Previous Contig 001236:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF013B09Sequence459001236 (5)gb:AY093171_15751251e-16Arabidopsis thaliana unknown protein (At3g28920) mRNA, complete cds.>gb:AY128820362011596 (10)
JMFF026D03Sequence532001236 (5)gb:AY093171_15751259e-15Arabidopsis thaliana unknown protein (At3g28920) mRNA, complete cds.>gb:AY128820588011596 (10)gb:AY730338_16254381e-24Solanum tuberosum strain P6/210 clone BAC BA47f2, complete sequence.
JMFF035F17Sequence541001236 (5)gb:AY093171_15751251e-28Arabidopsis thaliana unknown protein (At3g28920) mRNA, complete cds.>gb:AY128820654011596 (10)gb:AY730338_16254381e-24Solanum tuberosum strain P6/210 clone BAC BA47f2, complete sequence.
JMSF008G08Sequence424001236 (5)667011596 (10)gb:AY730338_16254382e-22Solanum tuberosum strain P6/210 clone BAC BA47f2, complete sequence.
JMSF043C07Sequence792001236 (5)gb:AY093171_15751251e-30Arabidopsis thaliana unknown protein (At3g28920) mRNA, complete cds.>gb:AY128820631011596 (10)gb:AY730338_16254382e-17Solanum tuberosum strain P6/210 clone BAC BA47f2, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF043C07+ GACCGGATAAGCCGGTGNTAA
                      ____________________________________________________________
consensus GACCGGATAAGCCGGTGNTAA
 
. : . : . : . : . : . :
JMSF043C07+ GCGCGAGGAGCATTTGCGGCGCTGAGGGGTAGTACGAGGAAGAGATCGGCGGCGGAGATG
                      ____________________________________________________________
consensus GCGCGAGGAGCATTTGCGGCGCTGAGGGGTAGTACGAGGAAGAGATCGGCGGCGGAGATG
 
. : . : . : . : . : . :
JMSF043C07+ GGGAATTCGGGCTGCTGTGGTCGTGAGGCGGCGGCGGCGGCGGTGGAGGCGGGTGGTGGC
                      ____________________________________________________________
consensus GGGAATTCGGGCTGCTGTGGTCGTGAGGCGGCGGCGGCGGCGGTGGAGGCGGGTGGTGGC
 
. : . : . : . : . : . :
JMFF035F17+ CG
JMSF043C07+ GGTGGTGGGGCTGGTACTCTAGAGCTGGCGCCGCGCTTGGCAGCCCAAGCGGCTCCTCCG
                      ____________________________________________________________
consensus GGTGGTGGGGCTGGTACTCTAGAGCTGGCGCCGCGCTTGGCAGCCCAAGCGGCTCCTCCG
 
. : . : . : . : . : . :
JMFF013B09+ GGGT
JMFF035F17+ GCTCACGGCGGTGGAAATTCCGGTGACACCCACACGCGGCACATTTCAGCGAGGTTGGGT
JMSF043C07+ GCTCACGGCGGTGGAAATTCCGGTGACACCCACACGCGGCACATTTCAGCGAGGTTGGGT
                      ____________________________________________________________
consensus GCTCACGGCGGTGGAAATTCCGGTGACACCCACACGCGGCACATTTCAGCGAGGTTGGGT
 
. : . : . : . : . : . :
JMFF013B09+ CCGCAGGATTCGCCGTTGGCGACGGCATGAACTCCCCGCAACCGTCCACGGCGTGGCCGC
JMFF035F17+ CCGCAGGATTCGCCGTTGGCGACGGCATGAACTCCCCGCAACCGTCCACGGCGTGGCCGC
JMSF043C07+ CCGCAGGATTCGCCGTTGGCGACGGCATGAACTCCCCGCAACCGTCCACGGCGTGGCCGC
JMFF026D03+ TTCGCCGTTGGCGACGGCATGAACTCCCCGCAACCGTCCACGGCGTGGCCGC
                      ____________________________________________________________
consensus CCGCAGGATTCGCCGTTGGCGACGGCATGAACTCCCCGCAACCGTCCACGGCGTGGCCGC
 
. : . : . : . : . : . :
JMFF013B09+ CGATACTGGCGGCGTGGTTCTTCAGGCACTCCTTGTAAACAACCACCACCGCGTGGTGGT
JMFF035F17+ CGATACTGGCGGCGTGGTTCTTCAGGCACTCCTTGTAAACAACCACCACCGCGTGGTGGT
JMSF043C07+ CGATACTGGCGGCGTGGTTCTTCAGGCACTCCTTGTAAACAACCACCACCGCGTGGTGGT
JMSF008G08+ ACCGCGTGGTGGT
JMFF026D03+ CGATACTGGCGGCGTGGTTCTTCAGGCACTCCTTGTAAACAACCACCACCGCGTGGTGGT
                      ____________________________________________________________
consensus CGATACTGGCGGCGTGGTTCTTCAGGCACTCCTTGTAAACAACCACCACCGCGTGGTGGT
 
. : . : . : . : . : . :
JMFF013B09+ GGTGGTGGTGGTGGTGGAGCGAATTGTGGCGCTTCAGCACCCCGTTACTGNTAAAAGACA
JMFF035F17+ GGTGGTGGTGGTGGTGGAGCGAATTGNGGCGCTTCAGCACCCCGTTACTGCTAAAAGACA
JMSF043C07+ GGTGGTGGTGGTGGTGGAGCGAATTGTGGCGCTTCAGCACCCCGTTACTGCTAAAAGACA
JMSF008G08+ GGTGGTGGTGGTGGTGGAGCGAATTGTGGCGCTTCAGCACCCCGTTACTGCTAAAAGACA
JMFF026D03+ GGTGGTGGTGGTGGTGGAGCGAATTGTGGCGCTTCAGCACCCCGTTACTGCTAAAAGACA
                      ____________________________________________________________
consensus GGTGGTGGTGGTGGTGGAGCGAATTGTGGCGCTTCAGCACCCCGTTACTGCTAAAAGACA
 
