Previous Contig 001241:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF004E17Sequence423001241 (11)gb:AB119653_15279348e-36Lilium longiflorum LP-ExoII mRNA for exo-1,3-beta-glucanase, complete cds.700008765 (10)gb:AY335818_16002219e-81Gossypium hirsutum beta-D-glucosidase mRNA, complete cds.
JMFF012E06Sequence542001241 (11)gb:AY357946_16019265e-56Lilium longiflorum exo-beta-glucanase (ExoI) mRNA, complete cds.751008765 (10)gb:AY335818_16002212e-63Gossypium hirsutum beta-D-glucosidase mRNA, complete cds.
JMFF026F10Sequence609001241 (11)gb:AB119653_15279341e-42Lilium longiflorum LP-ExoII mRNA for exo-1,3-beta-glucanase, complete cds.751008765 (10)gb:AY335818_16002215e-60Gossypium hirsutum beta-D-glucosidase mRNA, complete cds.
JMFF036H24Sequence585001241 (11)gb:AY357946_16019269e-59Lilium longiflorum exo-beta-glucanase (ExoI) mRNA, complete cds.709008765 (10)gb:AY335818_16002219e-84Gossypium hirsutum beta-D-glucosidase mRNA, complete cds.
JMFF038C17Sequence505001241 (11)gb:AB119653_15279341e-50Lilium longiflorum LP-ExoII mRNA for exo-1,3-beta-glucanase, complete cds.721008765 (10)gb:AY335818_16002214e-60Gossypium hirsutum beta-D-glucosidase mRNA, complete cds.
JMFF048N07Sequence284001241 (11)gb:AY091027_15742572e-08Arabidopsis thaliana putative beta-D-glucan exohydrolase (At5g20950) mRNA, compl219001241 (11)gb:AY357946_16019265e-19Lilium longiflorum exo-beta-glucanase (ExoI) mRNA, complete cds.
JMFF051P03Sequence589001241 (11)gb:AY357946_16019267e-56Lilium longiflorum exo-beta-glucanase (ExoI) mRNA, complete cds.512008765 (10)gb:AC091811_17351253e-48Oryza sativa chromosome 3 BAC OSJNBa0069E14 genomic sequence, complete sequence.
JMSF013I14Sequence554001241 (11)gb:AY357946_16019264e-58Lilium longiflorum exo-beta-glucanase (ExoI) mRNA, complete cds.714008765 (10)gb:AY335818_16002216e-81Gossypium hirsutum beta-D-glucosidase mRNA, complete cds.
JMSF024I05Sequence674001241 (11)gb:AB119653_15279344e-81Lilium longiflorum LP-ExoII mRNA for exo-1,3-beta-glucanase, complete cds.749008765 (10)gb:AC091811_17351251e-62Oryza sativa chromosome 3 BAC OSJNBa0069E14 genomic sequence, complete sequence.
JMSF036P02Sequence654001241 (11)gb:AB119653_15279347e-78Lilium longiflorum LP-ExoII mRNA for exo-1,3-beta-glucanase, complete cds.699008765 (10)gb:AY335818_16002211e-89Gossypium hirsutum beta-D-glucosidase mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF024I05+ GTAATCCCGGGATGATTTCAGTCATAGCCCTCACAATCTCGGG
                      ____________________________________________________________
consensus GTAATCCCGGGATGATTTCAGTCATAGCCCTCACAATCTCGGG
 
. : . : . : . : . : . :
JMSF036P02+ TACCGCAATGCA
JMFF036H24+ GCAATGCA
JMFF051P03+ TACCGCAATGCA
rJMFF048N07- TACCGCAATGCA
JMSF024I05+ ATCTTCGCTGTAACTCTCATAGCACCGGCCCCATCTAGGATCTCTACATACCGCAATGCA
                      ____________________________________________________________
consensus ATCTTCGCTGTAACTCTCATAGCACCGGCCCCATCTAGGATCTCTACATACCGCAATGCA
 
