- AAACGTTCACAACAAAATTAGAAAACTATAATTAAAGAAACATATTCTCAGCACAGTGCT
rJMFF028K22- AAACGTTCACAACAAAATTAGAAAACTATAATTAAAGAAACATATTCTCAGCACAGTGCT
rJMFF030K23- AAACGTTCACAACAAAATTAGAAAACTATAATTAAAGAAACATATTCTCAGCACAGTGCT
rJMFF035N04- AAACGTTCACAACAAAATTAGAAAACTATAATTAAAGAAACATATTCTCAGCACAGTGCT
rJMFF019I10- AANCGTTCNCAACAAAATTAGAAAACTATAATTAAAGAAACATATTCTCANCACAGTGCT
rJMFF004I09- AAACGTTCACAACAAAATTAGAAAACTATAATTAAAGAAACATATTCTCAGCACAGTGCT
rJMFF015B06- AAACGTTCACAACAAAATTAGAAAACTATAATTAAAGAAACATATTCTCAGCACAGTGCT
rJMFF008I12- AAACGTTCACAACAAAATTAGAAAACTATAATTAAAGAAACATATTCTCAGCACAGTGCT
rJMFF022C20- AAACGTTCACAACAAAATTAGAAAACTATAATTAAAGAAACATATTCTCAGCACAGTGCT
rJMSF046N23- AAACGTTCACAACAAAATTAGAAAACTATAATTAAAGAAACATATTCTCAGCACAGTGCT
rJMFF016E05- AAACGTTCACAACAAAATTAGAAAACTATAATTAAAGAAACATATTCTCAGCACAGTGCT
rJMFF007I05- AAACGTTCACAACAAAATTAGAAAACTATAATTAAAGAAACATATTCTCAGCACAGTGCT
rJMFF017D06- AAACGTTCACAACAAAATTAGAAAACTATAATTAAAGAAACATATTCTCAGCACAGTGCT
rJMFF026G12- AAACGTTCACAACAAAATTAGAAAACTATAATTAAAGAAACATATTCTCAGCACAGTGCT
rJMFF035M15- AAACGTTCACAACAAAATTAGAAAACTATAATTAAAGAAACATATTCTCAGCACAGTGCT
rJMFF017H01- AAACGTTCACAACAAAATTAGAAAACTATAATTAAAGAAACATATTCTCAGCACAGTGCT
rJMFF024F06- AAACGTTCACAACAAAATTAGAAAACTATAATTAAAGAAACATATTCTCAGCACAGTGCT
rJMFF033C01- AAACGTTCACAACAAAATTAGAAAACTATAATTAAAGAAACATATTCTCAGCACAGTGCT
                      ____________________________________________________________
consensus AAACGTTCACAACAAAATTAGAAAACTATAATTAAAGAAACATATTCTCAGCACAGTGCT
 
. : . : . : . : . : . :
rJMFF046P14- CACTTCTTCTTCTGAGCAGCCTTGGTGACCTTGGCACCAGTTGGGTCCTTCTTGTCAACG
rJMFF025C19- CACTTCTTCTTCTGAGCAGCCTTGGTGACCTTGGCACCAGTTGGGTCCTTCTTGTCAACG
JMFN009N08+ CACTTCTTCTTCTGAGCAGCCTTGGTGACCTTGGCACCAGTTGGGTCCTTCTTGTCAACG
rJMFF046A05- CACTTCTTCTTCTGAGCAGCCTTGGTGACCTTGGCACCAGTTGGGTCCTTCTTGTCAACG
rJMFF041P19- CACTTCTTATTATGAGCAGCCTTGGAGACCTTGGCACCAGTTGGGTCCTTCTTGTCAACG
rJMFF014C04- CACTTCTTCTTCTGAGCAGCCTTGGTGACCTTGGCACCAGTTGGGTCCTTCTTGTCAACG
rJMFF011P18- CACTTCTTCTTCTGAGCAGCCTTGGTGACCTTGGCACCAGTTGGGTCCTTCTTGTCAACG
rJMFF018B02- CACTTCTTCTTCTGAGCAGCCTTGGTGACCTTGGCACCAGTTGGGTCCTTCTTGTCAACG
rJMFF017B20- CACTTCTTCTTCTGAGCAGCCTTGGTGACCTTGGCACCAGTTGGGTCCTTCTTGTCAACG
rJMFF016M22- CACTTCTTCTTCTGAGCAGCCTTGGTGACCTTGGCACCAGTTGGGTCCTTCTTGTCAACG
rJMFF014G02- CACTTCTTCTTCTGAGCAGCCTTGGTGACCTTGGCACCAGTTGGGTCCTTCTTGTCAACG
rJMFF005E02- CACTTCTTCTTCTGAGCAGCCTTGGTGACCTTGGCACCAGTTGGGTCCTTCTTGTCAACG
rJMFF045A12- CACTTCTTCTTCTGAGCAGCCTTGGTGACCTTGGCACCAGTTGGGTCCTTCTTGTCAACG
rJMFF028B23- CACTTCTTCTTCTGAGCAGCCTTGGTGACCTTGGCACCAGTTGGGTCCTTCTTGTCAACG
JMFN007J07+ CACTTCTTCTTCTGAGCAGCCTTGGTGACCTTGGCACCAGTTGGGTCCTTCTTGTCAACG
rJMFF004E05- CACTTCTTCTTCTGAGCAGCCTTGGTGACCTTGGCACCAGTTGGGTCCTTCTTGTCAACG
rJMFF037A04- CACTTCTTCTTCTGAGCAGCCTTGGTGACCTTGGCACCAGTTGGGTCCTTCTTGTCAACG
rJMFF031G20- CACTTCTTCTTCTGAGCAGCCTTGGTGACCTTGGCACCAGTTGGGTCCTTCTTGTCAACG
rJMFF036P09- CACTTCTTCTTCTGAGCAGCCTTGGTGACCTTGGCACCAGTTGGGTCCTTCTTGTCAACG
rJMFF019B09- CACTTCTTCTTCTGAGCAGCCTTGGTGACCTTGGCACCAGTTGGGTCCTTCTTGTCAACG
rJMFF038I23- CACTTCTTCTTCTGAGCAGCCTTGGTGACCTTGGCACCAGTTGGGTCCTTCTTGTCAACG
rJMFF026G11- CACTTCTTCTTCTGAGCAGCCTTGGTGACCTTGGCACCAGTTGGGTCCTTCTTGTCAACG
rJMFF028K22- CACTTCTTCTTCTGAGCAGCCTTGGTGACCTTGGCACCAGTTGGGTCCTTCTTGTCAACG
rJMFF030K23- CACTTCTTCTTCTGAGCAGCCTTGGTGACCTTGGCACCAGTTGGGTCCTTCTTGTCAACG
rJMFF035N04- CACTTCTTCTTCTGAGCAGCCTTGGTGACCTTGGCACCAGTTGGGTCCTTCTTGTCAACG
rJMFF019I10- CACTTCTTCTTCTGAGCANCCTTGGTGACCTTGGCACCAGTTGGGTCCTTCTTGTCNACG
rJMFF004I09- CACTTCTTCTTCTGAGCAGCCTTGGTGACCTTGGCACCAGTTGGGTCCTTCTTGTCAACG
rJMFF015B06- CACTTCTTCTTCTGAGCAGCCTTGGTGACCTTGGCACCAGTTGGGTCCTTCTTGTCAACG
rJMFF008I12- CACTTCTTCTTCTGAGCAGCCTTGGTGACCTTGGCACCAGTTGGGTCCTTCTTGTCAACG
rJMFF022C20- CACTTCTTCTTCTGAGCAGCCTTGGTGACCTTGGCACCAGTTGGGTCCTTCTTGTCAACG
rJMSF046N23- CACTTCTTCTTCTGAGCAGCCTTGGTGACCTTGGCACCAGTTGGGTCCTTTTTGTCAACG
rJMFF016E05- CACTTCTTCTTCTGAGCAGCCTTGGTGACCTTGGCACCAGTTGGGTCCTTCTTGTCAACG
rJMFF007I05- CACTTCTTCTTCTGAGCAGCCTTGGTGACCTTGGCACCAGTTGGGTCCTTCTTGTCAACG
rJMFF017D06- CACTTCTTCTTCTGAGCAGCCTTGGTGACCTTGGCACCAGTTGGGTCCTTCTTGTCAACG
rJMFF026G12- CACTTCTTCTTCTGAGCAGCCTTGGTGACCTTGGCACCAGTTGGGTCCTTCTTGTCAACG
rJMFF035M15- CACTTCTTCTTCTGAGCAGCCTTGGTGACCTTGGCACCAGTTGGGTCCTTCTTGTCAACG
rJMFF017H01- CACTTCTTCTTCTGAGCAGCCTTGGTGACCTTGGCACCAGTTGGGTCCTTCTTGTCAACG
rJMFF024F06- CACTTCTTCTTCTGAGCAGCCTTGGTGACCTTGGCACCAGTTGGGTCCTTCTTGTCAACG
rJMFF033C01- CACTTCTTCTTCTGAGCAGCCTTGGTGACCTTGGCACCAGTTGGGTCCTTCTTGTCAACG
                      ____________________________________________________________
consensus CACTTCTTCTTCTGAGCAGCCTTGGTGACCTTGGCACCAGTTGGGTCCTTCTTGTCAACG
 
. : . : . : . : . : . :
rJMFF046P14- CTCTTAATGACTCCAACAGCGACGGTTTGACGCATGTCCCTCACAGCAAAACGCCCCAGC
rJMFF025C19- CTCTTAATGACTCCAACAGCGACGGTTTGACGCATGTCCCTCACAGCAAAACGCCCCAGC
JMFN009N08+ CTCTTAATGACTCCAACAGCGACGGTTTGACGCATGTCCCTCACAGCAAAACGCCCCAGC
rJMFF046A05- CTCTTAATGACTCCNACAGCGACGGTTTGACGCATGTCCCTCACAGCAAAACGCCCCAGC
rJMFF041P19- CTCTTAATGACTCCAACAGCCACGGTTTGACGCATGTCCCTCACAGCAAAACGCCCCAAC
rJMFF014C04- CTCTTAATGACTCCAACAGCGACGGTTTGACGCATGTCCCTCACAGCAAAACGCCCCAGC
rJMFF011P18- CTCTTAATGACTCCAACAGCGACGGTTTGACGCATGTCCCTCACAGCAAAACGCCCCAGC
rJMFF018B02- CTCTTAATGACTCCAACAGCGACGGTTTGACGCATGTCCCTCACAGCAAAACGCCCCAGC
rJMFF017B20- CTCTTAATGACTCCAACAGCGACGGTTTGACGCATGTCCCTCACAGCAAAACGCCCCAGC
rJMFF016M22- CTCTTAATGACTCCAACAGCGACGGTTTGACGCATGTCCCTCACAGCAAAACGCCCCAGC
rJMFF014G02- CTCTTAATGACTCCAACAGCGACGGTTTGACGCATGTCCCTCACAGCAAAACGCCCCAGC
rJMFF005E02- CTCTTAATGACTCCAACAGCGACGGTTTGACGCATGTCCCTCACAGCAAAACGCCCCAGC
rJMFF045A12- CTCTTAATGACTCCCACAGCGACGGTTTGACGCATGTCCCTCACAGCAAAACGCCCCAGC
rJMFF028B23- CTCTTAATGACTCCAACAGCGACGGTTTGACGCATGTCCCTCACAGCAAAACGCCCCAGC
JMFN007J07+ CTCTTAATGACTCCAACAGCGACGGTTTGACGCATGTCCCTCACAGCAAAACGCCCCAGC
rJMFF004E05- CTCTTAATGACTCCAACAGCGACGGTTTGACGCATGTCCCTCACAGCAAAACGCCCCAGC
rJMFF037A04- CTCTTAATGACTCCAACAGCGACGGTTTGACGCATGTCCCTCACAGCAAAACGCCCCAGC
rJMFF031G20- CTCTTAATGACTCCAACAGCGACGGTTTGACGCATGTCCCTCACAGCAAAACGCCCCAGC
rJMFF036P09- CTCTTAATGACTCCAACAGCGACGGTTTGACGCATGTCCCTCACAGCAAAACGCCCCAGC
rJMFF019B09- CTCTTAATGACTCCAACAGCGACGGTTTGACGCATGTCCCTCACAGCAAAACGCCCCAGC
rJMFF038I23- CTCTTAATGACTCCAACAGCGACGGTTTGACGCATGTCCCTCACAGCAAAACGCCCCAGC
rJMFF026G11- CTCTTAATGACTCCAACAGCGACGGTTTGACGCATGTCCCTCACAGCAAAACGCCCCAGC
rJMFF028K22- CTCTTAATGACTCCAACAGCGACGGTTTGACGCATGTCCCTCACAGCAAAACGCCCCAGC
rJMFF030K23- CTCTTAATGACTCCAACAGCGACGGTTTGACGCATGTCCCTCACAGCAAAACGCCCCAGC
rJMFF035N04- CTCTTAATGACTCCAACAGCGACGGTTTGACGCATGTCCCTCACAGCAAAACGCCCCAGC
rJMFF019I10- CTCTTAATGACTCCAACAGCGACGGTTTGACGCATGTCCCTCACAGCAAAACGCCCCAGC
rJMFF004I09- CTCTTAATGACTCCAACAGCGACGGTTTGACGCATGTCCCTCACAGCAAAACGCCCCAGC
rJMFF015B06- CTCTTAATGACTCCAACAGCGACGGTTTGACGCATGTCCCTCACAGCAAAACGCCCCAGC
rJMFF008I12- CTCTTAATGACTCCAACAGCGACGGTTTGACGCATGTCCCTCACAGCAAAACGCCCCAGC
rJMFF022C20- CTCTTAATGACTCCAACAGCGACGGTTTGACGCATGTCCCTCACAGCAAAACGCCCCAGC
rJMSF046N23- CTCTTAATGACTCCAACAGCGACGGTTTGACGCATGTCCCTCACAGCAAAACGCCCCAGC
rJMFF016E05- CTCTTAATGACTCCAACAGCGACGGTTTGACGCATGTCCCTCACAGCAAAACGCCCCAGC
rJMFF007I05- CTCTTAATGACTCCAACAGCGACGGTTTGACGCATGTCCCTCACAGCAAAACGCCCCAGC
rJMFF017D06- CTCTTAATGACTCCAACAGCGACGGTTTGACGCATGTCCCTCACAGCAAAACGCCCCAGC
rJMFF026G12- CTCTTAATGACTCCAACAGCGACGGTTTGACGCATGTCCCTCACAGCAAAACGCCCCAGC
rJMFF035M15- CTCTTAATGACTCCAACAGCGACGGTTTGACGCATGTCCCTCACAGCAAAACGCCCCAGC
rJMFF017H01- CTCTTAATGACTCCAACAGCGACGGTTTGACGCATGTCCCTCACAGCAAAACGCCCCAGC
rJMFF024F06- CTCTTAATGACTCCAACAGCGACGGTTTGACGCATGTCCCTCACAGCAAAACGCCCCAGC
rJMFF033C01- CTCTTAATGACTCCAACAGCGACGGTTTGACGCATGTCCCTCACAGCAAAACGCCCCAGC
                      ____________________________________________________________
consensus CTCTTAATGACTCCAACAGCGACGGTTTGACGCATGTCCCTCACAGCAAAACGCCCCAGC
 
