Previous Contig 001243:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF009M07Sequence555001243 (5)gb:AB008268_15104613e-06Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MSJ1.
JMFF026F22Sequence589001243 (5)769010288 (4)gb:AP004462_18413819e-11Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P045
JMFF027M23Sequence609001243 (5)gb:AB008268_15104612e-11Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MSJ1.731010288 (4)gb:AB110444_15269481e-08Oryza sativa (japonica cultivar-group) rf-1gene for fertility restorer, hypothet
JMFF037M20Sequence570001243 (5)gb:AB008268_15104615e-09Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MSJ1.791010288 (4)gb:AP004462_18413813e-11Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P045
JMFF043D18Sequence607001243 (5)gb:AB008268_15104612e-11Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MSJ1.640010288 (4)

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF043D18+ CCCCACATAGCACATCCCCTTCAGCAAGCAATTG
JMFF037M20+ GCAAGCAATTG
JMFF027M23+ CTCCCCACATAGCACATCCCCTTCAGCAAGCAATTG
                      ____________________________________________________________
consensus CTCCCCACATAGCACATCCCCTTCAGCAAGCAATTG
 
. : . : . : . : . : . :
JMFF043D18+ TACGTGTTGATTGTGGG-CTCGCAACCAGCTCGGCCCATGCTTTCGAAAACCTCAAATGC
JMFF037M20+ TACGTGTTGATTGTGGG-CTCGCAACCAGCTCGGCCCATGCTTTCGAAAACCTCAAATGC
JMFF009M07+ GTTGATTGTGGGNCTCGCAACCAGCTCGGCCCATGCTTTCGAAAACCTCAAATGC
JMFF027M23+ TACGTGTTGATTGTGGG-CTCGCAACCAGCTCGGCCCATGCTTTCGAAAACCTCAAATGC
                      ____________________________________________________________
consensus TACGTGTTGATTGTGGG-CTCGCAACCAGCTCGGCCCATGCTTTCGAAAACCTCAAATGC
 
. : . : . : . : . : . :
JMFF043D18+ CTGTTTCAACCGTCCTTTTTTGCAGAACGAGTTGATCACTGTGGTGAACATCGCTACATT
JMFF037M20+ CTGTTTCAACCGTCCTTTTTTGCAGAACGAGTTGATCACTGTGGTGAACATCGCTACATT
JMFF009M07+ CTGTTTCAACCGTCCTTTTTTGCAGAACGAGTTGATCACTGTGGTGAACATCGCTACATT
JMFF027M23+ CTGTTTCAACCGTCCTTTTTTGCAGAACGAGTTGATCACTGTGGTGAACATCGCTACATT
                      ____________________________________________________________
consensus CTGTTTCAACCGTCCTTTTTTGCAGAACGAGTTGATCACTGTGGTGAACATCGCTACATT
 
. : . : . : . : . : . :
JMFF043D18+ GGGTTGAACCCCATTGTCTAACATGCGGTTTAGAACAGTTCTCGCTGTTTCAGGGTCATT
JMFF037M20+ GGGTTGAACCCCATTGTCTAACATGCGGTTTAGAACAGTTCTCGCTGTTTCAGGGTCATT
JMFF009M07+ GGGTTGAACCCCATTGTCTAACATGCGGTTTAGAACAGTTCTCGCTGTTTCAGGGTCATT
JMFF027M23+ GGGTTGAACCCCATTGTCTAACATGCGGTTTAGAACAGTTCTCGCTGTTTCAGGGTCATT
                      ____________________________________________________________
consensus GGGTTGAACCCCATTGTCTAACATGCGGTTTAGAACAGTTCTCGCTGTTTCAGGGTCATT
 
