Previous Contig 001237:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF026D09Sequence545001237 (5)560001237 (5)
JMFN020K22Sequence606001237 (5)
JMFN028C05Sequence534001237 (5)
JMFN035K19Sequence638001237 (5)

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF026D09- ATATGTATGAATCCAAAAACAGTGATTAGGCAATGGTTCCCTATAATTCATCACACTCA
                      ____________________________________________________________
consensus ATATGTATGAATCCAAAAACAGTGATTAGGCAATGGTTCCCTATAATTCATCACACTCA
 
. : . : . : . : . : . :
rJMFF026D09- CAAGATGGCATTAAAATTAATCTATGCTTAAAATCAGTGAAGAGCTCAACAATCATTCTC
JMFN028C05+ TATGCTTAAAATCAGTGAAGAGCTCAACAATCATTCTC
JMFN020K22+ TATGCTTAAAATCAGTGAAGAGCTCAACAATCATTCTC
JMFN035K19+ GATGGCATTAAAATTAATCTATGCTTAAAATCAGTGAAGAGCTCAACAATCATTCTC
                      ____________________________________________________________
consensus CAAGATGGCATTAAAATTAATCTATGCTTAAAATCAGTGAAGAGCTCAACAATCATTCTC
 
. : . : . : . : . : . :
rJMFF026D09- CACCGTTAAATTTCGTCAGTGATGAAGCTGCTTCGCCACCAATACTGCCCGGATCTGAAC
JMFN028C05+ CACCGTTAAATTTCGTCAGTGATGAAGCTGCTTCGCCACCAATACTGCCCGGATCTGAAC
JMFN020K22+ CACCGTTAAATTTCGTCAGTGATGAAGCTGCTTCGCCACCAATACTGCCCGGATCTGAAC
JMFN035K19+ CACCGTTAAATTTCGTCAGTGATGAAGCTGCTTCGCCACCAATACTGCCCGGATCTGAAC
JMFF026D09+ TGAAC
                      ____________________________________________________________
consensus CACCGTTAAATTTCGTCAGTGATGAAGCTGCTTCGCCACCAATACTGCCCGGATCTGAAC
 
. : . : . : . : . : . :
rJMFF026D09- CGCAGAACCTAACCACGCAACCATGGCTACGTTTCTCAAGTCGGCCCCCTTGTGATGACC
JMFN028C05+ CGCAGAACCTAACCACGCAACCATGGCTACGTTTCTCAAGTCGGCCCCCTTGTGATGACC
JMFN020K22+ CGCAGAACCTAACCACGCAACCATGGCTACGTTTCTCAAGTCGGCCCCCTTGTGATGACC
JMFN035K19+ CGCAGAACCTAACCACGCAACCATGGCTACGTTTCTCAAGTCGGCCCCCTTGTGATGACC
JMFF026D09+ CGCAGAACCTAACCACGCAACCATGGCTACGTTTCTCAAGTCGGCCCCCTTGTGATGACC
                      ____________________________________________________________
consensus CGCAGAACCTAACCACGCAACCATGGCTACGTTTCTCAAGTCGGCCCCCTTGTGATGACC
 
. : . : . : . : . : . :
rJMFF026D09- GATGATGACCTCAGCCACCGCCGTTGCTCGCCGTCGACGGACTCCACCGCCCAGACGCCA
JMFN028C05+ GATGATGACCTCAGCCACCGCCGTTGCTCGCCGTCGACGGACTCCACCGCCCAGACGCCA
JMFN020K22+ GATGATGACCTCAGCCACCGCCGTTGCTCGCCGTCGACGGACTCCACCGCCCAGACGCCA
JMFN035K19+ GATGATGACCTCAGCCACCGCCGTTGCTCGCCGTCGACGGACTCCACCGCCCAGACGCCA
JMFF026D09+ GATGATGACCTCAGCCACCGCCGTTGCTCGCCGTCGACGGACTCCACCGCCCAGACGCCA
                      ____________________________________________________________
consensus GATGATGACCTCAGCCACCGCCGTTGCTCGCCGTCGACGGACTCCACCGCCCAGACGCCA
 
. : . : . : . : . : . :
rJMFF026D09- GAAAAGCATCAACGAGCTCCACCGCCGTCAGATTTGTTGCGCTGTCGTTGGATCCACTGC
JMFN028C05+ GAAAAGCATCAACGAGCTCCACCGCCGTCAGATTTGTTGCGCTGTCGTTGGATCCACTGC
JMFN020K22+ GAAAAGCATCAACGAGCTCCACCGCCGTCAGATTTGTTGCGCTGTCGTTGGATCCACTGC
JMFN035K19+ GAAAAGCATCAACGAGCTCCACCGCCGTCAGATTTGTTGCGCTGTCGTTGGATCCACTGC
JMFF026D09+ GAAAAGCATCAACGAGCTCCACCGCCGTCAGATTTGTTGCGCTGTCGTTGGATCCACTGC
                      ____________________________________________________________
consensus GAAAAGCATCAACGAGCTCCACCGCCGTCAGATTTGTTGCGCTGTCGTTGGATCCACTGC
 