. : . : . : . : . : . :
rJMFF046P14- GGTGGGTACTCAGAGAAGGTCTCAACGACCATGGGCTTTGTGGGAAGCATCTTCACAAAA
rJMFF025C19- GGTGGGTACTCANAGAAGGTCTCAACGACCATGGGCTTTGTGGGAAGCATCTTCACAAAA
JMFN009N08+ GGTGGGTACTCAGAGAAGGTCTCAACGACCATGGGCTTTGTGGGAAGCATCTTCACAAAA
rJMFF046A05- GGTGGGTACTCAGAGAAGGTCTCAACGACCATGGGCTTTGTGGGAAGCATCTTCACAAAA
rJMFF041P19- GGAGGTTACTCAAAGAAGGGCTCATCGACCATGGGCTTTGTGGGAAGCATATTGACAAAA
rJMFF014C04- GGTGGGTACTCAGAGAAGGTCTCAACGACCATGGGCTTTGTGGGAAGCATCTTCACAAAA
rJMFF011P18- GGTGGGTACTCAGAGAAGGTCTCAACGACCATGGGCTTTGTGGGAAGCATCTTCACAAAA
rJMFF018B02- GGTGGGTACTCAGAGAAGGTCTCAACGACCATGGGCTTTGTGGGAAGCATCTTCACAAAA
rJMFF017B20- GGTGGGTACTCAGAGAAGGTCTCAACGACCATGGGCTTTGTGGGAAGCATCTTCACAAAA
rJMFF016M22- GGTGGGTACTCAGAGAAGGTCTCAACGACCATGGGCTTTGTGGGAAGCATCTTCACAAAA
rJMFF014G02- GGTGGGTACTCAGAGAAGGTCTCAACGACCATGGGCTTTGTGGGAAGCATCTTCACAAAA
rJMFF005E02- GGTGGGTACTCAGAGAAGGTCTCAACGACCATGGGCTTTGTGGGAAGCATCTTCACAAAA
rJMFF045A12- GGTGGGTACTCAGAGAAGGTCTCAACGACCATGGGCTTTGTGGGAAGCATCTTCACAAAA
rJMFF028B23- GGTGGGTACTCAGAGAAGGTCTCAACGACCATGGGCTTTGTGGGAAGCATCTTCACAAAA
rJMFF037N23- GTCTCAACGACCATGGGCTTTGTGGGAANCATCTTCACAAAA
JMFN007J07+ GGTGGGTACTCAGAGAAGGTCTCAACGACCATGGGCTTTGTGGGAAGCATCTTCACAAAA
rJMFF004E05- GGTGGGTACTCAGAGAAGGTCTCAACGACCATGGGCTTTGTGGGAAGCATCTTCACAAAA
rJMFF037A04- GGTGGGTACTCAGAGAAGGTCTCAACGACCATGGGCTTTGTGGGAAGCATCTTCACAAAA
rJMFF031G20- GGTGGGTACTCAGAGAAGGTCTCAACGACCATGGGCTTTGTGGGAAGCATCTTCACAAAA
rJMFF036P09- GGTGGGTACTCAGAGAAGGTCTCAACGACCATGGGCTTTGTGGGAAGCATCTTCACAAAA
rJMFF019B09- GGTGGGTACTCAGAGAAGGTCTCAACGACCATGGGCTTTGTGGGAAGCATCTTCACAAAA
rJMFF038I23- GGTGGGTACTCAGAGAAGGTCTCAACGACCATGGGCTTTGTGGGAAGCATCTTCACAAAA
rJMFF026G11- GGTGGGTACTCAGAGAAGGTCTCAACGACCATGGGCTTTGTGGGAAGCATCTTCACAAAA
rJMFF028K22- GGTGGGTACTCAGAGAAGGTCTCAACGACCATGGGCTTTGTGGGAAGCATCTTCACAAAA
rJMFF030K23- GGTGGGTACTCAGAGAAGGTCTCAACGACCATGGGCTTTGTGGGAAGCATCTTCACAAAA
rJMFF035N04- GGTGGGTACTCAGAGAAGGTCTCAACGACCATGGGCTTTGTGGGAAGCATCTTCACAAAA
rJMFF019I10- GGNGGGTACTCAGAGAAGGTCTCAACGACCATGGGCTTTGTGGGAAGCATCTTCACAAAA
rJMFF004I09- GGTGGGTACTCAGAGAAGGTCTCAACGACCATGGGCTTTGTGGGAAGCATCTTCACAAAA
rJMFF015B06- GGTGGGTACTCAGAGAAGGTCTCAACGACCATGGGCTTTGTGGGAAGCATCTTCACAAAA
rJMFF008I12- GGTGGGTACTCAGAGAAGGTCTCAACGACCATGGGCTTTGTGGGAAGCATCTTCACAAAA
rJMFF022C20- GGTGGGTACTCAGAGAAGGTCTCAACGACCATGGGCTTTGTGGGAAGCATCTTCACAAAA
rJMSF046N23- GGTGGGTACTCAGAGAAGGTCTCAACGACCATGGGCTTTGTGGGAAGCATCTTCACAAAA
rJMFF016E05- GGTGGGTACTCAGAGAAGGTCTCAACGACCATGGGCTTTGTGGGAAGCATCTTCACAAAA
rJMFF007I05- GGTGGGTACTCAGAGAAGGTCTCAACGACCATGGGCTTTGTGGGAAGCATCTTCACAAAA
rJMFF017D06- GGTGGGTACTCAGAGAAGGTCTCAACGACCATGGGCTTTGTGGGAAGCATCTTCACAAAA
rJMFF026G12- GGTGGGTACTCAGAGAAGGTCTCAACGACCATGGGCTTTGTGGGAAGCATCTTCACAAAA
rJMFF035M15- GGTGGGTACTCAGAGAAGGTCTCAACGACCATGGGCTTTGTGGGAAGCATCTTCACAAAA
rJMFF017H01- GGTGGGTACTCAGAGAAGGTCTCAACGACCATGGGCTTTGTGGGAAGCATCTTCACAAAA
rJMFF024F06- GGTGGGTACTCAGAGAAGGTCTCAACGACCATGGGCTTTGTGGGAAGCATCTTCACAAAA
rJMFF033C01- GGTGGGTACTCAGAGAAGGTCTCAACGACCATGGGCTTTGTGGGAAGCATCTTCACAAAA
                      ____________________________________________________________
consensus GGTGGGTACTCAGAGAAGGTCTCAACGACCATGGGCTTTGTGGGAAGCATCTTCACAAAA
 
. : . : . : . : . : . :
rJMFF046P14- CCAGCATCACCATTCTTCAGGAACTTGGGCTCCTTCTCGAGCTCCTTGCCAGATCGTCTG
rJMFF025C19- CCANCATCACCATTCTTCAGGAACTTGGGCTCCTTCTCGAGCTCCTTGCCAGATCGTCTG
JMFN009N08+ CCAGCATCACCATTCTTCAGGAACTTGGGCTCCTTCTCGAGCTCCTTGCCAGATCGTCTG
rJMFF046A05- CCAGCATCACCATTCTTCAGGAACTTGGGCTCCTTCTCGAGCTCCTTGCCAGATCGTCTG
rJMFF041P19- CCCGCATCACCATTCTTCAGGAACTGGGGCTCCTTCTCAAGCTCCTTGCCATATCTTCTG
rJMFF014C04- CCAGCATCACCATTCTTCAGGAACTTGGGCTCCTTCTCGAGCTCCTTGCCAGATCGTCTG
rJMFF011P18- CCAGCATCACCATTCTTCAGGAACTTGGGCTCCTTCTCGAGCTCCTTGCCAGATCGCCTG
rJMFF018B02- CCAGCATCACCATTCTTCAGGAACTTGGGCTCCTTCTCGAGCTCCTTGCCAGATCGTCTG
rJMFF017B20- CCAGCATCACCATTCTTCAGGAACTTGGGCTCCTTCTCGAGCTCCTTGCCAGATCGTCTG
rJMFF016M22- CCAGCATCACCATTCTTCAGGAACTTGGGCTCCTTCTCGAGCTCCTTGCCAGATCGTCTG
rJMFF014G02- CCAGCATCACCATTCTTCAGGAACTTGGGCTCCTTCTCGAGCTCCTTGCCAGATCGTCTG
rJMFF005E02- CCAGCATCACCATTCTTCAGGAACTTGGGCTCCTTCTCGAGCTCCTTGCCAGATCGTCTG
rJMFF045A12- CCAGCATCACCATTCTTCAGGAACTTGGGCTCCTTCTCGAGCTCCTTGCCAGATCGTCTG
rJMFF028B23- CCAGCATCACCATTCTTCAGGAACTTGGGCTCCTTCTCGAGCTCCTTGCCAGATCGTCTG
rJMFF037N23- CCAGCATCACCATTCTTCAGGAACTTGGGCTCCTTCTCGAGCTCCNTGCCAGATCGTCTG
JMFN007J07+ CCAGCATCACCATTCTTCAGGAACTTGGGCTCCTTCTCGAGCTCCTTGCCAGATCG
rJMFF004E05- CCAGCATCACCATTCTTCAGGAACTTGGGCTCCTTCTCGAGCTCCTTGCCAGATCGTCTG
rJMFF037A04- CCAGCATCACCATTCTTCAGGAACTTGGGCTCCTTCTCGAGCTCCTTGCCAGATCGTCTG
rJMFF031G20- CCAGCATCACCATTCTTCAGGAACTTGGGCTCCTTCTCGAGCTCCTTGCCAGATCGTCTG
rJMFF036P09- CCAGCATCACCATTCTTCAGGAACTTGGGCTCCTTCTCGAGCTCCTTGCCAGATCGTCTG
rJMFF019B09- CCAGCATCACCATTCTTCAGGAACTTGGGCTCCTTCTCGAGCTCCTTGCCAGATCGTCTG
rJMFF038I23- CCAGCATCACCATTCTTCAGGAACTTGGGCTCCTTCTCGAGCTCCTTGCCAGATCGTCTG
rJMFF026G11- CCAGCATCACCATTCTTCAGGAACTTGGGCTCCTTCTCGAGCTCCTTGCCAGATCGTCTG
rJMFF028K22- CCAGCATCACCATTCTTCAGGAACTTGGGCTCCTTCTCGAGCTCCTTGCCAGATCGTCTG
rJMFF030K23- CCAGCATCACCATTCTTCAGGAACTTGGGCTCCTTCTCGAGCTCCTTGCCAGATCGTCTG
rJMFF035N04- CCAGCATCACCATTCTTCAGGAACTTGGGCTCCTTCTCGAGCTCCTTGCCAGATCGTCTG
rJMFF019I10- CCAGCATCACCATTCTTCAGGAACTTGGGCTCCTTCTCGAGCTCCTTGCCAGATCGNCTG
rJMFF004I09- CCAGCATCACCATTCTTCAGGAACTTGGGCTCCTTCTCGAGCTCCTTGCCAGATCGTCTG
rJMFF015B06- CCAGCATCACCATTCTTCAGGAACTTGGGCTCCTTCTCGAGCTCCTTGCCAGATCGTCTG
rJMFF008I12- CCAGCATCACCATTCTTCAGGAACTTGGGCTCCTTCTCGAGCCCCTTGCCAGATCGTCTG
rJMFF022C20- CCAGCATCACCATTCTTCAGGAACTTGGGCTCCTTCTCGAGCTCCTTGCCAGATCGTCTG
rJMSF046N23- CCAGCATCACCATTCTTCAGGAACTTGGGCTCCTTCTCGAGCTCCTTGCCAGATCGTCTG
rJMFF016E05- CCAGCATCACCATTCTTCAGGAACTTGGGCTCCTTCTCGAGCTCCTTGCCAGATCGTCTG
rJMFF007I05- CCAGCATCACCATTCTTCAGGAACTTGGGCTCCTTCTCGAGCTCCTTGCCAGATCGTCTG
rJMFF017D06- CCAGCATCACCATTCTTCAGGAACTTGGGCTCCTTCTCGAGCTCCTTGCCAGATCGTCTG
rJMFF026G12- CCAGCATCACCATTCTTCAGGAACTTGGGCTCCTTCTCGAGCTCCTTGCCAGATCGTCTG
rJMFF035M15- CCAGCATCACCATTCTTCAGGAACTTGGGCTCCTTCTCGAGCTCCTTGCCAGATCGTCTG
rJMFF017H01- CCAGCATCACCATTCTTCAGGAACTTGGGCTCCTTCTCGAGCTCCTTGCCAGATCGTCTG
rJMFF024F06- CCAGCATCACCATTCTTCAGGAACTTGGGCTCCTTCTCGAGCTCCTTGCCAGATCGTCTG
rJMFF033C01- CCAGCATCACCATTCTTCAGGAACTTGGGCTCCTTCTCGAGCTCCTTGCCAGATCGTCTG
                      ____________________________________________________________
consensus CCAGCATCACCATTCTTCAGGAACTTGGGCTCCTTCTCGAGCTCCTTGCCAGATCGTCTG
 