. : . : . : . : . : . :
JMFF043D18+ TTTCTCGCAATTTTCACTCACCCAGATTGCGTGTGCGGAGCTATTTTCCTCGGATAGTTC
JMFF037M20+ TTTCTCGCAATTTTCACTCACCCAGATTGCGTGTGCGGAGCTATTTTCCTCGGATAGTTC
JMFF009M07+ TTTCTCGCAATTTTCACTCACCCAGATTGCGTGTGCGGAGCTATTTTCCTCGGATAGTTC
JMFF027M23+ TTTCTCGCAATTTTCACTCACCCAGATTGCGTGTGCGGAGCTATTTTCCTCGGATAGTTC
JMFF026F22+ TTTCACTCACCCAGATTGCGTGTGCGGAGCTATTTTCCTCGGATAGTTC
                      ____________________________________________________________
consensus TTTCTCGCAATTTTCACTCACCCAGATTGCGTGTGCGGAGCTATTTTCCTCGGATAGTTC
 
. : . : . : . : . : . :
JMFF043D18+ AATTTCGCTTTGATTAGTTGAAACAAATGCATGTTTTGTGCTTAATTTATCTGGATTTTC
JMFF037M20+ AATTTCGCTTTGATTAGTTGAAACAAATGCATGTTTTGTGCTTAATTTATCTGGATTTTC
JMFF009M07+ AATTTCGCTTTGATTAGTTGAAACAAATGCATGTTTTGTGCTTAATTTATCTGGATTTTC
JMFF027M23+ AATTTCGCTTTGATTAGTTGAAACAAATGCATGTTTTGTGCTTAATTTATCTGGATTTTC
JMFF026F22+ AATTTCGCTTTGATTAGTTGAAACAAATGCATGTTTTGTGCTTAATTTATCTGGATTTTC
                      ____________________________________________________________
consensus AATTTCGCTTTGATTAGTTGAAACAAATGCATGTTTTGTGCTTAATTTATCTGGATTTTC
 
. : . : . : . : . : . :
JMFF043D18+ AGCAAGACTAGACTTTTCTTGTGCTATATTTCGGGCTAATGGATGAAAATTGCCGGGGTT
JMFF037M20+ AGCAAGACTAGACTTTTCTTGTGCTATATTTCGGGCTAATGGATGAAAATTGCCGGGGTT
JMFF009M07+ AGCAAGACTAGACTTTTCTTGTGCTATATTTCGGGCTAATGGATGAAAATTGCCGGGGTT
JMFF027M23+ AGCAAGACTAGACTTTTCTTGTGCTATATTTCGGGCTAATGGATGAAAATTGCCGGGGTT
JMFF026F22+ AGCAAGACTAGACTTTTCTTGTGCTATATTTCGGGCTAATGGATGAAAATTGCCGGGGTT
                      ____________________________________________________________
consensus AGCAAGACTAGACTTTTCTTGTGCTATATTTCGGGCTAATGGATGAAAATTGCCGGGGTT
 
. : . : . : . : . : . :
JMFF043D18+ CTTGATAAAGGAGGTGGGGGTTTTAGGAAAAGGAGGAAGTAGGATAGAAGAGGCAGAAGA
JMFF037M20+ CTTGATAAAGGAGGTGGGGGTTTTAGGAAAAGGAGGAAGTAGGATAGAAGAGGCAGAAGA
JMFF009M07+ CTTGATAAAGGAGGTGGGGGTTTTAGGAAAAGGAGGAAGTAGGATAGAAGAGGCAGAAGA
JMFF027M23+ CTTGATAAAGGAGGTGGGGGTTTTAGGAAAAGGAGGAAGTAGGATAGAAGAGGCAGAAGA
JMFF026F22+ CTTGATAAAGGAGGTGGGGGTTTTAGGAAAAGGAGGAAGTAGGATAGAAGAGGCAGAAGA
                      ____________________________________________________________
consensus CTTGATAAAGGAGGTGGGGGTTTTAGGAAAAGGAGGAAGTAGGATAGAAGAGGCAGAAGA
 