. : . : . : . : . : . :
JMSF036P02+ GGGTGAAAATACGTATTGAATCCCAGTAGCCCTGACTTCAAGAGCAGTTGCAGCGCCAAT
JMFF036H24+ GGGTGAAAATACGTATTGAATCCCAGTAGCCCTGACTTCAAGAGCAGTTGCAGCGCCAAT
JMFF051P03+ GGGTGAAAATACGTA-TGAATCCCAGTAGCCCTGACTTCAAGAGCAGTTGCAGCGCCAAT
rJMFF048N07- GGGTGAAAATACGTATTGAATCCCAGTAGCCCTGACTTCAAGAGCAGTTGCAGCGCCAAT
JMSF024I05+ GGGTGAAAATACGTATTGAATCCCAGTAGCCCTGACTTCAAGAGCAGTTGCAGCGCCAAT
JMFF012E06+ ACTTCAAGAGCAGTTGCAGCGCCAAT
JMSF013I14+ CAGTAGCCCTGACTTCAAGAGCAGTTGCAGCGCCAAT
                      ____________________________________________________________
consensus GGGTGAAAATACGTATTGAATCCCAGTAGCCCTGACTTCAAGAGCAGTTGCAGCGCCAAT
 
. : . : . : . : . : . :
JMSF036P02+ CCTCCTAACCAGTTGAGGAT-CCCTGGTTGCTCCAAGACCAACATTATGGGGGAAAATAG
JMFF036H24+ CCTCCTAACCAGTTGAGGATCCCCTGGTTGCTCCAAGACCAACATTATGGGGGAAAATAG
JMFF051P03+ CCTCCTAACCAGTTGAGGAT-CCCTGGTTGCTCCAAGACCAACATTATGGGGGAAAATAG
rJMFF048N07- CCTCCTAACCAGTTGAGGAT-CCCTGGTTGCTCCAAGACCAACATTATGGGGGAAAATAG
JMSF024I05+ CCTCCTAACCAGTTGAGGAT-CCCTGGTTGCTCCAAGACCAACATTATGGGGGAAAATAG
JMFF038C17+ GTTGAGGAT-CCCTGGTTGCTCCAAGACCAACATTATGGGGGAAAATAG
JMFF012E06+ CCTCCTAACCAGTTGAGGAT-CCCTGGTTGCTCCAAGACCAACATTATGGGGGAAAATAG
JMSF013I14+ CCTCCTAACCAGTTGAGGAT-CCCTGGTTGCTCCAAGACCAACATTATGGGGGAAAATAG
JMFF026F10+ GGAAAATAG
                      ____________________________________________________________
consensus CCTCCTAACCAGTTGAGGAT-CCCTGGTTGCTCCAAGACCAACATTATGGGGGAAAATAG
 
. : . : . : . : . : . :
JMSF036P02+ TAGCTTTATAAACATTGTTTTGGCCATGAACTGCATCAATCCCATAAATCATAGGAATCC
JMFF036H24+ TAGCTTTATAAACATTGTTTTGGCCATGAACTGCATCAATCCCATAAATCATAGGAATCC
JMFF051P03+ TAGCTTTATAAACATTGTTTTGGCCATGAACTGCATCAATCCCATAAATCATAGGAATCC
JMFF004E17+ TGCATCAATCCCATAAATCATAGGAATCC
rJMFF048N07- TAGCTTTATAAACATTGTT
JMSF024I05+ TAGCTTTATAAACATTGTTTTGGCCATGAACTGCATCAATCCCATAAATCATAGGAATCC
JMFF038C17+ TAGCTTTATAAACATTGTTTTGGCCATGAACTGCATCAATCCCATAAATCATAGGAATCC
JMFF012E06+ TAGCTTTATAAACATTGTTTTGGCCATGAACTGCATCAATCCCATAAATCATAGGAATCC
JMSF013I14+ TAGCTTTATAAACATTGTTTTGGCCATGAACTGCATCAATCCCATAAATCATAGGAATCC
JMFF026F10+ TAGCTTTATAAACATTGTTTTGGCCATGAACTGCATCAATCCCATAAATCATAGGAATCC
                      ____________________________________________________________
consensus TAGCTTTATAAACATTGTTTTGGCCATGAACTGCATCAATCCCATAAATCATAGGAATCC
 