. : . : . : . : . : . :
rJMFF046P14- TCAATCTTGGTCATCAGCTCAGCAAACTTGAC
rJMFF025C19- NCAATCTTGGTC
JMFN009N08+ TCAATCTTGGTCATCAGCTCAGCAAACTTGACAGCAATGTGGGAAGTGTGGCAGTCGAGA
rJMFF046A05- TCAATCTTGGTCATCAGCTCAGCAAACTTGACAGCAATGTGGGAAGTGTGGCAGTCGAGA
rJMFF041P19- CCAATCTTGGACATCAGGTCACCAAACTTGACAGCAATGTGGGAAGCGTGGCATGCAACA
rJMFF014C04- TCAATCTTGGTCATCAGCTCAGCAAACTTGACAGCAATGTGGGAAGTGTGGCAGTCGAGA
rJMFF011P18- TCAATCTTGGTCATCAGCTCAGCAAACTTGACAGCAATGTGGGAAGTGTGGCAGTCGAGA
rJMFF018B02- TCAATCTTGGTCATCAGCTCAGCAAACTTGACAGCAATGTGGGAAGTGTGGCAGTCGAGA
rJMFF017B20- TCAATCTTGGTCATCAGCTCAGCAAACTTGACAGCAATGTGGGAAGTGTGGCAGTCGAGA
rJMFF016M22- TCAATCTTGGTCATCAGCTCAGCAAACTTGACAGCAATGTGGGAAGTGTGGCAGTCGAGA
rJMFF014G02- TCAATCTTGGTCATCAGCTCAGCAAACTTGACAGCAATGTGGGAAGTGTGGCAGTCGAGA
rJMFF005E02- TCAATCTTGGTCATCAGCTCAGCAAACTTGACAGCAATGTGGGAAGTGTGGCAGTCGAGA
rJMFF045A12- TCAATCTTGGTCATCAGCTCAGCAAACTTGACAGCAATGTGGGAAGTGTGGCAGTCGAGA
rJMFF028B23- TCAATCTTGGGCATCAGCTCA
rJMFF037N23- TCAATCTTGGTCATCANCTCANCAAACTTGACAGCAATGTGGGAAGTGTGGCAGTCGANA
rJMFF004E05- TCAATCTTGGTCATCAGCTCAGCAAACTTGACAGCAATGTGGGAAGTGTGGCAGTCGAGA
rJMFF037A04- TCAATCTTGGTCATCAGCTCAGCAAACTTGACAGCAATGTGGGAAGTGTGGCAGTCGAGA
rJMFF031G20- TCAATCTTGGTCATCAGCTCAGCAAACTTGACAGCAATGTGGGAAGTGTGGCAGTCGAGA
rJMFF036P09- TCAATCTTGGTCATCAGCTCAGCAAACTTGACAGCAATGTGGGAAGTGTGGCAGTCGAGA
rJMFF019B09- TCAATCTTGGTCATCAGCTCAGCAAACTTGACAGCAATGTGGGAAGTGTGGCAGTCGAGA
rJMFF038I23- TCAATCTTGGTCATCAGCTCAGCAAACTTGACAGCAATGTGGGAAGTGTGGCAGTCGAGA
rJMFF026G11- TCAATCTTGGTCATCAGCTCAGCAAACTTGACAGCAATGTGGGAAGTGTGGCAGTCGAGA
rJMFF028K22- TCAATCTTGGTCATCAGCTCAGCAAACTTGACAGCAATGTGGGAAGTGTGGCAGTCGAGA
rJMFF030K23- TCAATCTTGGTCATCAGCTCAGCAAACTTGACAGCAATGTGGGAAGTGTGGCAGTCGAGA
rJMFF035N04- TCAATCTTGGTCATCAGCTCAGCAAACTTGACAGCAATGTGGGAAGTGTGGCAGTCGAGA
rJMFF019I10- NCAATCTTGGTCATCAGCTCAGCAAACTTGACAGCAATGTGGGAAGTGTGGCAGTCAAGA
rJMFF004I09- TCAATCTTGGTCATCAGCTCAGCAAACTTGACAGCAATGTGGGAAGTGTGGCAGTCGAGA
rJMFF015B06- TCAATCTTGGTCATCAGCTCAGCAAACTTGACAGCAATGTGGGAAGTGTGGCAGTCGAGA
rJMFF008I12- TCAATCTTGGTCATCAGCTCAGCAAACTTGACAGCAATGTGGGAAGTGTGGCAGTCGAGA
rJMFF022C20- TCAATCTTGGTCATCAGCTCAGCAAACTTGACAGCAATGTGGGAAGTGTGGCAGTCGAGA
rJMSF046N23- TCAATCTTGGTCATCAGCTCAGCAAACTTGACAGCAATGTGGGAAGTGTGGCAGTCGAGA
rJMFF016E05- TCAATCTTGGTCATCAGCTCAGCAAACTTGACAGCAATGTGGGAAGTGTGGCAGTCGAGA
rJMFF007I05- TCAATCTTGGTCATCAGCTCAGCAAACTTGACAGCAATGTGGGAAGTGTGGCAGTCGAGA
rJMFF017D06- TCAATCTTGGTCATCAGCTCAGCAAACTTGACAGCAATGTGGGAAGTGTGGCAGTCGAGA
rJMFF026G12- TCAATCTTGGTCATCAGCTCAGCAAACTTGACAGCAATGTGGGAAGTGTGGCAGTCGAGA
rJMFF035M15- TCAATCTTGGTCATCAGCTCAGCAAACTTGACAGCAATGTGGGAAGTGTGGCAGTCGAGA
rJMFF017H01- TCAATCTTGGTCATCAGCTCAGCAAACTTGACAGCAATGTGGGAAGTGTGGCAGTCGAGA
rJMFF024F06- TCAATCTTGGTCATCAGCTCAGCAAACTTGACAGCAATGTGGGAAGTGTGGCAGTCGAGA
rJMFF033C01- TCAATCTTGGTCATCAGCTCAGCAAACTTGACAGCAATGTGGGAAGTGTGGCAGTCGAGA
                      ____________________________________________________________
consensus TCAATCTTGGTCATCAGCTCAGCAAACTTGACAGCAATGTGGGAAGTGTGGCAGTCGAGA
 
. : . : . : . : . : . :
JMFN009N08+ ACAGGAGCATAACCGTTACCAATCTGACCAGGGTGGTTCATGATGATAACCTGGGAGGTG
rJMFF046A05- ACAGGAGCATAACCGTTACCAATCTGACCAGGGTGGTTCATGATGATNACCTGGGAGGTG
rJMFF041P19- ACAGGAGCATAACCGCTACCAATCTGACCAGGGAGGGTCATGATGATAACCTGCGAGGTG
rJMFF014C04- ACAGGAGCATAACCGTTACCAATCTGACCAGGGTGGTTCATGATGATAACCTGGGAGGTG
rJMFF011P18- ACAGGAGCATAACCGTTACCAATCTGACCAGGGTGGTTCATGATGATAACCTGGGAGGTG
rJMFF018B02- ACAGGAGCATAACCGTTACCAATCTGACCAGGGTGGTTCATGATGATAACCTGGGAGGTG
rJMFF017B20- ACAGGAGCATAACCGTTACCAATCTGACCAGGGTGGTTCATGATGATAACCTGGGAGGTG
rJMFF016M22- ACAGGAGCATAACCGTTACCAATCTGACCAGGGTGGTTCATGATGATAACCTGGGAGGTG
rJMFF014G02- ACAGGAGCATAACCGTTACCAATCTGACCAGGGTGGTTCATGATGATAACCTGGGAGGTG
rJMFF005E02- ACAGGAGCATAACCGTTACCAATCTGACCAGGGTGGTTCATGATGATAACCTGGGAGGTG
rJMFF045A12- ACAGGAGCATAACCGTTACCAATCTGACCAGGGTGGTTCATGATGATNACCTGGGAGGTG
rJMFF037N23- ACAGGAGCATAACCGTTACCAATCTGANCAGGGTGGTTCATGATGATAACCTGGGAGGNG
rJMFF004E05- ACAGGAGCATAACCGTTACCAATCTGACCAGGGTGGTTCATGATGATAACCTGGGAGGTG
rJMFF037A04- ACAGGAGCATAACCGTTACCAATCTGACCAGGGTGGTTCATGATGATAACCTGGGAGGTG
rJMFF031G20- ACAGGAGCATAACCGTTACCAATCTGACCAGGGTGGTTCATGATGATAACCTGGGAGGTG
rJMFF036P09- ACAGGAGCATAACCGTTACCAATCTGACCAGGGTGGTTCATGATGATAACCTGGGAGGTG
rJMFF019B09- ACAGGAGCATAACCGTTACCAATCTGACCAGGGTGGTTCATGATGATAACCTGGGAGGTG
rJMFF038I23- ACAGGAGCATAACCGTTACCAATCTGACCAGGGTGGTTCATGATGATAACCTGGGAGGTG
rJMFF026G11- ACAGGAGCATAACCGTTACCAATCTGACCAGGGTGGCTCATGATGATAACCTGGGAGGTG
rJMFF028K22- ACAGGAGCATAACCGTTACCAATCTGACCAGGGTGGTTCATGATGATAACCTGGGAGGTG
rJMFF030K23- ACAGGAGCATAACCGTTACCAATCTGACCAGGGTGGTTCATGATGATAACCTGGGAGGTG
rJMFF035N04- ACAGGAGCATAACCGTTACCAATCTGACCAGGGTGGTTCATGATGATAACCTGGGAGGTG
rJMFF019I10- ACAGGAGCATAACCGTTACCAATCTGACCAGGGTGGTTCATGATGATAACCTGGGAGGTG
rJMFF004I09- ACAGGAGCATAACCGTTACCAATCTGACCAGGGTGGTTCATGATGATAACCTGGGAGGTG
rJMFF015B06- ACAGGAGCATAACCGTTACCAATCTGACCAGGGTGGTTCATGATGATAACCTGGGAGGTG
rJMFF008I12- ACAGGAGCATAACCGTTACCAATCTGACCAGGGTGGTTCATGATGATAACCTGGGAGGTG
rJMFF022C20- ACAGGAGCATAACCGTTACCAATCTGACCAGGGTGGTTCATGATGATAACCTGGGAGGTG
rJMSF046N23- ACAGGAGCATAACCGTTACCAATCTGACCAGGGTGGTTCATGATGATAACCTGGGAGGTG
rJMFF016E05- ACAGGAGCATAACCGTTACCAATCTGACCAGGGTGGTTCATGATGATAACCTGGGAGGTG
rJMFF007I05- ACAGGAGCATAACCGTTACCAATCTGACCAGGGTGGTTCATGATGATAACCTGGGAGGTG
rJMFF017D06- ACAGGAGCATAACCGTTACCAATCTGACCAGGGTGGTTCATGATGATAACCTGGGAGGTG
rJMFF026G12- ACAGGAGCATAACCGTTACCAATCTGACCAGGGTGGTTCATGATGATAACCTGGGAGGTG
rJMFF035M15- ACAGGAGCATAACCGTTACCAATCTGACCAGGGTGGTTCATGATGATAACCTGGGAGGTG
rJMFF017H01- ACAGGAGCATAACCGTTACCAATCTGACCAGGGTGGTTCATGATGATAACCTGGGAGGTG
rJMFF024F06- ACAGGAGCATAACCGTTACCAATCTGACCAGGGTGGTTCATGATGATAACCTGGGAGGTG
rJMFF033C01- ACAGGAGCATAACCGTTACCAATCTGACCAGGGTGGTTCATGATGATAACCTGGGAGGTG
JMFN014A13+ GTTCATGATGATAACCTGGAAGGTG
                      ____________________________________________________________
consensus ACAGGAGCATAACCGTTACCAATCTGACCAGGGTGGTTCATGATGATAACCTGGGAGGTG
 
. : . : . : . : . : . :
JMFN009N08+ AAGTTGGCAGCTCCTTTCGCTG
rJMFF046A05- AAGTTGGCAGCTCCTTTCGCTGGGTCATCCTTAGAGTTGGAAGCAACGTAACCACGCTTG
rJMFF041P19- AAGTTGGCAGCTCCTTTCTCATGGACATCCTTAGAGTTGGTAGCAACGCAACCACGCTTG
rJMFF014C04- AAGTTGGCAGCTCCTTTCGCTGGGTCATCCTTANAGTTGGAAGCAACGTAACCACGCTTG
rJMFF011P18- AAGTTGGCAGCTCCTTTCGCTGGGTCATCCTTAGAGTTGGAAGCAACGTAACCACGCTTG
rJMFF018B02- AAGTTGGCAGCTCCTTTCGCTGGGTCATCCTTAGAGTTGGAAGCAACGTAACCACGCTTG
rJMFF017B20- AAGTTGGCAGCTCCTTTCGCTGGGTCATCCTTAGAGTTGGAAGCAACGTAACCACGCTTG
rJMFF016M22- AAGTTGGCAGCTCCTTTCGCTGGGTCATCCTTAGAGTTGGAAGCAACGTAACCACGCTTG
rJMFF014G02- AAGTTGGCAGCTCCTTTCGCTGGGTCATCCTTAGAGTTGGAAGCAACGTAACCACGCTTG
rJMFF005E02- AAGTTGGCAGCTCCTTTCGCTGGGTCATCCTTAGAGTTGGAAGCAACGTAACCACGCTTG
rJMFF045A12- AAGTTGGCAGCTCCTTTCGCTGGGTCATCCTTAGAGTTGGAAGCAACGTAACCACGCTTG
rJMFF037N23- AAGTTGGCAGCTCCTTTCNCTGGGTCATCCTTAAAGTTGGAAGCAACGTAACCACACTTG
rJMFF004E05- AAGTTGGCAGCTCCTTTCGCTGGGTCATCCTTAGAGTTGGAAGCAACGTAACCACGCTTG
rJMFF037A04- AAGTTGGCAGCTCCTTTCGCTGGGTCATCCTTAGAGTTGGAAGCAACGTAACCACGCTTG
rJMFF031G20- AAGTTGGCAGCTCCTTTCGCTGGGTCATCCTTAGAGTTGGAAGCAACGTAACCACGCTTG
rJMFF036P09- AAGTTGGCAGCTCCTTTCGCTGGGTCATCCTTAGAGTTGGAAGCAACGTAACCACGCTTG
rJMFF019B09- AAGTTGGCAGCTCCTTTCGCTGGGTCATCCTTAGAGTTGGAAGCAACGTAACCACGCTTG
rJMFF038I23- AAGTTGGCAGCTCCTTTCGCTGGGTCATCCTTAGAGTTGGAAGCAACGTAACCACGCTTG
rJMFF026G11- AAGTTGGCAGCTCCTTTCGCTGGGTCATCCTTAGAGTTGGAAGCAACGTAACCACGCTTG
rJMFF028K22- AAGTTGGCAGCTCCTTTCGCTGGGTCATCCTTAGAGTTGGAAGCAACGTAACCACGCCTG
rJMFF030K23- AAGTTGGCAGCTCCTTTCGCTGGGTCATCCTTAGAGTTGGAAGCAACGTAACCACGCTTG
rJMFF035N04- AAGTTGGCAGCTCCTTTCGCTGGGTCATCCTTAGAGTTGGAAGCAACGTAACCACGCTTG
rJMFF019I10- AANTTGGCAGCTCCTTTCGCTGGGTCATCCTTAGAGTTGGAAGCAACGTAACCACGCTTG
rJMFF004I09- AAGTTGGCAGCTCCTTTCGCTGGGTCATCCTTAGAGTTGGAAGCAACGTAACCACGCTTG
rJMFF015B06- AAGTTGGCAGCTCCTTTCGCTGGGTCATCCTTAGAGTTGGAAGCAACGTAACCACGCTTG
rJMFF008I12- AAGTTGGCAGCTCCTTTCGCTGGGTCATCCTTAGAGTTGGAAGCAACGTAACCACGCTTG
rJMFF022C20- AAGTTGGCAGCTCCTTTCGCTGGGTCATCCTTAGAGTTGGAAGCAACGTAACCACGCTTG
rJMSF046N23- AAGTTGGCAGCTCCTTTCGCTGGGTCATCCTTAGAGTTGGAAGCAACGTAACCACGCTTG
rJMFF016E05- AAGTTGGCAGCTCCTTTCGCTGGGTCATCCTTAGAGTTGGAAGCAACGTAACCACGCTTG
rJMFF007I05- AAGTTGGCAGCTCCTTTCGCTGGGTCATCCTTAGAGTTGGAAGCAACGTAACCACGCTTG
rJMFF017D06- AAGTTGGCAGCTCCTTTCGCTGGGTCATCCTTAGAGTTGGAAGCAACGTAACCACGCTTG
rJMFF026G12- AAGTTGGCAGCTCCTTTCGCTGGGTCATCCTTAGAGTTGGAAGCAACGTAACCACGCTTG
rJMFF035M15- AAGTTGGCAGCTCCTTTCGCTGGGTCATCCTTAGAGTTGGAAGCAACGTAACCACGCTTG
rJMFF017H01- AAGTTGGCAGCTCCTTTCGCTGGGTCATCCTTAGAGTTGGAAGCAACGTAACCACGCTTG
rJMFF024F06- AAGTTGGCAGCTCCTTTCGCTGGGTCATCCTTAGAGTTGGAAGCAACGTAACCACGCTTG
rJMFF033C01- AAGTTGGCAGCTCCTTTCGCTGGGTCATCCTTAGAGTTGGAAGCAACGTAACCACGCTTG
JMFN014A13+ AAGTTGGCAGCTCCTTTCGCTGGGTCATCCTTAGAGTTGGAAGCAACGTAACCACGCTTG
                      ____________________________________________________________
consensus AAGTTGGCAGCTCCTTTCGCTGGGTCATCCTTAGAGTTGGAAGCAACGTAACCACGCTTG
 