. : . : . : . : . : . :
rJMFF026D09- CCCCTCGTGTCAGCTGCACGCCTCGCGCCTGCCGTTCGTCGAAAAACTAGAGGACGCCGC
JMFN028C05+ CCCCTCGTGTCA---GCACGCCTCGCGCCTGCCGTTCGTCGAAAAACTAGAGGACGCCGC
JMFN020K22+ CCCCTCGTGTCA---GCACGCCTCGCGCCTGCCGTTCGTCGAAAAACTAGAGGACGCCGC
JMFN035K19+ CCCCTCGTGTCAGCTGCACGCCTCGCGCCTGCCGTTCGTCGAAAAACTAGAGGACGCCGC
JMFF026D09+ CCCCTCGTGTCAGCTGCACGCCTCGCGCCTGCCGTTCGTCGAAAAACTAGAGGACGCCGC
                      ____________________________________________________________
consensus CCCCTCGTGTCAGCTGCACGCCTCGCGCCTGCCGTTCGTCGAAAAACTAGAGGACGCCGC
 
. : . : . : . : . : . :
rJMFF026D09- CGGTTGGAGAGAAGCTCGGACTACCATCGGATCTGCCTTGCTCGTTCGTCGCTGGAACCA
JMFN028C05+ CGGTTGGAGAGAAGCTCGGACTACCATCGGATCTGCCTTGCTCGTTCGTCGCTGGAACCA
JMFN020K22+ CGGTTGGAGAGAAGCTCGGACTACCATCGGATCTGCCTTGCTCGTTCGTCGCTGGAACCA
JMFN035K19+ CGGTTGGAGAGAAGCTCGGACTACCATCGGATCTGCCTTGCTCGTTCGTCGCTGGAACCA
JMFF026D09+ CGGTTGGAGAGAAGCTCGGACTACCATCGGATCTGCCTTGCTCGTTCGTCGCTGGAACCA
                      ____________________________________________________________
consensus CGGTTGGAGAGAAGCTCGGACTACCATCGGATCTGCCTTGCTCGTTCGTCGCTGGAACCA
 
. : . : . : . : . : . :
rJMFF026D09- CCGCCGGACATGGTCGCCTGCTTCGCTGCTGGTTACGTCAAGAGAGAGAGCAGGAGCAAC
JMFN028C05+ CCGCCGGACATGGTCGCCTGCTTCGCTGCTGGTTACGTCAAGAGAGAGAGCAGGAGCAAC
JMFN020K22+ CCGCCGGACATGGTCGCCTGCTTCGCTGCTGGTTACGTCAAGAGAGAGAGCAGGAGCAAC
JMFN035K19+ CCGCCGGACATGGTCGCCTGCTTCGCTGCTGGTTACGTCAAGAGAGAGAGCAGGAGCAAC
JMFF026D09+ CCGCCGGACATGGTCGCCTGCTTCGCTGCTGGTTACGTCAAGAGAGAGAGCAGGAGCAAC
                      ____________________________________________________________
consensus CCGCCGGACATGGTCGCCTGCTTCGCTGCTGGTTACGTCAAGAGAGAGAGCAGGAGCAAC
 
. : . : . : . : . : . :
rJMFF026D09- GAAAATGGAGGGAGGAAGGAA
JMFN028C05+ GAAAATGGAGGGAGGAAGGAAGGGATAAAGAAGGTGGCTGGTGGTGGCTTCGCTGGACCT
JMFN020K22+ GAAAATGGAGGGAGGAAGGAAGGGATAAAGAAGGTGGCTGGTGGTGGCTTCGCTGGACCT
JMFN035K19+ GAAAATGGAGGGAGGAAGGAAGGGATAAAGAAGGTGGCTGGTGGTGGCTTCGCTGGACCT
JMFF026D09+ GAAAATGGAGGGAGGAAGGAAGGGATAAAGAAGGTGGCTGGTGGTGGCTTCGCTGGACCT
                      ____________________________________________________________
consensus GAAAATGGAGGGAGGAAGGAAGGGATAAAGAAGGTGGCTGGTGGTGGCTTCGCTGGACCT
 
. : . : . : . : . : . :
JMFN028C05+ TCACCTCACCGCCACCATC
JMFN020K22+ TCACCTCACCGCCACCATCTGTTCCGCCAGCCAAACGAGATGGAGAGGGAGAGAGAAGCT
JMFN035K19+ TCACCTCACCGCCACCATCTGTTCCGCCAGCCAAACGAGATGGAGAGGGAGAGAGAAGCT
JMFF026D09+ TCACCTCACCGCCACCATCTGTTCCGCCAGCCAAACGAGATGGAGAGGGAGAGAGAAGCT
                      ____________________________________________________________
consensus TCACCTCACCGCCACCATCTGTTCCGCCAGCCAAACGAGATGGAGAGGGAGAGAGAAGCT
 
. : . : . : . : . : . :
JMFN020K22+ CTAGGTGGTTGGGGCTGTTAGGGT
JMFN035K19+ CTAGGTGGTTGGGGCTGTTAGGGTTATTTGGGGATTTGGGG
JMFF026D09+ CTAGGTGGTTGGGGCTGTTAGGGTTATTTGGGGATTTGGGGATTTGGGGATGGTGAGAGG
                      ____________________________________________________________
consensus CTAGGTGGTTGGGGCTGTTAGGGTTATTTGGGGATTTGGGGATTTGGGGATGGTGAGAGG