. : . : . : . : . : . :
JMSF036P02+ CAAGCCGGGTCGCTAACGAGCCCTTCTGGAAATCATTCACCATGTCCACCCAGTCTTGAG
JMFF036H24+ CAAGCCGGGTCGCTAACGAGCCCTTCTGGAAATCATTCACCATGTCCACCCAGTCTTGAG
JMFF051P03+ CAAGCCGGGTCGCTAACGAGCCCTTCTGGAAATCATTCACCATGTCCACCCAGTCTTGAG
JMFF004E17+ CAAGCCGGGTCGCTAACGAGCCCTTCTGGAAATCATTCACCATGTCCACCCAGTCTTGAG
JMSF024I05+ CAAGCCGGGTCGCTAACGAGCCCTTCTGGAAATCATTCACCATGTCCACCCAGTCTTGAG
JMFF038C17+ CAAGCCGGGTCGCTAACGAGCCCTTCTGGAAATCATTCACCATGTCCACCCAGTCTTGAG
JMFF012E06+ CAAGCCGGGTCGCTAACGAGCCCTTCTGGAAATCATTCACCATGTCCACCCAGTCTTGAG
JMSF013I14+ CAAGCCGGGTCGCTAACGAGCCCTTCTGGAAATCATTCACCATGTCCACCCAGTCTTGAG
JMFF026F10+ CAAGCCGGGTCGCTAACGAGCCCTTCTGGAAATCATTCACCATGTCCACCCAGTCTTGAG
                      ____________________________________________________________
consensus CAAGCCGGGTCGCTAACGAGCCCTTCTGGAAATCATTCACCATGTCCACCCAGTCTTGAG
 
. : . : . : . : . : . :
JMSF036P02+ CAGATGCCTTCTCCTTTGGAACACTCCCTCCTCCACTCAACACACTACCTATATAGTATT
JMFF036H24+ CAGATGCCTTCTCCTTTGGAACACTCCCTCCTCCACTCAACACACTACCTATATAGTATT
JMFF048N07+ GTATT
JMFF051P03+ CAGATGCCTTCTCCTTTGGAACACTCCCTCCTCCACTCAACAGACTACCTATATAGTATT
JMFF004E17+ CAGATGCCTTNTCCTTTGGAACACTCCCTCCTCCACTCAACACACTACCTATATAGTATT
JMSF024I05+ CAGATGCCTTCTCCTTTGGAACACTCCCTCCTCCACTCAACACACTACCTATATAGTATT
JMFF038C17+ CAGATGCCTTCTCCTTTGGAACACTCCCTCCTCCACTCAACACACTACCTATATAGTATT
JMFF012E06+ CAGATGCCTTCTCCTTTGGAACACTCCCTCCTCCACTCAACACACTACCTATATAGTATT
JMSF013I14+ CAGATGCCTTCTCCTTTGGAACACTCCCTCCTCCACTCAACACACTACCTATATAGTATT
JMFF026F10+ CAGATGCCTTCTCCTTTGGAACACTCCCTCCTCCACTCAACACACTACCTATATAGTATT
                      ____________________________________________________________
consensus CAGATGCCTTCTCCTTTGGAACACTCCCTCCTCCACTCAACACACTACCTATATAGTATT
 
. : . : . : . : . : . :
JMSF036P02+ TCTTCATGACCTCAAAAGATGAAACTTGGCGTTCAATCTGAACCATTTGCCCAATTTTTT
JMFF036H24+ TCTTCATGACCTCAAAAGATGAAACTTGGCGTTCAATCTGAACCATTTGCCCAATTTTTT
JMFF048N07+ TCTTCATGACCTCAAAAGATGAAACTTGGCGTTCAATCTGAACCATTTGCCCAA-TTTTT
JMFF051P03+ TCTTCATGACCTCAAAAGATGAAACTTGGCGTTCAATCTGAACCATTTGCCCAATTTTTT
JMFF004E17+ TCTTCATGACCTCAAAAGATGAAACTTGGCGTTCAATCTGAACCATTTGCCCAATTTTTT
JMSF024I05+ TCTTCATGACCTCAAAAGATGAAACTTGGCGTTCAATCTGAACCATTTGCCCAATTTTTT
JMFF038C17+ TCTTCATGACCTCAAAAGATGAAACTTGGCGTTCAATCTGAACCATTTGCCCAATTTTTT
JMFF012E06+ TCTTCATGACCTCAAAAGATGAAACTTGGCGTTCAATCTGAACCATTTGCCCAATTTTTT
JMSF013I14+ TCTTCATGACCTCAAAAGATGAAACTTGGCGTTCAATCTGAACCATTTGCCCAATTTTTT
JMFF026F10+ TCTTCATGACCTCAAAAGATGAAACTTGGCGTTCAATCTGAACCATTTGCCCAATTTTTT
                      ____________________________________________________________
consensus TCTTCATGACCTCAAAAGATGAAACTTGGCGTTCAATCTGAACCATTTGCCCAATTTTTT
 