. : . : . : . : . : . :
rJMFF046A05- AGATCCTTCACAGCAACATTCTTC
rJMFF041P19- AGATCCTTCACAGGAACATTCTTGACGTTAGATCCAACATTGTC
rJMFF014C04- AGATCCTTCACAGCAACATTCTTCACGTTGAATCCAACATTGTCACCA-GGAAGAGCCTC
rJMFF011P18- AGATCCTTCACAGCAACATTCTTCACGTTGAATCCAACATTGTCACCA-GGAAGAGCCTC
rJMFF018B02- AGATCCTTCACAGCAACATTCTTCACGTTGAATCCAACATTGTCACCA-GGAAGAGCCTC
rJMFF017B20- AGATCCTTCACAGCAACATTCTTCACGTTGAATCCAACATTGTCACCA-GGAAGAGCCTC
rJMFF016M22- AGATCCTTCACAGCAACATTCTTCACGTTGAATCCAACATTGTCACCA-GGAAGAGCCCC
rJMFF014G02- AGATCCTTCACAGCAACATTCTTCACGTTGAATCCAACATTGTCACCA-GGAAGAGCCTC
rJMFF005E02- AGATCCTTCACAGCAACATTCTTCACGTTGAATCCAACATTGTCACCAGGGAAGAGCCTC
rJMFF045A12- AGATCCTTCACAGCAACATTCTTCACGTTGAATC
rJMFF037N23- AGATCCTTCACAGCAACATTCTTCACGTTGAATCCAACATTGTCA
rJMFF004E05- AGATCCTTCACAGCAACATTCTTCACGTTGAATCCAACATTGTCACCA-GGAAGAGCCTC
rJMFF037A04- AGATCCTTCACAGCAACATTCTTCACGTTGAATCCAACATTGTCACCA-GGAAGAGCCTC
rJMFF031G20- AGATCCTTCACAGCAACATTCTTCACGTTGAATCCAACATTGTCACCA-GGAAGAGCCTC
rJMFF036P09- AGATCCTTCACAGCAACATTCTTCACGTTGAATCCAACATTGTCACCA-GGAAGAGCCTC
rJMFF019B09- AGATCCTTCACAGCAACATTCTTCACGTTGAATCCAACATTGTCACCA-GGAAGAGCCTC
rJMFF038I23- AGATCCTTCACAGCAACATTCTTCACGTTGAATCCAACATTGTCACCA-GGAAGAGCCTC
rJMFF026G11- AGATCCTTCACAGCAACATTCTTCACGTTGAATCCAACATTGTCACCA-GGAAGAGCCTC
rJMFF028K22- AGATCCTTCACAGCAACATTCTTCACGTTGAATCCAACATTGTCACCA-GGAAGAGCCTC
rJMFF030K23- AGATCCTTCACAGCAACATTCTTCACGTTGAATCCAACATTGTCACCA-GGAAGAGCCTC
rJMFF035N04- AGATCCTTCACAGCAACATTCTTCACGTTGAATCCAACATTGTCA
rJMFF019I10- AGATCCTTCACAGCAACATTCTTCACGTTGAATCCAACATTGTCACCA-AGAANAGCCTC
rJMFF004I09- AGATCCTTCACAGCAACATTCTTCACGTTGAATCCAACATTGTCACCA-GGAAGAGCCTC
rJMFF015B06- AGATCCTTCACAGCAACATTCTTCACGTTGAATCCAACATTGTCACCA-GGAAGAGCCTC
rJMFF008I12- AGATCCTTCACAGCAACATTCTTCACGTTGAATCCAACATTGTCACCA-GGAAGAGCCTC
rJMFF022C20- AGATCCTTCACAGCAACATTCTTCACGTTGAATCCAACATTGTCACCA-GGAAGAGCCTC
rJMSF046N23- AGATCCTTCACAGCAACATTCTTCACGTTGAATCCAACATTGTCACCA-GGAAGAGCCTC
rJMFF016E05- AGATCCTTCACAGCAACATTCTTCACGTTGAATCCAACATTGTCACCA-GGAAGAGCCTC
rJMFF007I05- AGATCCTTCACAGCAACATTCTTCACGTTGAATCCAACATTGTCACCA-GGAAGAGCCTC
rJMFF017D06- AGATCCTTCACAGCAACATTCTTCACGTTGAATCCAACATTGTCACCA-GGAAGAGCCTC
rJMFF026G12- AGATCCTTCACAGCAACATTCTTCACGTTGAATCCAACATTGTCACCA-GGAAGAGCCTC
rJMFF035M15- AGATCCTTCACAGCAACATTCTTCACGTTGAATCCAACATTGTCACCA-GGAAGAGCCTC
rJMFF017H01- AGATCCTTCACAGCAACATTCTTCACGTTGAATCCAACATTGTCACCA-GGAAGAGCCTC
rJMFF024F06- AGATCCTTCACAGCAACATTCTTCACGTTGAATCCAACATTGTCACCA-GGAAGAGCCTC
rJMFF033C01- AGATCCTTCACAGCAACATTCTTCACGTTGAATCCAACATTGTCACCA-GGAAGAGCCTC
JMFN014A13+ AGATCCTTCACAGCAACATTCTTCACGTTGAATCCAACATTGTCACCA-GGAAGAGCCTC
                      ____________________________________________________________
consensus AGATCCTTCACAGCAACATTCTTCACGTTGAATCCAACATTGTCACCA-GGAAGAGCCTC
 
. : . : . : . : . : . :
rJMFF014C04- TTGAAGAGCTTCGTGATGCATCTCAACAGACTTAACTTCAGTGGNCAGG
rJMFF011P18- TTGAAGAGCTTCGTGATGCATCTCAACAGACTTAACTTCAGTGGTCAGG
rJMFF018B02- TTGAAGAGCTTCGTGATGCATCTCAACAGACTTAACTTCAGTGGTCAGG
rJMFF017B20- TTGAAGAGCTTCGTGATGCATCTCAACAGACTTAACTTCAGTGGTCA
rJMFF016M22- TTGAAGAGCTTCGTGATGCATCTCAACAGACTTAACTTCAGTGGTCAGG
rJMFF014G02- TTGAAGAGCTTCGTGATGCATCTCAACAGACTTAACTTCAGTGGTCAGGC
rJMFF005E02- TTGAAGAGCTTCGTGATGCATCTCAACAGACTTAACTTCAGTGGTCAGGC
rJMFF004E05- TTGAAGAGCTTCGTGATGCANCTCAACAGACTTAACTTCAGTGGTCAGGC
rJMFF037A04- TTGAAGAGCTTCGTGATGCATCTCAACAGACTTAACTTCAGTGGTCA
rJMFF031G20- TTGAAGAGCTTCGTGATGCATCTCAACAGACTTAACTTCAGTGGTCA
rJMFF036P09- TTGAAGAGCTTCGTGATGCATCTCAACAGACTTAACTTCAGTGGTC
rJMFF019B09- TTGAAGAGCTTCGTGATGCATCTCAACAGACTTAACTTCAGTGGTC
rJMFF038I23- TTGAAGAGCTTCNTGATGCATCTCAACAGACTTAACTTCAGTGGTCAGGCC
rJMFF026G11- TTGAAGAGCTTCGTGATGCATCTCAACAGACTTAACTTCAGTGGTCAG
rJMFF028K22- TTGAAGAGCTTCGTGATGCATCTCAACAGACTTAACTTCA
rJMFF030K23- TTGAA
rJMFF019I10- TTGAA
rJMFF004I09- TTGAAGAGCTTCGTGATGCATCTCAACAGACTTAACTTCAGTGGTCAGGCCAG
rJMFF015B06- TTGAAGAGCTTCGTGATGCATCTCAACAGACTTAACTTCAGTGGTCAGGCCAGAAGGTCC
rJMFF008I12- TTGAAGAGCTTCGTGATGCATCTCAACAGACTTAACTTCAGTGGTCAGGCCAGAANGTCC
rJMFF022C20- TTGAAGAGCTTCGTGATGCATCTCAACAGACTTAACTTCAGTGGTCANGCCAGAAGGTCC
rJMSF046N23- TTGAAGAGCTTCGTGATGCATCTCAACAGACTTAACTTCAGTGGTCAGGCCAGAAGGTCC
rJMFF016E05- TTGAAGAGCTTCGTGATGCATCTCAACAGACTTAACTTCAGTGGTCAGGCCAGAAGGTCC
rJMFF007I05- TTGAAGAGCTTCGTGATGCATCTCAACAGACTTAACTTCAGTGGTCAGGCCAGAAGGTCC
rJMFF017D06- TTGAAGAGCTTCGTGATGCATCTCAACAGACTTAACTTCAGTGGTCAGGCCAGAAGGTCC
rJMFF026G12- TTGAAGAGCTTCGTGATGCATCTCAACAGACTTAACTTCAGTGGTCAGGCCAGAAGGTCC
rJMFF035M15- TTGAAGAGCTTCGTGATGCATCTCAACAGACTTAACTTCAGTGGTCAGGCCAGAANGTCC
rJMFF017H01- TTGAAGAGCTTCGTGATGCATCTCAACAGACTTAACTTCAGTGGTCAGGCCAGAAGGTCC
rJMFF024F06- TTGAAGAGCTTCGTGATGCATCTCAACAGACTTAACTTCAGTGGTCAGGCCAGAAGGTCC
rJMFF033C01- TTGAAGAGCTTCGTGATGCATCTCAACAGACTTAACTTCAGTGGTCAGGCCAGAAGGTCC
JMFN014A13+ TTGAAGAGCTTCGTGATGCATCTCAACAGACTTAACTTCAGTGGTCAGGCCAGAAGGTCC
                      ____________________________________________________________
consensus TTGAAGAGCTTCGTGATGCATCTCAACAGACTTAACTTCAGTGGTCAGGCCAGAAGGTCC
 
. : . : . : . : . : . :
rJMFF015B06- GAAGGTCACAACCATACCA
rJMFF008I12- GAAGGTCACAACCATACCAGGCTTGAGGACACCAGTCTCCACACGACCC
rJMFF022C20- GAAGGTCACAACCATACCAGGCTTGAGGACACCAGTCTCCACACGA
rJMSF046N23- GAAGGTCACAACCATACCAGG
rJMFF016E05- GAAGGTCACAACCATACCAGGCTTGAGGACACCAGTCTCCACACGACC
rJMFF007I05- GAAGGTCACAACCATACCAG
rJMFF017D06- GAAGGTCACAACCATACCAGGCTTGAGGACACCAGTCTCCACACGACCCACA
rJMFF026G12- GAAGGTCACAACCATACCAGGCTTGAGGACACCAGTCTCCACACGACCCACAGGGGACAG
rJMFF035M15- GAAGGTCACAACCATACCAGGCTTGAGGACACCAGTCTCCACACGACCCACAGGG
rJMFF017H01- GAAGGTCACAACCATACCAGGCTTGAGGACACCAGTCTCCACACGACCCACAGGGGACAG
rJMFF024F06- GAAGGTCACAACCATACCAGGCTTGAGGACACCAGTCTCCACACGACCCACAGGGGACAG
rJMFF033C01- GAAGGTCACAACCATACCAGGCTTGAGGACACCAGTCTCCACACGACCCACA-GGGACAG
JMFN014A13+ GAAGGTCACAACCATACCAGGCTTGAGGACACCAGTCTCCACACGACCCACA-GGGACAG
                      ____________________________________________________________
consensus GAAGGTCACAACCATACCAGGCTTGAGGACACCAGTCTCCACACGACCCACAGGGGACAG
 
. : . : . : . : . : . :
rJMFF026G12- TTCCAAT-ACCACCAATTTTGTACACAT
rJMFF017H01- TTCCAATAACCACCAATTTTGTACACATCTTGG
rJMFF024F06- TTCCAAT-ACCACCAATTTTGTACACATCTTGG
rJMFF033C01- TTCCAAT-ACCACCAATTTTGTACACATCTTGG
JMFN014A13+ TTCCAAT-ACCACCAATTTTGTACACATCTTGGAGTGGGAGACGGAGGGGCTTGTCAGTG
                      ____________________________________________________________
consensus TTCCAAT-ACCACCAATTTTGTACACATCTTGGAGTGGGAGACGGAGGGGCTTGTCAGTG
 
. : . : . : . : . : . :
JMFN014A13+ GGCCTCTTGGGTTCATTAATCATATCAAGAGCTTCAAGGAGGGTCGGTCCCTTGTACCAG
JMSF046N23+ GGGTCGGTCCCTTGTACCAG
                      ____________________________________________________________
consensus GGCCTCTTGGGTTCATTAATCATATCAAGAGCTTCAAGGAGGGTCGGTCCCTTGTACCAG
 
. : . : . : . : . : . :
JMFN014A13+ TCAAGGTTGGTGGACCTTTCAATCATGTTATCACCCTCAAAACCAGAGATTGGGACAAAT
JMFF041P19+ TATCACCCTCAAAACCAGAGACTGGTACAAAT
JMFN030M08+ TGGGACAAAT
JMSF046N23+ TCAAGGTTGGTGGACCTTTCAATCATGTTATCACCCTCAAAACCAGAGATTGGGACAAAT
JMFF044O13+ TGGGACAAAT
                      ____________________________________________________________
consensus TCAAGGTTGGTGGACCTTTCAATCATGTTATCACCCTCAAAACCAGAGATTGGGACAAAT
 
. : . : . : . : . : . :
JMFN014A13+ GGGATCTTCTCAGGGTTGTATCCAACCTTCTTCAAGTAGGATGACACTTCCTTCACAATT
JMFF041P19+ GGGATCTTCTCAGGGTTGTATCCAACCTTCTTCAAGTAGGATGACACTTCCTTCACAATT
JMFN030M08+ GGGATCTTCTCAGGGTTGTATCCAACCTTCTTCAAGTAGGATGACACTTCCTTCACAATT
JMSF046N23+ GGGATCTTCTCAGGGTTGTATCCAACCTTCTTCAAGTAGGATGACACTTCCTTCACAATT
JMFN011O06+ ATGACACTTCCTTCACAATT
JMFF045A12+ GACACTTCCTTCACAATT
JMFF008I12+ TCAAGTAGGATGACACTTCCTTCACAATT
JMFF046A05+ TTCAAGTAGGATGACACTTCCTTCACAATT
JMFF044O13+ GGGATCTTCTCAGGGTNGTATCCAACCTTCTTCAAGTAGGATGACACTTCCTTCACAATT
                      ____________________________________________________________
consensus GGGATCTTCTCAGGGTTGTATCCAACCTTCTTCAAGTAGGATGACACTTCCTTCACAATT
 