. : . : . : . : . : . :
JMFF043D18+ GAGAGAAGGTGGAGGGTGGAGTGAAAAATGCATGGCAGAATCGCAGAGATGATGAAATCT
JMFF037M20+ GAGAGAAGGTGGAGGGTGGAGTGAAAAATGCATGGCAGAATCGCAGAGATGATGAAATCT
JMFF009M07+ GAGAGAAGGTGGAGGGTGGAGTGAAAAATGCATGGCAGAATCACAGAGATGATGAAATCT
JMFF027M23+ GAGAGAAGGTGGAGGGTGGAGTGAAAAATGCATGGCAGAATCGCAGAGATGATGAAATCT
JMFF026F22+ GAGAGAAGGTGGAGGGTGGAGTGAAAAATGCATGGCAGAATCGCAGAGATGATGAAATCT
                      ____________________________________________________________
consensus GAGAGAAGGTGGAGGGTGGAGTGAAAAATGCATGGCAGAATCGCAGAGATGATGAAATCT
 
. : . : . : . : . : . :
JMFF043D18+ GTAGTCCTGGGAAGGGAAGAAGAAAAGGTCGAAGCCAATTTGGGAGTTTCACCATCTGGG
JMFF037M20+ GTAGTCCTGGGAAGGGAAGAAGAAAAGGTCGAAGCCAATTTGGGAGTTTCACCATCTGGG
JMFF009M07+ GTAGTCCTGGGAAGGGAAGAAGAAAAGGTCGAAGCCAATTTGGGAGTTTCACCATCTGGG
JMFF027M23+ GTAGTCCTGGGAAGGGAAGAAGAAAAGGTCGAAGCCAATTTGGGAGTTTCACCATCTGGG
JMFF026F22+ GTAGTCCTGGGAAGGGAAGAAGAAAAGGTCGAAGCCAATTTGGGAGTTTCACCATCTGGG
                      ____________________________________________________________
consensus GTAGTCCTGGGAAGGGAAGAAGAAAAGGTCGAAGCCAATTTGGGAGTTTCACCATCTGGG
 
. : . : . : . : . : . :
JMFF043D18+ TTAGAGAATTTGTTGTCTGTAGTTCTGCCTCAAT
JMFF037M20+ TTAGAGAATTTGTTGTCTGT
JMFF009M07+ TTAGAGAATTTGTTGTCTGT
JMFF027M23+ TTAGAGAATTTGTTGTCTGTAGTTCTGCCCCAAT
JMFF026F22+ TTAGAGAATTTGTTGTCTGTAGTTCTGCCCCAATATCTTTTCGTATTGCGCTTCAAAACC
                      ____________________________________________________________
consensus TTAGAGAATTTGTTGTCTGTAGTTCTGCCCCAATATCTTTTCGTATTGCGCTTCAAAACC
 
. : . : . : . : . : . :
JMFF026F22+ CAATTCATTAATTTGTTGTAATTTGTCTTGGGATTAGGATAAGGGCTGTGCAGAATCCGA
                      ____________________________________________________________
consensus CAATTCATTAATTTGTTGTAATTTGTCTTGGGATTAGGATAAGGGCTGTGCAGAATCCGA
 
. : . : . : . : . : . :
JMFF026F22+ GAAATCCGATGGACTCCAAACTCGGGAAAATTTTTGCATTCTTGAGGCCGAATCGGATAT
                      ____________________________________________________________
consensus GAAATCCGATGGACTCCAAACTCGGGAAAATTTTTGCATTCTTGAGGCCGAATCGGATAT
 
. : . : . : . : . : . :
JMFF026F22+ GAGTAATCCGACATGTTTTTTTTGAATGTAGTAATCCGACATGTTATTCTTTTAAAAGTC
                      ____________________________________________________________
consensus GAGTAATCCGACATGTTTTTTTTGAATGTAGTAATCCGACATGTTATTCTTTTAAAAGTC