. : . : . : . : . : . :
JMSF036P02+ CCTCCAAGCTCATCCTGCCCATCAGGTCCTTGATCCTTCGACCTATTGGCTTTGTTGGAT
JMFF036H24+ CCTCCAAGCTCATCCTGCCCATCAGGTCCTTGATCCTTCGACCTATTGGCTTTGTTGGAT
JMFF048N07+ CCTCCAAGCTCATCCTGCCCATCAGGTCCTTGATCCTTCGACCTATTGGCTTTGTTGGAT
JMFF051P03+ CCTCCAAGCTCATCCTGCCCATCAGGTCCTTGATCCTTCGACCTATTGGCTTTGTTGGAT
JMFF004E17+ CCTCCAAGCTCATCCTGCCCATCAGGTCCTTGATCCTTCGACCTATTGGCTTTGTTGGAT
JMSF024I05+ CCTCCAAGCTCATCCTGCCCATCAGGTCCTTGATCCTTCGACCTATTGGCTTTGTTGGAT
JMFF038C17+ CCTCCAAGCTCATCCTGCCCATCAGGTCCTTGATCCTTCGACCTATTGGCTTTGTTGGAT
JMFF012E06+ CCTCCAAGCTCATCCTGCCCATCAGGTCCTTGATCCTTCGACCTATTGGCTTTGTTGGAT
JMSF013I14+ CCTCCAAGCTCATCCTGCCCATCAGGTCCTTGATCCTTCGACCTATTGGCTTTGTTGGAT
JMFF026F10+ CCTCCAAGCTCATCCTGCCCATCAGGTCCTTGATCCTTCGACCTATTGGCTTTGTTGGAT
                      ____________________________________________________________
consensus CCTCCAAGCTCATCCTGCCCATCAGGTCCTTGATCCTTCGACCTATTGGCTTTGTTGGAT
 
. : . : . : . : . : . :
JMSF036P02+ CTTTGTAGAGCATGTAATCTGCATTGGCTACAAACACACAACCACATACCACAACAATCC
JMFF036H24+ CTTTGTAGAGCATGTAATCTGCATTGGCTACAAACACACAACCACATACCACAACAATCC
JMFF048N07+ CTTTGTAGAGCATGTAATCTGCATTGGCTACAAACACACAACCACATACCACAACAATCC
JMFF051P03+ CTTTGTAGAGCATGTAATCTGCATTGGCTACAAACACACAACCACATACCACAACAATCC
JMFF004E17+ CTTTGTAGAGCATGTAATCTGCATTGGCTACAAACACACAACCACATACCACAACAATCC
JMSF024I05+ CTTTGTAGAGCATGTAATCTGCATTGGCTACAAACACACAACCACATACCACAACAATCC
JMFF038C17+ CTTTGTAGAGCATGTAATCTGCATTGGCTACAAACACACAACCACATACCACAACAATCC
JMFF012E06+ CTTTGTAGAGCATGTAATCTGCATTGGCTACAAACACACAACCACATACCACAACAATCC
JMSF013I14+ CTTTGTAGAGCATGTAATCTGCATTGGCTACAAACACACAACCACATACCACAACAATCC
JMFF026F10+ CTTTGTAGAGCATGTAATCTGCATTGGCTACAAACACACAACCACATACCACAACAATCC
                      ____________________________________________________________
consensus CTTTGTAGAGCATGTAATCTGCATTGGCTACAAACACACAACCACATACCACAACAATCC
 