. : . : . : . : . : . :
JMFN014A13+ TCATCATATCTAGCCTTGGAGTATTTGGGAGTAGTGGCATCTATCTTGTTACAGCAGCAG
JMFF041P19+ TCATCATATCTAGCCTTGGAGTATTTGGGAGTAGTGGCATCTATCTTGTTACAGCAGCAG
JMFN030M08+ TCATCATATCTAGCCTTGGAGTATTTGGGAGTAGTGGCATCTATCTTGTTACAGCAGCAG
JMSF046N23+ TCATCATATCTAGCCTTGGAGTATTTGGGAGTAGTGGCATCTATCTTGTTACAGCAGCAG
JMFN011O06+ TCATCATATCTAGCCTTGGAGTATT-GGGAGTAGTGGCATCTATCTTGTTACAGCAGCAG
JMFF017D06+ TTGGAGTATTTGGGAGTAGTGGCATCTATCTTGTTACAGCAGCAG
JMFF038I23+ GGAGTATTTGGGAGTAGTGGCATCTATCTTGTTACAGCAGCAG
JMFF045A12+ TCATCATATCTAGCCTTGGAGTATTGNGGAGTAGTGGCATCTATCTTGTTACAGCAGCAG
JMFF008I12+ TCATCATATCTAGCCTTGGAGTATTTGGGAGTAGTGGCATCTATCTTGTTACAGCAGCAG
JMFF046A05+ TCATCATATCTAGCCTTGGAGTATTTGGGAGTAGTGGCATCTTTCTTGTTACAGCAGCAG
JMFF019I10+ TGGAGTATTTGGGAGTAGTGGCATCTATCTTGTTACAGCAGCAG
JMFF007I05+ TTGGAGTATTTGGGAGTAGTGGCATCTATCTTGTTACAGCAGCAG
JMFF044O13+ TCATCATATCTAGCCTTGGAGTATTTGGGAGTAGTGGCATCTATCTTGTTACAGCAGCAG
JMFF037A04+ TGGAGTATTTGGGAGTAGTGGCATCTATCTTGTTACAGCAGCAG
JMFF033C01+ TGGAGTATTTGGGAGTAGTGGCATCTATCTTGTTACAGCAGCAG
JMFF019B09+ GGAGTATTTGGGAGTAGTGGCATCTATCTTGTTACAGCAGCAG
JMFF014G02+ GGAGTATTTGGGAGTAGTGGCATCTATCTTGTTACAGCAGCAG
JMFF037N23+ TTGTTACAGCAGCAG
JMFF018B02+ GGAGTATTTGGGAGTAGTGGCATCTATCTTGTTACAGCAGCAG
JMFF016E05+ TTTGGGAGTAGTGGCATCTATCTTGTTACAGCAGCAG
JMFF031G20+ TTGTTACAGCAGCAG
JMFF017B20+ GGAGTATTTGGGAGTAGTGGCATCTATCTTGTTACAGCAGCAG
JMFF011P18+ GGAGTATTTGGGAGTAGTGGCATCTATCTTGTTACAGCAGCAG
JMFF015B06+ TGGGAGTAGTGGCATCTATCTNGTTACAGCAGCAG
JMFF030K23+ CTTGTTACAGCAGCAG
JMFF025E17+ GTTACAGCAGCAG
JMFF018I02+ GTTACAGCAGCAG
JMFF016M22+ GTTACAGCAGCAG
JMFF028K22+ TTGTTACAGCAGCAG
JMFF017H01+ TGTTACAGCAGCAG
JMFF035N04+ GTTACAGCAGCAG
JMFF014C04+ GTTACAGCAGCAG
JMFF035M15+ TTACAGCAGCAG
JMFF026G12+ AGCAGCAG
JMFF036P09+ GTTACAGCAGCAG
JMFF004E05+ TGTTACAGCAGCAG
JMFF004I09+ TTGGGAGTAGTGGCATCTATCTTGTTACAGCAGCAG
                      ____________________________________________________________
consensus TCATCATATCTAGCCTTGGAGTATTTGGGAGTAGTGGCATCTATCTTGTTACAGCAGCAG
 
. : . : . : . : . : . :
JMFN014A13+ ATCATTTGCTTGACACCAAGGGTGAAAGCAAGCAAAGCATGCTCACGGG
JMFF041P19+ ATCATTTGCTTGACACCAAGGGTGAAAGCAAGCAAAGCATGCTCACGGGTCTGACCATCC
JMFN030M08+ ATCATTTGCTTGACACCAAGGGTGAAAGCAAGCAAAGCATGCTCACGGGTCTGACCATCC
JMSF046N23+ ATCATTTGCTTGACACCAAGGGTGAAAGCAAGCAAAGCATGCTCACGGGTCTGACCATCC
JMFN011O06+ ATCATNTGCTTGACACCAAGGGTGAAAGCAAGCAAAGCATGCTCACGGGTCTGACCATCC
JMFF017D06+ ATCATTTGCTTGACACCAAGGGTGAAAGCAAGCAAAGCATGCTCACGGGTCTGACCATCC
JMFF038I23+ ATCATTTGCTTGACACCAAGGGTGAAAGCAAGCAAAGCATGCTCACGGGTCTGACCATCC
JMFF045A12+ ATCATTTGCTTGACACCAAGGGTGAAAGCAAGCAAAGCATGCTCACGGGTCTGACCATCC
JMFF008I12+ ATCATTTGCTTGACACCAAGGGTGAAAGCAAGCAAAGCATGCTCACGGGTCTGACCATCC
JMFF046A05+ ATCATTTGCTTGACACCAAGGGTGAAAGCAAGCAAAGCATGCTCACGGGTCTGACCATCC
JMFF019I10+ ATCATTTGCTTGACACCAAGGGTGAAAGCAAGCAAAGCATGCTCACGGGTCTGACCATCC
JMFF007I05+ ATCATTTGCTTGACACCAAGGGTGAAAGCAAGCAAAGCATGCTCACGGGTCTGACCATCC
JMFF044O13+ ATCATTTGCTTGACACCAAGGGTGAAAGCAAGCAAAGCATGCTCACGGGTCTGACCATCC
JMFF037A04+ ATCATTTGCTTGACACCAAGGGTGAAAGCAAGCAAAGCATGCTCACGGGTCTGACCATCC
JMFF033C01+ ATCATTTGCTTGACACCAAGGGTGAAAGCAAGCAAAGCATGCTCACGGGTCTGACCATCC
JMFF019B09+ ATCATTTGCTTGACACCAAGGGTGAAAGCAAGCAAAGCATGCTCACGGGTCTGACCATCC
JMFF014G02+ ATCATTTGCTTGACACCAAGGGTGAAAGCAAGCAAAGCATGCTCACGGGTCTGACCATCC
JMFF037N23+ ATCATTTGCTTGACACCAAGGGTGAAAGCAAGCAAAGCATGCTCACGGGTCTGACCATCC
JMFF018B02+ ATCATTTGCTTGACACCAAGGGTGAAAGCAAGCAAAGCATGCTCACGGGTCTGACCATCC
JMFF016E05+ ATCATTTGCTTGACACCAAGGGTGAAAGCAAGCAAAGCATGCTCACGGGTCTGACCATCC
JMFF031G20+ ATCATTTGCTTGACACCAAGGGTGAAAGCAAGCAAAGCATGCTCACGGGTCTGACCATCC
JMFF017B20+ ATCATTTGCTTGACACCAAGGGTGAAAGCAAGCAAAGCATGCTCACGGGTCTGACCATCC
JMFF011P18+ ATCATTTGCTTGACACCAAGGGTGAAAGCAAGCAAAGCATGCTCACGGGTCTGACCATCC
JMFF015B06+ ATCATTTGCTTGACACCAAGGGTGAAAGCAAGCAAAGCATGCTCACGGGTCTGACCATCC
JMFF030K23+ ATCATTTGCTTGACACCAAGGGTGAAAGCAAGCAAAGCATGCTCACGGGTCTGACCATCC
JMFF025E17+ ATCATTCGCTTGACACCAAGGGTGAAAGCAAGCAAAGCATGCTCACGGGTCTGACCATCC
JMFF018I02+ ATCATTCGCTTGACACCAAGGGTGAAAGCAAGCAAAGCATGCTCACGGGTCTGACCATCC
JMFF016M22+ ATCATTTGCTTGACACCAAGGGTGAAAGCAAGCAAAGCATGCTCACGGGTCTGACCATCC
JMFF028K22+ ATCATTTGCTTGACACCAAGGGTGAAAGCAAGCAAAGCATGCTCACGGGTCTGACCATCC
JMFF017H01+ ATCATTTGCTTGACACCAAGGGTGAAAGCAAGCAAAGCATGCTCACGGGTCTGACCATCC
JMFF035N04+ ATCATTTGCTTGACACCAAGGGTGAAAGCAAGCAAAGCATGCTCACGGGTCTGACCATCC
JMFF014C04+ ATCATTTGCTTGACACCAAGGGTGAAAGCAAGCAAAGCATGCTCACGGGTCTGACCATCC
JMFF035M15+ ATCATTTGCTTGACACCAAGGGTGAAAGCAAGCAAAGCATGCTCACGGGTCTGACCATCC
JMFF026G12+ ATCATTTGCTTGACACCAAGGGTGAAAGCAAGCAAAGCATGCTCACGGGTCTGACCATCC
JMFF036P09+ ATCATTTGCTTGACACCAAGGGTGAAAGCAAGCAAAGCATGCTCACGGGTCTGACCATCC
JMFF022C20+ GGGTGAAAGCAAGCAAAGCATGCTCACGGGTCTGACCATCC
JMSF012F18+ AGCAAAGCATGCTCACGGGTCTGACCATCC
JMFF004E05+ ATCATTTGCTTGACACCAAGGGTGAAAGCAAGCAAAGCATGCTCACGGGTCTGACCATCC
JMFF015L15+ AGGGTGAAAGCAAGCAAAGCATGCTCGCGGGTCTGACCATCC
JMFF004I09+ ATCATTTGCTTGACACCAAGGGTGAAAGCAAGCAAAGCATGCTCACGGGTCTGACCATCC
JMFF026G11+ GGTGAAAGCAAGCAAAGCATGCTCACGGGTCTGACCATCC
                      ____________________________________________________________
consensus ATCATTTGCTTGACACCAAGGGTGAAAGCAAGCAAAGCATGCTCACGGGTCTGACCATCC
 
. : . : . : . : . : . :
JMFF041P19+ TTTGAAATATCAGCTTCGAAACCACCAGTAGTGGAATCGATGATAAGAACAGCACAGTCA
JMFN030M08+ TTTGAAATACCAGCTTCGAAACCACCAGTAGTGGAATCGATGATAAGAACAGCACAGTCA
JMSF046N23+ TTTGAAATACCAGCTTCGAAACCACCAGTAGTGGAATCGATGATAAGAACAGCACAGTCA
JMFN011O06+ TTTGAAATACCAGCTTCGAAACCACCAGTAGTGGAATCGATGATAAGAACAGCACAGTCA
JMFF017D06+ TTTGAAATACCAGCTTCGAAACCACCAGTAGTGGAATCGATGATAAGAACAGCACAGTCA
JMFF038I23+ TTTGAAATACCAGCTTCGAAACCACCAGTAGTGGAATCGATGATAAGAACAGCACAGTCA
JMFF045A12+ TTTGAAATACCAGCTTCGAAACCACCAGTAGTGGAATCGATGATAAGAACAGCACAGTCA
JMFF008I12+ TTTGAAATACCAGCTTCGAAACCACCAGTAGTGGAATCGATGATAAGAACAGCACAGTCA
JMFF046A05+ TTTGAAATACCAGCTTCGAAACCACCAGTAGTGGAATCGATGATAAGAACAGCACAGTCA
JMFF019I10+ TTTGAAATACCAGCTTCGAAACCACCAGTAGTGGAATCGATGATAAGAACAGCACAGTCA
JMFF007I05+ TTTGAAATACCAGCTTCGAAACCACCAGTAGTGGAATCGATGATAAGAACAGCACAGTCA
JMFF044O13+ TTTGAAATACCAGCTTCGAAACCACCAGTAGTGGAATCGATGATAAGAACAGCACAGTCA
JMFF037A04+ TTTGAAATACCAGCTTCGAAACCACCAGTAGTGGAATCGATGATAAGAACAGCACAGTCA
JMFF033C01+ TTTGAAATACCAGCTTCGAAACCACCAGTAGTGGAATCGATGATAAGAACAGCACAGTCA
JMFF019B09+ TTTGAAATACCAGCTTCGAAACCACCAGTAGTGGAATCGATGATAAGAACAGCACAGTCA
JMFF014G02+ TTTGAAATACCAGCTTCGAAACCACCAGTAGTGGAATCGATGATAAGAACAGCACAGTCA
JMFF037N23+ TTTGAAATACCAGCTTCGAAACCACCAGTAGTGGAATCGATGATAAGAACAGCACAGTCA
JMFF018B02+ TTTGAAATACCAGCTTCGAAACCACCAGTAGTGGAATCGATGATAAGAACAGCACAGTCA
JMFF016E05+ TTTGAAATACCAGCTTCGAAACCACCAGTAGTGGAATCGATGATAAGAACAGCACAGTCA
JMFF031G20+ TTTGAAATACCAGCTTCGAAACCACCAGTAGTGGAATCGATGATAAGAACAGCACAGTCA
JMFF017B20+ TTTGAAATACCAGCTTCGAAACCACCAGTAGTGGAATCGATGATAAGAACAGCACAGTCA
JMFF011P18+ TTTGAAATACCAGCTTCGAAACCACCAGTAGTGGAATCGATGATAAGAACAGCACAGTCA
JMFF015B06+ TTTGAAATACCAGCTTCGAAACCACCAGTAGTGGAATCGATGATAAGAACAGCACAGTCA
JMFF030K23+ TTTGAAATACCAGCTTCGAAACCACCAGTAGTGGAATCGATGATAAGAACAGCACAGTCA
JMFF025E17+ TTTGAAATACCAGCTTCGAAACCACCAGTAGTGGAATCGATGATAAGAACAGCACAGTCA
JMFF018I02+ TTTGAAATACCAGCTTCGAAACCACCAGTAGTGGAATCGATGATAAGAACAGCACAGTCA
JMFF016M22+ TTTGAAATACCAGCTTCGAAACCACCAGTAGTGGAATCGATGATAAGAACAGCACAGTCA
JMFF028K22+ TTTGAAATACCAGCTTCGAAACCACCAGTAGTGGAATCGATGATAAGAACAGCACAGTCA
JMFF017H01+ TTTGAAATACCAGCTTCGAAACCACCAGTAGTGGAATCGATGATAAGAACAGCACAGTCA
JMFF035N04+ TTTGAAATACCAGCTTCGAAACCACCAGTAGTGGAATCGATGATAAGAACAGCACAGTCA
JMFF014C04+ TTTGAAATACCAGCTTCGAAACCACCAGTAGTGGAATCGATGATAAGAACAGCACAGTCA
JMFF035M15+ TTTGAAATACCAGCTTCGAAACCACCAGTAGTGGAATCGATGATAAGAACAGCACAGTCA
JMFF026G12+ TTTGAAATACCAGCTTCGAAACCACCAGTAGTGGAATCGATGATAAGAACAGCACAGTCA
JMFF036P09+ TTTGAAATACCAGCTTCGAAACCACCAGTAGTGGAATCGATGATAAGAACAGCACAGTCA
JMFF022C20+ TTTGAAATACCAGCTTCGAAACCACCAGTAGTGGAATCGATGATAAGAACAGCACAGTCA
JMSF012F18+ TTTGAAATACCAGCTTCGAAACCACCAGTAGTGGAATCGATGATAAGAACAGCACAGTCA
JMFF005E02+ TTTGAAATACCAGCTTCGAAACCACCAGTAGTGGAATCGATGATAAGAACAGCACAGTCA
JMFF024F06+ AATACCAGCTTCGAAACCACCAGTAGTGGAATCGATGATAAGAACAGCACAGTCA
JMFF004E05+ TTTGAAATACCAGCTTCGAAACCACCAGTAGTGGAATCGATGATAAGAACAGCACAGTCA
JMFF046P14+ GAATCGATGATAAGAACAGCACAGTCA
JMFF015L15+ TTTGAAATACCAGCTTCGAAACCACCAGTAGTGGAATCGATGATAAGAACAGCACAGTCA
JMFF004I09+ TTTGAAATACCAGCTTCGAAACCACCAGTAGTGGAATCGATGATAAGAACAGCACAGTCA
JMFF026G11+ TTTGAAATACCAGCTTCGAAACCACCAGTAGTGGAATCGATGATAAGAACAGCACAGTCA
                      ____________________________________________________________
consensus TTTGAAATACCAGCTTCGAAACCACCAGTAGTGGAATCGATGATAAGAACAGCACAGTCA
 
. : . : . : . : . : . :
JMFF041P19+ GCTTGTGAGGTTCCAGTGATCATGTTCTTGATAAAGTCACGATGCCCTGGGGCATCAATA
JMFN030M08+ GCTTGTGAGGTTCCAGTGATCATGTTCTTGATAAAGTCACGATGCCCTGGGGCATCAATA
JMSF046N23+ GCTTGTGAGGTTCCAGTGATCATGTTCTTGATAAAGTCACGATGCCCTGGGGCATCAATA
JMFN011O06+ GCTTGTGAGGTTCCAGTGATCATGTTCTTGATAAAGTCACGATGCCCTGGGGCATCAATA
JMFF017D06+ GCTTGTGAGGTTCCAGTGATCATGTTCTTGATAAAGTCACGATGCCCTGGGGCATCAATA
JMFF038I23+ GCTTGTGAGGTTCCAGTGATCATGTTCTTGATAAAGTCACGATGCCCTGGGGCATCAATA
JMFF045A12+ GCTTGTGAGGTTCCAGTGATCATGTTCTTGATAAAGTCACGATGCCCTGGGGCATCAATA
JMFF008I12+ GCTTGTGAGGTTCCAGTGATCATGTTCTTGATAAAGTCACGATGCCCTGGGGCATCAATA
JMFF046A05+ GCTTGTGAGGTTCCAGTGATCATGTTCTTGATAAAGTCACGATGCCCTGGGGCATCAATA
JMFF019I10+ GCTTGTGAGGTTCCAGTGATCATGTTCTTGATAAAGTCACGATGCCCTGGGGCATCAATA
JMFF007I05+ GCTTGTGAGGTTCCAGTGATCATGTTCTTGATAAAGTCACGATGCCCTGGGGCATCAATA
JMFF044O13+ GCTTGTGAGGTTCCAGTGATCATGTTCTTGATAAAGTCACGATGCCCTGGGGCATCAATA
JMFF037A04+ GCTTGTGAGGTTCCAGTGATCATGTTCTTGATAAAGTCACGATGCCCTGGGGCATCAATA
JMFF033C01+ GCTTGTGAGGTTCCAGTGATCATGTTCTTGATAAAGTCACGATGCCCTGGGGCATCAATA
JMFF019B09+ GCTTGTGAGGTTCCAGTGATCATGTTCTTGATAAAGTCACGATGCCCTGGGGCATCAATA
JMFF014G02+ GCTTGTGAGGTTCCAGTGATCATGTTCTTGATAAAGTCACGATGCCCTGGGGCATCAATA
JMFF037N23+ GCTTGTGAGGTTCCAGTGATCATGTTCTTGATAAAGTCACGATGCCCTGGGGCATCAATA
JMFF018B02+ GCTTGTGAGGTTCCAGTGATCATGTTCTTGATAAAGTCACGATGCCCTGGGGCATCAATA
JMFF016E05+ GCTTGTGAGGTTCCAGTGATCATGTTCTTGATAAAGTCACGATGCCCTGGGGCATCAATA
JMFF031G20+ GCTTGTGAGGTTCCAGTGATCATGTTCTTGATAAAGTCACGATGCCCTGGGGCATCAATA
JMFF017B20+ GCTTGTGAGGTTCCAGTGATCATGTTCTTGATAAAGTCACGATGCCCTGGGGCATCAATA
JMFF011P18+ GCTTGTGAGGTTCCAGTGATCATGTTCTTGATAAAGTCACGATGCCCTGGGGCATCAATA
JMFF015B06+ GCTTGTGAGGTTCCAGTGATCATGTTCTTGATAAAGTCACGATGCCCTGGGGCATCAATA
JMFF030K23+ GCTTGTGAGGTTCCAGTGATCATGTTCTTGATAAAGTCACGATGCCCTGGGGCATCAATA
JMFF025E17+ GCTTGTGAGGTTCCAGTGATCATGTTCTTGATAAAGTCACGATGCCCTGGGGCATCAATA
JMFF018I02+ GCTTGTGAGGTTCCAGTGATCATGTTCTTGATAAAGTCACGATGCCCTGGGGCATCAATA
JMFF016M22+ GCTTGTGAGGTTCCAGTGATCATGTTCTTGATAAAGTCACGATGCCCTGGGGCATCAATA
JMFF028K22+ GCTTGTGAGGTTCCAGTGATCATGTTCTTGATAAAGTCACGATGCCCTGGGGCATCAATA
JMFF017H01+ GCTTGTGAGGTTCCAGTGATCATGTTCTTGATAAAGTCACGATGCCCTGGGGCATCAATA
JMFF035N04+ GCTTGTGAGGTTCCAGTGATCATGTTCTTGATAAAGTCACGATGCCCTGGGGCATCAATA
JMFF014C04+ GCTTGTGAGGTTCCAGTGATCATGTTCTTGATAAAGTCACGATGCCCTGGGGCATCAATA
JMFF035M15+ GCTTGTGAGGTTCCAGTGATCATGTTCTTGATAAAGTCACGATGCCCTGGGGCATCAATA
JMFF026G12+ GCTTGTGAGGTTCCAGTGATCATGTTCTTGATAAAGTCACGATGCCCTGGGGCATCAATA
JMFF036P09+ GCTTGTGAGGTTCCAGTGATCATGTTCTTGATAAAGTCACGATGCCCTGGGGCATCAATA
JMFF022C20+ GCTTGTGAGGTTCCAGTGATCATGTTCTTGATAAAGTCACGATGCCCTGGGGCATCAATA
JMSF012F18+ GCTTGTGAGGTTCCAGTGATCATGTTCTTGATAAAGTCACGATGCCCTGGGGCATCAATA
JMFF005E02+ GCTTGTGAGGTTCCAGTGATCATGTTCTTGATAAAGTCACGATGCCCTGGGGCATCAATA
JMFF024F06+ GCTTGTGAGGTTCCAGTGATCATGTTCTTGATAAAGTCACGATGCCCTGGGGCATCAATA
JMFF004E05+ GCTTGTGAGGTTCCAGTGATCATGTTCTTGATAAAGTCACGATGCCCTGGGGCATCAATA
JMFF046P14+ GCTTGTGAGGTTCCAGTGATCATGTTCTGNATAAAGTCACGATGCCCTGGGGCATCAATA
JMFF015L15+ GCTTGTGAGGTTCCAGTGATCATGTTCTTGATAAAGTCACGATGCCCTGGGGCATCAATA
JMFF004I09+ GCTTGTGAGGTTCCAGTGATCATGTTCTTGATAAAGTCACGATGCCCTGGGGCATCAATA
JMFF026G11+ GCTTGTGAGGTTCCAGTGATCATGTTCTTGATAAAGTCACGATGCCCTGGGGCATCAATA
                      ____________________________________________________________
consensus GCTTGTGAGGTTCCAGTGATCATGTTCTTGATAAAGTCACGATGCCCTGGGGCATCAATA
 
. : . : . : . : . : . :
JMFF041P19+ ACTGTGCAGTAGTACTTGGTGGTCTCGAACTTCCGCAA-GGCAATATCAATGGTGATACC
JMFN030M08+ ACTGTGCAGTAGTACTTGGTGGTCTCAAACTTCCACAA-GGCAATATCAATGGTGATACC
JMSF046N23+ ACTGTGCAGTAGTACTTGGTGGTCTCAAACTTCCACAA-GGCAATATCAATGGTGATACC
JMFN011O06+ ACTGTGCAGTAGTACTTGGTGGTCTCAAACTTCCACAA-GGCAATATCAATGGTGATACC
JMFF017D06+ ACTGTGCAGTAGTACTTGGTGGTCTCAAACTTCCACAA-GGCAATATCAATGGTGATACC
JMFF038I23+ ACTGTGCAGTAGTACTTGGTGGTCTCAAACTTCCACAA-GGCAATATCAATGGTGATACC
JMFF045A12+ ACTGTGCAGTAGTACTTGGTGGTCTCAAACTTCCACAA-GGCAATATCAATGGTGATACC
JMFF008I12+ ACTGTGCAGTAGTACTTGGTGGTCTCAAACTTCCACAA-GGCAATATCAATGGTGATACC
JMFF046A05+ ACTGTGCAGTAGTACTTGGTGGTCTCAAACTTCCACAA-GGCAATATCAATGGTGATACC
JMFF019I10+ ACTGTGCAGTAGTACTTGGTGGTCTCAAACTTCCACAA-GGCAATATCAATGGTGATACC
JMFF007I05+ ACTGTGCAGTAGTACTTGGTGGTCTCAAACTTCCACAA-GGCAATATCAATGGTGATACC
JMFF044O13+ ACTGTGCAGTAGTACTTGGTGGTCTCAAACTTCCACAA-GGCAATATCAATGGTGATACC
JMFF037A04+ ACTGTGCAGTAGTACTTGGTGGTCTCAAACTTCCACAAGGGCAATATCAATGGTGATACC
JMFF033C01+ ACTGTGCAGTAGTACTTGGTGGTCTCAAACTTCCACAA-GGCAATATCAATGGTGATACC
JMFF019B09+ ACTGTGCAGTAGTACTTGGTGGTCTCAAACTTCCACAA-GGCAATATCAATGGTGATACC
JMFF014G02+ ACTGTGCAGTAGTACTTGGTGGTCTCAAACTTCCACAA-GGCAATATCAATGGTGATACC
JMFF037N23+ ACTGTGCAGTAGTACTTGGTGGTCTCAAACTTCCACAAGGGCAATATCAATGGTGATACC
JMFF018B02+ ACTGTGCAGTAGTACTTGGTGGTCTCAAACTTCCACAAGGGCAATATCAATGGTGATACC
JMFF016E05+ ACTGTGCAGTAGTACTTGGTGGTCTCAAACTTCCACAA-GGCAATATCAATGGTGATACC
JMFF031G20+ ACTGTGCAGTAGTACTTGGTGGTCTCAAACTTCCACAA-GGCAATATCAATGGTGATACC
JMFF017B20+ ACTGTGCAGTAGTACTTGGTGGTCTCAAACTTCCACAA-GGCAATATCAATGGTGATACC
JMFF011P18+ ACTGTGCAGTAGTACTTGGTGGTCTCAAACTTCCACAA-GGCAATATCAATGGTGATACC
JMFF015B06+ ACTGTGCAGTAGTACTTGGTGGTCTCAAACTTCCACAA-GGCAATATCAATGGTGATACC
JMFF030K23+ ACTGTGCAGTAGTACTTGGTGGTCTCAAACTTCCACAA-GGCAATATCAATGGTGATACC
JMFF025E17+ ACTGTGCAGTAGTACTTGGTGGTCTCAAACTTCCACAA-GGCAATATCAATGGTGATACC
JMFF018I02+ ACTGTGCAGTAGTACTTGGTGGTCTCAAACTTCCACAA-GGCAATATCAATGGTGATACC
JMFF016M22+ ACTGTGCAGTAGTACTTGGTGGTCTCAAACTTCCACAA-GGCAATATCAATGGTGATACC
JMFF028K22+ ACTGTGCAGTAGTACTTGGTGGTCTCAAACTTCCACAA-GGCAATATCAATGGTGATACC
JMFF017H01+ ACTGTGCAGTAGTACTTGGTGGTCTCAAACTTCCACAA-GGCAATATCAATGGTGATACC
JMFF035N04+ ACTGTGCAGTAGTACTTGGTGGTCTCAAACTTCCACAA-GGCAATATCAATGGTGATACC
JMFF014C04+ ACTGTGCAGTAGTACTTGGTGGTCTCAAACTTCCACAA-GGCAATATCAATGGTGATACC
JMFF035M15+ ACTGTGCAGTAGTACTTGGTGGTCTCAAACTTCCACAA-GGCAATATCAATGGTGATACC
JMFF026G12+ ACTGTGCAGTAGTACTTGGTGGTCTCAAACTTCCACAA-GGCAATATCAATGGTGATACC
JMFF036P09+ ACTGTGCAGTAGTACTTGGTGGTCTCAAACTTCCACAA-GGCAATATCAATGGTGATACC
JMFF022C20+ ACTGTGCAGTAGTACTTGGTGGTCTCAAACTTCCACAA-GGCAATATCAATGGTGATACC
JMSF012F18+ ACTGTGCAGTAGTACTTGGTGGTCTCAAACTTCCACAA-GGCAATATCAATGGTGATACC
JMFF005E02+ ACTGTGCAGTAGTACTTGGTGGTCTCAAACTTCCACAA-GGCAATATCAATGGTGATACC
JMFF024F06+ ACTGTGCAGTAGTACTTGGTGGTCTCAAACTTCCACAA-GGCAATATCAATGGTGATACC
JMFF004E05+ ACTGTGCAGTAGTACTTGGTGGTCTCAAACTTCCACAA-GGCAATATCAATGGTGATACC
JMFF046P14+ ACTGTGCAGTAGTACTTGGTGGTCCCAAACTTCCACAA-GGCAATATCAATGGCGATACC
JMFF015L15+ ACTGTGCAGTAGTACTTGGTGGTCTCAAACTTCCACAA-GGCAATATCAATGGTGATACC
JMFF004I09+ ACTGTGCAGTAGTACTTGGTGGTCTCAAACTTCCACAA-GGCAATATCAATGGTGATACC
JMFF026G11+ ACTGTGCAGTAGTACTTGGTGGTCTCAAACTTCCACAA-GGCAATATCAATGGTGATACC
                      ____________________________________________________________
consensus ACTGTGCAGTAGTACTTGGTGGTCTCAAACTTCCACAA-GGCAATATCAATGGTGATACC
 