. : . : . : . : . : . :
JMSF036P02+ CAATCAAGAATCTCAGCTCTTTCCCCATTTTCCCTCTCCAA------AGAGAAGGTAGCT
JMFF036H24+ CAATCAAGAATCTCAGCTCTTTCCCCATTTTCCCTCTCCAACTGTACAGAGAAGGTAGCT
JMFF048N07+ CAATCAAGAATCTCAGCTCTTTCCCCATTTTCCCTCTCCAACTGTACAGAGAAGGTAGCT
JMFF051P03+ CAATCAAGAATCTCAGCTCTTTCCCCATTTTCCCTCTCCAACTGTACAGAGAAGGTAGCT
JMFF004E17+ CAATCAAGAATCTCAGCTCTTTCCCCATTTTCCCTCTCCAA------AGAGAAGGTAGCT
JMSF024I05+ CAATCAAGAATCTCAGCTCTTTCCCCATTTTCCCTCTCCAA------AGAGAAGGTAGCT
JMFF038C17+ CAATCAAGAATCTCAGCTCTTTCCCCATTTTCCCTCTCCAACTGTACAGAGAAGGTAGCT
JMFF012E06+ CAATCAAGAATCTCAGCTCTTTCCCCATTTTCCCTCTCCAACTGTACAGAGAAGGTAGCT
JMSF013I14+ CAATCAAGAATCTCAGCTCTTTCCCCATTTTCCCTCTCCAACTGTACAGAGAAGGTAGCT
JMFF026F10+ CAATCAAGAATCTCAGCTCTTTCCCCATTTTCCCTCTCCAACTGTACAGAGAAGGTAGCT
                      ____________________________________________________________
consensus CAATCAAGAATCTCAGCTCTTTCCCCATTTTCCCTCTCCAACTGTACAGAGAAGGTAGCT
 
. : . : . : . : . : . :
JMSF036P02+ GGAGTGAGGCTGGGCGGTTTGATCAGCTTCTGTTC
JMFF036H24+ GGAGTGAGGCTGGGCGGTTTGATCAGCTTCAGTTC
JMFF048N07+ GGAGTGAGGCTGGGCGGTTTGATCAGCTTCTGTT
JMFF051P03+ GGAGTGAGGCTGGGCGGTTTGATCAGCTTCTGTTC
JMFF004E17+ GGAGTGAGGCTGGGCGGTTTGATCAGCTTCTGTTCAC
JMSF024I05+ GGAGTGAGGCTGGGCGGTTTGATCAGCTTCTGTTCAC
JMFF038C17+ GGAGTGAGGCTGGGCGGTTTGATCAGCTTCTG
JMFF012E06+ GGAGTGAGGCTGGGCGGTTTGATCAGCTTCTG
JMSF013I14+ GGAGTGAGGCTGGGCGGTTTGATCAGCTTCTGTTCAC
JMFF026F10+ GGAGTGAGGCTGGGCGGTTTGATCAGCTTCTGTTCACGGCTTCACGGATGGAAGAAATCT
                      ____________________________________________________________
consensus GGAGTGAGGCTGGGCGGTTTGATCAGCTTCTGTTCACGGCTTCACGGATGGAAGAAATCT
 
. : . : . : . : . : . :
JMFF026F10+ CAATTTAATGACTTCTAAGAAGACAACATTACAAAGTAGTGGTTGTAAGTTGTAACCAGT
                      ____________________________________________________________
consensus CAATTTAATGACTTCTAAGAAGACAACATTACAAAGTAGTGGTTGTAAGTTGTAACCAGT
 
. : . : . : . : . : . :
JMFF026F10+ GGGTTGTGGACACTAAGGAAATGTCAATTCATTGTATTGTTGCCATATCTTGTTTTGTAC
                      ____________________________________________________________
consensus GGGTTGTGGACACTAAGGAAATGTCAATTCATTGTATTGTTGCCATATCTTGTTTTGTAC