. : . : . : . : . : . :
JMFF041P19+ ACGCTCACGTTCAGCCTTGAGCTTGTCAAGCACCCACGCATACTTGAATGGCCTCTTGTT
JMFN030M08+ ACGCTCACGTTCAGCCTTGAGCTTGTCAAGCACCCACGCATACTTGAATGACCTCTTGTT
JMSF046N23+ ACGCTCACGTTCAGCCTTGAGCTTGTCAAGCACCCACGCATACTTGAATGACCTCTTGTT
JMFN011O06+ ACGCTCACGTTCAGCCTTGAGCTTGTCAAGCACCCACGCATACTTAAATGACCTCTTGTT
JMFF017D06+ ACGCTCACGTTCAGCCTTGAGCTTGTCAAGCACCCACGCATACTTGAATGACCTCTTGTT
JMFF038I23+ ACGCTCACGTTCAGCCTTGAGCTTGTCAAGCACCCACGCATACTTGAATGACCTCTTGTT
JMFF045A12+ ACGCTCACGTTCAGCCTTGAGCTTGTCAAGCACCCACGCATACTTGAATGACCTCTTGTT
JMFF008I12+ ACGCTCACGTTCAGCCTTGAGCTTGTCAAGCACCCACGCATACTTGAATGACCTCTTGTT
JMFF046A05+ ACGCTCACGTTCAGCCTTGAGCTTGTCAAGCACCCACGCATACTTGAATGACCTCTTGTT
JMFF019I10+ ACGCTCACGTTCAGCCTTGAGCTTGTCAAGCACCCACGCATACTTGAATGACCTCTTGTT
JMFF007I05+ ACGCTCACGTTCAGCCTTGAGCTTGTCAAGCACCCACGCATACTTGAATGACCTCTTGTT
JMFF044O13+ ACGCTCACGTTCAGCCTTGAGCTTGTCAAGCACCCACGCATACTTGAATGACCTCTTGTT
JMFF037A04+ ACGCTCACGTTCAGCCTTGAGCTTGTCAAGCACCCACGCATACTTGAATGACCTCTTGTT
JMFF033C01+ ACGCTCACGTTCAGCCTTGAGCTTGTCAAGCACCCACGCATACTTGAATGACCTCTTGTT
JMFF019B09+ ACGCTCACGTTCAGCCTTGAGCTTGTCAAGCACCCACGCATACTTGAATGACCTCTTGTT
JMFF014G02+ ACGCTCACGTTCAGCCTTGAGCTTGTCAAGCACCCACGCATACTTGAATGACCTCTTGTT
JMFF037N23+ ACGCTCACGTTCAGCCTTGAGCTTGTCAAGCACCCACGCATACTTGAATGACCTCTTGTT
JMFF018B02+ ACGCTCACGTTCAGCCTTGAGCTTGTCAAGCACCCACGCATACTTGAATGACCTCTTGTT
JMFF016E05+ ACGCTCACGTTCAGCCTTGAGCTTGTCAAGCACCCACGCATACTTGAATGACCTCTTGTT
JMFF031G20+ ACGCTCACGTTCAGCCTTGAGCTTGTCAAGCACCCACGCATACTTGAATGACCTCTTGTT
JMFF017B20+ ACGCTCACGTTCAGCCTTGAGCTTGTCAAGCACCCACGCATACTTGAATGACCTCTTGTT
JMFF011P18+ ACGCTCACGTTCAGCCTTGAGCTTGTCAAGCACCCACGCATACTTGAATGACCTCTTGTT
JMFF015B06+ ACGCTCACGTTCAGCCTTGAGCTTGTCAAGCACCCACGCATACTTGAATGACCTCTTGTT
JMFF030K23+ ACGCTCACGTTCAGCCTTGAGCTTGTCAAGCACCCACGCATACTTGAATGACCTCTTGTT
JMFF025E17+ ACGCTCACGTTCAGCCTTGAGCTTGTCAAGCACCCACGCATACTTGAATGACCTCTTGTT
JMFF018I02+ ACGCTCACGTTCAGCCTTGAGCTTGTCAAGCACCCACGCATACTTGAATGACCTCTTGTT
JMFF016M22+ ACGCTCACGTTCAGCCTTGAGCTTGTCAAGCACCCACGCATACTTGAATGACCTCTTCTT
JMFF028K22+ ACGCTCACGTTCAGCCTTGAGCTTGTCAAGCACCCACGCATACTTGAATGACCTCTTGTT
JMFF017H01+ ACGCTCACGTTCAGCCTTGAGCTTGTCAAGCACCCACGCATACTTGAATGACCTCTTGTT
JMFF035N04+ ACGCTCACGTTCAGCCTTGAGCTTGTCAAGCACCCACGCATACTTGAATGACCTCTTGTT
JMFF014C04+ ACGCTCACGTTCAGCCTTGAGCTTGTCAAGCACCCACGCATACTTGAATGACCTCTTGTT
JMFF035M15+ ACGCTCACGTTCAGCCTTGAGCTTGTCAAGCACCCACGCATACTTGAATGACCTCTTGTT
JMFF026G12+ ACGCTCACGTTCAGCCTTGAGCTTGTCAAGCACCCACGCATACTTGAATGACCTCTTGTT
JMFF036P09+ ACGCTCACGTTCAGCCTTGAGCTTGTCAAGCACCCACGCATACTTGAATGACCTCTTGTT
JMFF022C20+ ACGCTCACGTTCAGCCTTGAGCTTGTCAAGCACCCACGCATACTTGAATGACCTCTTGTT
JMSF012F18+ ACGCTCACGTTCAGCCTTGAGCTTGTCAAGCACCCACGCATACTTGAATGACCTCTTGTT
JMFF005E02+ ACGCTCACGTTCAGCCTTGAGCTTGTCAAGCACCCACGCATACTTGAATGACCTCTTGTT
JMFF024F06+ ACGCTCACGTTCAGCCTTGAGCTTGTCAAGCACCCACGCATACTTGAATGACCTCTTGTT
JMFF004E05+ ACGCTCACGTTCAGCCTTGAGCTTGTCAAGCACCCACGCATACTTGAATGACCTCTTGTT
JMFF046P14+ ACGCTCACGTTCAGCCTTGAGCTTGTCAAGCACCCACGCATACTTGAATGACCTCTTGTT
JMFF015L15+ ACGCTCACGTTCAGCCTTGAGCTTGTCAAGCACCCACGCATACTTGAATGACCTCTTGTT
JMFF004I09+ ACGCTCACGTTCAGCCTTGAGCTTGTCAAGCACCCACGCATACTTGAATGACCTCTTGTT
JMFF026G11+ ACGCTCACGTTCAGCCTTGAGCTTGTCAAGCACCCACGCATACTTGAATGACCTCTTGTT
                      ____________________________________________________________
consensus ACGCTCACGTTCAGCCTTGAGCTTGTCAAGCACCCACGCATACTTGAATGACCTCTTGTT
 
. : . : . : . : . : . :
JMFF041P19+ CATCTCAGCAGCTTCCTTCTCGAACCTGTCAATCACACGCTTGTCAATACCTCCAAGCTT
JMFN030M08+ CATCTCAGCAGCTTCCTTCTCGAACCTCTCAATCACACGCTTGTCAATACCTCCAAGCTT
JMSF046N23+ CATCTCAGCAGCTTCCTTCTCGAACCTCTCAATCACACGCTTGTCAATACCTCCAAGCTT
JMFN011O06+ CATCTCAGCAGCTTCCTTCTCGAACCTCTCAATCACACGCTTGTCAATACCTCCAAGCTT
JMFF017D06+ CATCTCAGCAGCTTCCTTCTCGAACCTCTCAATCACACGCTTGTCAATACCTCCAAGCTT
JMFF038I23+ CATCTCAGCAGCTTCCTTCTCGAACCTCTCAATCACACGCTTGTCAATACCTCCAAGCTT
JMFF045A12+ CATCTCAGCAGCTTCCTTCTCGAACCTCTCAATCACACGCTTGTCAATACCTCCAAGCTT
JMFF008I12+ CATCTCAGCAGCTTCCTTCTCGAACCTCTCAATCACACGCTTGTCAATACCTCCAAGCTT
JMFF046A05+ CATCTCAGCAGCTTCCTTCTCGAACCTCTCAATCACACGCTTGTCAATACCTCCAAGCTT
JMFF019I10+ CATCTCAGCAGCTTCCTTCTCGAACCTCTCAATCACACGCTTGTCAATACCTCCAAGCTT
JMFF007I05+ CATCTCAGCAGCTTCCTTCTCGAACCTCTCAATCACACGCTTGTCAATACCTCCAAGCTT
JMFF044O13+ CATCTCAGCAGCTTCCTTCTCGAACCTCTCAATCACACGCTTGTCAATACCTCCAAGCTT
JMFF037A04+ CATCTCAGCAGCTTCCTTCTCGAACCTCTCAATCACACGCTTGTCAATACCTCCAAGCTT
JMFF033C01+ CATCTCAGCAGCTTCCTTCTCGAACCTCTCAATCACACGCTTGTCAATACCTCCAAGCTT
JMFF019B09+ CATCTCAGCAGCTTCCTTCTCGAACCTCTCAATCACACGCTTGTCAATACCTCCAAGCTT
JMFF014G02+ CATCTCAGCAGCTTCCTTCTCGAACCTCTCAATCACACGCTTGTCAATACCTCCAAGCTT
JMFF037N23+ CATCTCAGCAGCTTCCTTCTCGAACCTCTCAATCACACGCTTGTCAATACCTCCAAGCTT
JMFF018B02+ CATCTCAGCAGCTTCCTTCTCGAACCTCTCAATCACACGCTTGTCAATACCTCCAAGCTT
JMFF016E05+ CATCTCAGCAGCTTCCTTCTCGAACCTCTCAATCACACGCTTGTCAATACCTCCAAGCTT
JMFF031G20+ CATCTAAGCAGCTTCCTTCTCGAACCTCTCAATCACACGCTTGTCAATACCTCCAAGCTT
JMFF017B20+ CATCTAAGCAGCTTCCTTCTCGAACCTCTCAATCACACGCTTGTCAATACCTCCAAGCTT
JMFF011P18+ CATCTCAGCAGCTTCCTTCTCGAACTTCTCAATCACACGCTTGTCAATACCTCCAAGCTT
JMFF015B06+ CATCTCAGCAGCTTCCTTCTCGAACCTCTCAATCACACGCTTGTCAATACCTCCAAGCTT
JMFF030K23+ CATCTCAGCAGCTTCCTTCTCGAACCTCTCAATCACACGCTTGTCAATACCTCCAAGCTT
JMFF025E17+ CATCTCAGCAGCTTCCTTCTCGAACCTCTCAATCACACGCTTGTCAATACCTCCAAGCTT
JMFF018I02+ CATCTCAGCAGCTTCCTTCTCGAACCTCTCAATCACACGCTTGTCAATACCTCCAAGCTT
JMFF016M22+ CATCTCAGCAGCTTCCTTCTCGAACCTCTCAATCACACGCTTGTCAATACCTCCAAGCTT
JMFF028K22+ CATCTCAGCAGCTTCCTTCTCGAACCTCTCAATCACACGCTTGTCAATACCTCCAAGCTT
JMFF017H01+ CATCTCAGCAGCTTCCTTCTCGAACCTCTCAATCACACGCTTGTCAATACCTCCAAGCTT
JMFF035N04+ CATCTCAGCAGCTTCCTTCTCGAACCTCTCAATCACACGCTTGTCAATACCTCCAAGCTT
JMFF014C04+ CATCTCAGCAGCTTCCTTCTCGAACCTCTCAATCACACGCTTGTCAATACCTCCAAGCTT
JMFF035M15+ CATCTCAGCAGCTTCCTTCTCGAACCTCTCAATCACACGCTTGTCAATACCTCCAAGCTT
JMFF026G12+ CATCTCAGCAGCTTCCTTCTCGAACCTCTCAATCACACGCTTGTCAATACCTCCAAGCTT
JMFF036P09+ CATCTCAGCAGCTTCCTTCTCGAACCTCTCAATCACACGCTTGTCAATACCTCCAAGCTT
JMFF022C20+ CATCTCAGCAGCTTCCTTCTCGAACCTCTCAATCACACGCTTGTCAATACCTCCAAGCTT
JMSF012F18+ CATCTCAGCAGCTTCCTTCTCGAACCTCTCAATCACACGCTTGTCAATACCTCCAAGCTT
JMFF005E02+ CATCTCAGCAGCTTCCTTCTCGAACCTCTCAATCACACGCTTGTCAATACCTCCAAGCTT
JMFF024F06+ CATCTCAGCAGCTTCCTTCTCGAACCTCTCAATCACACGCTTGTCAATACCTCCAAGCTT
JMFF004E05+ CATCTCAGCAGCTTCCTTCTCGAACCTCT-AATCACACGCTTGTCAATACCTCCAAGCTT
JMFF046P14+ CATCTCAGCAGCTTCCTTCTCGAACCTCTCAATCACACGCTTGTCAATACCTCCAAGCTT
JMFF015L15+ CATCTCAGCAGCTTCCTTCTCTAACCTCTCAATCACACGCTTGTCAATACCTCCAAGCTT
JMFF028B23+ AATCACACGCTTGTCAATACCTCCAAGCTT
JMFF004I09+ CATCTCAGCAGCTTCCTTCTCGAACCTCTCAATCACACGCTTGTCAATACCTCCAAGCTT
JMFF026G11+ CATCTCAGCAGCTTCCTTCTCGAACCTCTCAATCACACGCTTGTCAATACCTCCAAGCTT
                      ____________________________________________________________
consensus CATCTCAGCAGCTTCCTTCTCGAACCTCTCAATCACACGCTTGTCAATACCTCCAAGCTT
 
. : . : . : . : . : . :
JMFF041P19+ GTAGATCAAGTGTCCAGTAGTGGTCGACTTACCAGAGTCGACATGGCCAATGACCCCAAT
JMFN030M08+ GTAGATCAAGTGTCCAGTAGTGGTCGACTTACCAGAGTCGACATGGCCAATGACCACAAT
JMSF046N23+ GTAGATCAAGTGTCCAGTAGTGGTCGACTTACCAGAGTCGACATGGCCAATGACCACAAT
JMFN011O06+ GTAGATCAAGTGTCCAGTAGTGGTCGACTTACCAGAGTCGACATGGCCAATGACCACAAT
JMFF017D06+ GTAGATCAAGTGTCCAGTAGTGGTCGACTTACCAGAGTCGACATGGCCAATGACCACAAT
JMFF038I23+ GTAGATCAAGTGTCCAGTAGTGGTCGACTTACCAGAGTCGACATGGCCAATGACCACAAT
JMFF045A12+ GTAGATCAAGTGTCCAGTAGTGGTCGACTTACCAGAGTCGACATGGCCAATGACCACAAT
JMFF008I12+ GTAGATCAAGTGTCCAGTAGTGGTCGACTTACCAGAGTCGACATGGCCAATGACCACAAT
JMFF046A05+ GTAGATCAAGTGTCCAGTAGTGGTCGACTTACCAGAGTCGACATGGCCAATGACCACAAT
JMFF019I10+ GTAGATCAAGTGTCCAGTAGTGGTCGACTTACCAGAGTCGACATGGCCAATGACCACAAT
JMFF007I05+ GTAGATCAAGTGTCCAGTAGTGGTCGACTTACCAGAGTCGACATGGCCAATGACCACAAT
JMFF044O13+ GTAGATCAAGTGTCCAGTAGTGGTCGACTTACCAGAGTCGACATGGCCAATGACCACAAT
JMFF037A04+ GTAGATCAAGTGTCCAGTAGTGGTCGACTTACCAGAGTCGACATGGCCAATGACCACAAT
JMFF033C01+ GTAGATCAAGTGTCCAGTAGTGGTCGACTTACCAGAGTCGACATGGCCAATGACCACAAT
JMFF019B09+ GTAGATCAAGTGTCCAGTAGTGGTCGACTTACCAGAGTCGACATGGCCAATGACCACAAT
JMFF014G02+ GTAGATCAAGTGTCCAGTAGTGGTCGACTTACCAGAGTCGACATGGCCAATGACCACAAT
JMFF037N23+ GTAGATCAAGTGTCCAGTAGTGGTCGACTTACCAGAGTCGACATGGCCAATGACCACAAT
JMFF018B02+ GTAGATCAAGTGTCCAGTAGTGGTCGACTTACCAGAGTCGACATGGCCAATGACCACAAT
JMFF016E05+ GTAGATCAAGTGTCCAGTAGTGGTCGACTTACCAGAGTCGACATGGCCAATGACCACAAT
JMFF031G20+ GTAGATCAAGTGTCCAGTAGTGGTCGACTTACCAGAGTCGACATGGCCAATGACCACAAT
JMFF017B20+ GTAGATCAAGTGTCCAGTAGTGGTCGACTTACCAGAGTCGACATGGCCAATGACCACAAT
JMFF011P18+ GTAGATCAAGTGTCCAGTAGTGGTCGACTTACCAGAGTCGACATGGCCAATGACCACAAT
JMFF015B06+ GTAGATCAAGTGTCCAGTAGTGGTCGACTTACCAGAGTCGACATGGCCAATGACCACAAT
JMFF030K23+ GTAGATCAAGTGTCCAGTAGTGGTCGACTTACCAGAGTCGACATGGCCAATGACCACAAT
JMFF025E17+ GTAGATCAAGTGTCCAGTAGTGGTCGACTTACCAGAGTCGACATGGCCAATGACCACAAT
JMFF018I02+ GTAGATCAAGTGTCCAGTAGTGGTCGACTTACCAGAGTCGACATGGCCAATGACCACAAT
JMFF016M22+ GTAGATCAAGTGTCCAGTAGTGGTCGACTTACCAGAGTCGACATGGCCAATGACCACAAT
JMFF028K22+ GTAGATCAAGTGTCCAGTAGTGGTCGACTTACCAGAGTCGACATGGCCAATGACCACAAT
JMFF017H01+ GTAGATCAAGTGTCCAGTAGTGGTCGACTTACCAGAGTCGACATGGCCAATGACCACAAT
JMFF035N04+ GTAGATCAAGTGTCCAGTAGTGGTCGACTTACCAGAGTCGACATGGCCAATGACCACAAT
JMFF014C04+ GTAGATCAAGTGTCCAGTAGTGGTCGACTTACCAGAGTCGACATGGCCAATGACCACAAT
JMFF035M15+ GTAGATCAAGTGTCCAGTAGTGGTCGACTTACCAGAGTCGACATGGCCAATGACCACAAT
JMFF026G12+ GTAGATCAAGTGTCCAGTAGTGGTCGACTTACCAGAGTCGACATGGCCAATGACCACAAT
JMFF036P09+ GTAGATCAAGTGTCCAGTAGTGGTCGACTTACCAGAGTCGACATGGCCAATGACCACAAT
JMFF022C20+ GTAGATCAAGTGTCCAGTAGTGGTCGACTTACCAGAGTCGACATGGCCAATGACCACAAT
JMSF012F18+ GTAGATCAAGTGTCCAGTAGTGGTCGACTTACCAGAGTCGACATGGCCAATGACCACAAT
JMFF005E02+ GTAGATCAAGTGTCCAGTAGTGGTCGACTTACCAGAGTCGACATGGCCAATGACCACAAT
JMFF024F06+ GTAGATCAAGTGTCCAGTAGTGGTCGACTTACCAGAGTCGACATGGCCAATGACCACAAT
JMFF004E05+ GTAGATCAAGTGTCCAGTAGTGGTCGACTTACCAGAGTCGACATGGCCAATGACCACAAT
JMFF046P14+ GTAGATCAAGTGTCCAGTAGTGGTCGACTTACCAGAGTCGACATGGCCAATGACCACAAT
JMFF015L15+ GTAGATCAAGTGTCCAGTAGTGGTCGACTTACCAGAGTCGACATGGCCAATGACCACAAT
JMFF028B23+ GTAGATCAAGTGTCCAGTAGTGGTCGACTTACCAGAGTCGACATGGCCAATGACCACAAT
JMFF004I09+ GTAGATCAAGTGTCCAGTAGTGGTCGACTTACCAGAGTCGACATGGCCAATGACCACAAT
JMFF026G11+ GTAGATCAAGTGTCCAGTAGTGGTCGACTTACCAGAGTCGACATGGCCAATGACCACAAT
                      ____________________________________________________________
consensus GTAGATCAAGTGTCCAGTAGTGGTCGACTTACCAGAGTCGACATGGCCAATGACCACAAT
 
. : . : . : . : . : . :
JMFF041P19+ ACTGATGTGAACCTTCTCGTTACCCATTGTCAACTTTTAATAAAAACTTTCCTCGCTCGA
JMFN030M08+ ACTGATGTGAACCTTCTCCTTACCCATTCTCAACTTTTAATAAAAACTTTCCTCGCTCGA
JMSF046N23+ ACTGATGTGAACCTTCTCCTTACCCATTCTCAACTTTTAATAAAAACTTTCCTCGCTCGA
JMFN011O06+ ACTGATGTGAACCTTCTCCTTACCCATTCTCAACTTTTAATAAAAACTTTCCTCGCTCGA
JMFF017D06+ ACTGATGTGAACCTTCTCCTTACCCATTCTCAACTTTTAATAAAAACTTTCCTCGCTCGA
JMFF038I23+ ACTGATGTGAACCTTCTCCTTACCCATTCTCAACTTTTAATAAAAACTTTCCTCGCTCGA
JMFF045A12+ ACTGATGTGAACCTTCTCCTTACCCATTCT
JMFF008I12+ ACTGATGTGAACCTTCTCCTTACCCATTCTCAACTTTTAATAAAAACTTTCCTCGCTCGA
JMFF046A05+ ACTGATGTGAACCTTCTCCTTACCCATTCTCAACTTTTAATAAAAACTTTCCTCGCTCGA
JMFF019I10+ ACTGATGTGAACCTTCTCCTTACCCATTCTCAACTTTTAATAAAAACTTTCCTCGCTCGA
JMFF007I05+ ACTGATGTGAACCTTCTCCTTACCCATTCTCAACTTTTAATAAAAACTTTCCTCGCTCGA
JMFF044O13+ ACTGATGTGAACCTTCTCCTTACCCATTCTCAACTTTTAATAAAAACTTTCCTCGCTCGA
JMFF037A04+ ACTGATGTGAACCTTCTCCTTACCCATTCTCAACTTTTAATAAAAACTTTCCTCGCTCGA
JMFF033C01+ ACTGATGTGAACCTTCTCCTTACCCATTCTCAACTTTTAATAAAAACTTTCCTCGCTCGA
JMFF019B09+ ACTGATGTGAACCTTCTCCTTACCCATTCTCAACTTTTAATAAAAACTTTCCTCGCTCGA
JMFF014G02+ ACTGATGTGAACCTTCTCCTTACCCATTCTCAACTTTTAATAAAAACTTTCCTCGCTCGA
JMFF037N23+ ACTGATGTGAACCTTCTCCTTACCCATTCTCAACTTTTAATAAAAACTTTCCTCGCTCGA
JMFF018B02+ ACTGATGTGAACCTTCTCCTTACCCATTCTCAACTTTTAATAAAAACTTTCCTCGCTCGA
JMFF016E05+ ACTGATGTGAACCTTCTCCTTACCCATTCTCAACTTTTAATAAAAACTTTCCTCGCTCGA
JMFF031G20+ ACTGATGTGAACCTTCTCCTTACCCATTCTCAACTTTTAATAAAAACTTTCCTCGCTCGA
JMFF017B20+ ACTGATGTGAACCTTCTCCTTACCCATTCTCAACTTTTAATAAAAACTTTCCTCGCTCGA
JMFF011P18+ ACTGATGTGAACCTTCTCCTTACCCATTCTCAACTTTTAATAAAAACTTTCCTCGCTCGA
JMFF015B06+ ACTGATGTGAACCTTCTCCTTACCCATTCTCAACTTTTAATAAAAACTCTCCTCGCTCGA
JMFF030K23+ ACTGATGTGAACCTTCTCCTTACCCATTCTCAACTTTTAATAAAAACTTTCCTCGCTCGA
JMFF025E17+ ACTGATGTGAACCTTCTCCTTACCCATTCTCAACTTTTAATAAAAACTTTCCTCGCTCGA
JMFF018I02+ ACTGATGTGAACCTTCTCCTTACCCATTCTCAACTTTTAATAAAAACTTTCCTCGCTCGA
JMFF016M22+ ACTGATGTGAACCTTCTCCTTACCCATTCTCAACTTTTAATAAAAACTTTCCTCGCTCGA
JMFF028K22+ ACTGATGTGAACCTTCTCCTTACCCATTCTCAACTTTTAATAAAAACTTTCCTCGCTCGA
JMFF017H01+ ACTGATGTGAACCTTCTCCTTACCCATTCTCAACTTTTAATAAAAACTTTCCTCGCTCGA
JMFF035N04+ ACTGATGTGAACCTTCTCCTTACCCATTCTCAACTTTTAATAAAAACTTTCCTCGCTCGA
JMFF014C04+ ACTGATGTGAACCTTCTCCTTACCCATTCTCAACTTTTAATAAAAACTTTCCTCGCTCGA
JMFF035M15+ ACTGATGTGAACCTTCTCCTTACCCATTCTCAACTTTTAATAAAAACTTTCCTCGCTCGA
JMFF026G12+ ACTGATGTGAACCTTCTCCTTACCCATTCTCAACTTTTAATAAAAACTTTCCTCGCTCGA
JMFF036P09+ ACTGATGTGAACCTTCTCCTTACCCATTCTCAACTTTTAATAAAAACTTTCCTCGCTCGA
JMFF022C20+ ACTGATGTGAACCTTCTCCTTACCCATTCTCAACTTTTAATAAAAACTTTCCTCGCTCGA
JMSF012F18+ ACTGATGTGAACCTTCTCCTTACCCATTCTCAACTTTTAATAAAAATTTTCCTCGCTCGA
JMFF005E02+ ACTGATGTGAACCTTCTCCTTACCCATTCTCAACTTTTAATAAAAACTTTCCTCGCTCGA
JMFF024F06+ ACTGATGTGAACCTTCTCCTTACCCATTCTCAACTTTTAATAAAAACTTTCCTCGCTCGA
JMFF004E05+ ACTGATGTGAACCTTCTCCTTACCCATTCT
JMFF046P14+ ACTGATGTGAACCTTCTCCTTACCCATTCTCAACTTTTAATAAAAACTTTCCTCGCTCGA
JMFF015L15+ ACTGATGTGAACCTTCTCCTTACCCATTCT
JMFF028B23+ ACTGATGTGAACCTTCTCCTTACCCATTCT
JMFF004I09+ ACTGATGTGAACCTTCTCCTTACCCATTCTCAACTTTTAATAAAAACTTTCCTCGCTCGA
JMFF026G11+ ACTGATGTGAACCTTCTCCTTACCCATTCTCAACTTTTAATAAAAACTTTCCTCGCTCGA
                      ____________________________________________________________
consensus ACTGATGTGAACCTTCTCCTTACCCATTCTCAACTTTTAATAAAAACTTTCCTCGCTCGA
 
. : . : . : . : . : . :
JMFF041P19+ CGGCTGCGGCAGAGGGAAGACAGGATGAGCGTTTGCAGGAGCGAGGAGC
JMFN030M08+ CGGCTGCGGCAGAGGGAAGACAG
JMSF046N23+ CGGCTGCGGCAGAGGGAAGACAGGATGAGCGTTTGCAGGAGCGAGGAGCGGAGC
JMFN011O06+ CGGCTGCGGCAGAGGGAAGACAGGATGAGCGTTTGCAGGAGCGA
JMFF017D06+ CGGCTGCGGCAGAGGGAAGACAGGATGAGCGTTTGCAGGAGCGAGGAGCGGAGC
JMFF038I23+ CGGCTGCGGCAGAGGGAAGACAGGATGAGCGTTTGCAGGAGCGAGGAGCGGAGC
JMFF008I12+ CGGCTGCGGCAGAGGGAAGACAGGATGAGCGTTTGCAGGAGCGAGGAGCGGAGC
JMFF046A05+ CGGCTGCGGCAGAGGGAAGACAGGATGAGCGTTTGCAGGAGCGAGGAGCGGAGC
JMFF019I10+ CGGCTGCGGCAGAGGGAAGACAGGATGAGCGTTTGCAGGAGCGAGGAGCGGAGC
JMFF007I05+ CGGCTGCGGCAGAGGGAAGACAGGATGAGCGTTTGCAGGAGCGAGGAGCGGAG
JMFF044O13+ CGGCTGCGGCAGAGGGAAGACAGGATGAGCGTTTGCAGGAGCGAGGAGCGGAGCA
JMFF037A04+ CGGCTGCGGCAGAGGGAAGACAGGATGAGCGTTTGCAGGAGCGAGGAGCGGAGCAAGAG
JMFF033C01+ CGGCTGCGGCAGAGGGAAGACAGGATGAGCGTTTGCAGGAGCGAGGAGCGGAGCAAGAG
JMFF019B09+ CGGCTGCGGCAGAGGGAAGACAGGATGAGCGTTTGCAGGAGCGAGGAGCGGAGCAAGAG
JMFF014G02+ CGGCTGCGGCAGAGGGAAGACAGGATGAGCGTTTGCAGGAGCGAGGAGCGGAGC
JMFF037N23+ CGGCTGCGGCAGAGGGAAGACAGGATGAGCGTTTGCAGGAGCGAGGAGCGGAGCAAGAG
JMFF018B02+ CGGCTGCGGCAGAGGGAAGACAGGATGAGCGTTTGCAGGAGCGAGGAGCGGAGCAAGAG
JMFF016E05+ CGGCTGCGGCAGAGGGAAGACAGGATGAGCGTTTGCAGGAGCGAGGAGCGGAGCAAGAG
JMFF031G20+ CGGCTGCGGCAGAGGGAAGACAGGATGAGCGTTTGCAGGAGCGAGGAGCGGAG
JMFF017B20+ CGGCTGCGGCAGAGGGAAGACAGGATGAGCGTTTGCAGGAGCGAGGAGCGGAG
JMFF011P18+ CGGCTGCGGCAGAGGGAAGACAGGATGAGCGTTTGCAGGAGCGAGGAGCGGAGCAAGAG
JMFF015B06+ CGGCTGCGGCAGAGGGAAGACAGGATGAGCGTTTGCAGGAGCGAGGAGCGGAGCAAGAG
JMFF030K23+ CGGCTGCGGCAGAGGGAAGACAGGATGAGCGTTTGCAGGAGCGAGGAGCGGAGC
JMFF025E17+ CGGCTGCGGCAGAGGGAAGACAGGATGAGCGTTTGCAGGAGCGAGGAGCGGAGCAA
JMFF018I02+ CGGCTGCGGCAGAGGGAAGACAGGATGAGCGTTTGCAGGAGCGAGGAGCGGAGCAAGAG
JMFF016M22+ CGGCTGCGGCAGAGGGAAGACAGGATGAGCGTTTGCAGGAGCGAGGAGCGGAGCAAGAG
JMFF028K22+ CGGCTGCGGCAGAGGGAAGACAGGATGAGCGTTTGCAGGAGCGAGGAGCGGAG
JMFF017H01+ CGGCTGCGGCAGAGGGAAGACAGGATGAGCGTTTGCAGGAGCGAGGAGCGGAGC
JMFF035N04+ CGGCTGCGGCAGAGGGAAGACAGGATGAGCGTTTGCAGGAGCGAGGAGCGGAGC
JMFF014C04+ CGGCTGCGGCAGAGGGAAGACAGGATGAGCGTTTGCAGGAGCGAGGAGCGGAGC
JMFF035M15+ CGGCTGCGGCAGAGGGAAGACAGGATGAGCGTTTGCAGGAGCGAGGAGCGGAGCA
JMFF026G12+ CGGCTGCGGCAGAGGGAAGACAGGATGAGCGTTTGCAGGAGCGAGGAGCGGAGCAAGA
JMFF036P09+ CGGCTGCGGCAGAGGGAAGACAGGATGAGCGTTTGCAGGAGCGAGGAGCG
JMFF022C20+ CGGCTGCGGCAGAGGGAAGACAGGATGAGCGTTTGCAGGAGCGAGGAGCGGAGCAAGAG
JMSF012F18+ CGGCTGCGGCAGAGGGAAGACAGGATGAGCGTTTGCAGGAGCGAGGAGCGGAGC
JMFF005E02+ CGGCTGCGGCAGAGGGAAGACAGGATGAGCGTTTGCAGGAGCGAGGAGCGGAGCAAGAG
JMFF024F06+ CGGCTGCGGCAGAGGGAAGACAGGATGAGCGTTTGCAGGAGCGAGGAGCGGAGCAAGAG
JMFF046P14+ CGGCTGCGGCAGAGGGAAGACAGGATGAGCGTTTGCAGGAGTGAGGAGCGGAGCAA
JMFF004I09+ CGGCTGCGGCAGAGGGAAGACAGGATGAGCGTTTGCAGGAGCGAGGAGCGGAGCAAGAG
JMFF026G11+ CGGCTGCGGCAGAGGGAAGACAGGATGAGCGTTTGCAGGAGCGAGGAGCGGAGCAAGAGC
                      ____________________________________________________________
consensus CGGCTGCGGCAGAGGGAAGACAGGATGAGCGTTTGCAGGAGCGAGGAGCGGAGCAAGAGC