. : . : . : . : . : . :
JMFF013B09+ ACGGCTTCACCGCCGAGATCCTCGCCGCCGGCGTCTCACTCTCNTGAACATCACCGCCTT
JMFF035F17+ ACGGCTTCACCGCCGAGATCCTCGCCGCCGGCGTCTCACTCTCCTGAACATCACCGCCTT
JMSF043C07+ ACGGCTTCACCGCCGAGATCCTCGCCGCCGGCGTCTCACTCTCCTGAACATCACCGCCTT
JMSF008G08+ ACGGCTTCACCGCCGAGATCCTCGCCGCCGGCGTCTCACTCTCCTGAACATCACCGCCTT
JMFF026D03+ ACGGCTTCACCGCCGAGATCCTCGCCGCCGGCGTCTCACTCTCCTGAACATCACCGCCTT
                      ____________________________________________________________
consensus ACGGCTTCACCGCCGAGATCCTCGCCGCCGGCGTCTCACTCTCCTGAACATCACCGCCTT
 
. : . : . : . : . : . :
JMFF013B09+ TAACCGCCGCGGCCGCGGCGGAGCTCGCGTTGGTGGCTGCCGGAGGATTACTGCCTAAAT
JMFF035F17+ TAACCGCCGCGGCCGCGGCGGAGCTCGCGTTGGTGGCTGCCGGAGGATTACTGCCTAAAT
JMSF043C07+ TAACCGCCGCGGCCGCGGCGGAGCTCGCGTTGGTGGCTGCCGGAGGATTACTGCCTAAAT
JMSF008G08+ TAACCGCCGCGGCCGCGGCGGAGCTCGCGTTGGTGGCTGCCGGAGGATTACTGCCTAAAT
JMFF026D03+ TAACCGCCGCGGCCGCGGCGGAGCTCGCGTTGGTGGCTGCCGGAGGATTACTGCCTAAAT
                      ____________________________________________________________
consensus TAACCGCCGCGGCCGCGGCGGAGCTCGCGTTGGTGGCTGCCGGAGGATTACTGCCTAAAT
 
. : . : . : . : . : . :
JMFF013B09+ CCATGCTNTAAACATCAAGCAGTAGTGGCCCTCTAAACTTCCCTCTTCCTTCTTCTCACT
JMFF035F17+ CCATGCTCTAAACATCAAGCAGTAGTGGCCCTCTAAACTTCCCTCTTCCTTCTTCTCACT
JMSF043C07+ CCATGCTCTAAACATCAAGCAGTAGTGGCCCTCTAAACTTCCCTCTTCCTTCTTCTCACC
JMSF008G08+ CCATGCTCTAAACATCAAGCAGTAGTGGCCCTCTAAACTTCCCTCTTCCTTCTTCTCACT
JMFF026D03+ CCATGCTCTAAACATCAAGCAGTAGTGGCCCTCTAAACTTCCCTCTTCCTTCTTCTCACT
                      ____________________________________________________________
consensus CCATGCTCTAAACATCAAGCAGTAGTGGCCCTCTAAACTTCCCTCTTCCTTCTTCTCACT
 
. : . : . : . : . : . :
JMFF013B09+ CTACTCTCCNGTAACCTTAGATTAGGGTTAACCTTTCACGCCCAGAAACACCCATCTTTC
JMFF035F17+ CTACTCTCCTGTAACCTTAGATTAGGGTTAACCTTTCACGCCCAGAAACACCCATCTTTC
JMSF043C07+ CTACTCTCCTGTAACCTTAGATTAGGGTTAACCTTTCACGCCCAGAAACACCCATCTTTC
JMSF008G08+ CTACTCTCCTGTAACCTTAGATTAGGGTTAACCTTTCACGCCCAGAAACACCCATCTTTC
JMFF026D03+ CTACTCTCCTGTAACCTTAGATTAGGGTTAACCTTTCACGCCCAGAAACACCCATCTTTC
                      ____________________________________________________________
consensus CTACTCTCCTGTAACCTTAGATTAGGGTTAACCTTTCACGCCCAGAAACACCCATCTTTC
 
. : . : . : . : . : . :
JMFF013B09+ TCCATTAAAGACAGTAAAGATGAGAGCTTTTGAAG
JMFF035F17+ TCCATTAAAGACAGTAAAGATGAGAGCTTTTGAAGTTAAGGAGAAATGAATTTTGTGTT
JMSF043C07+ TCCATTAAAGACAGTAAAGATGAGAGCTTTTGAAGTTAAGGAGAAATGAATTTTGTGTTG
JMSF008G08+ TCCATTAAAGACAGTAAAGATGAGAGCTTTTGAAGTTAAGGAGAAATGAATTTTGTGTTG
JMFF026D03+ TCCATTAAAGACAGTAAAGATGAGAGCTTTTGAAGTTAAGGAGAAATGAATTTTGTGTTG
                      ____________________________________________________________
consensus TCCATTAAAGACAGTAAAGATGAGAGCTTTTGAAGTTAAGGAGAAATGAATTTTGTGTTG
 
. : . : . : . : . : . :
JMSF043C07+ GAATATTATGGCTCTGGGGGAAAGGTTGCTGATGAAGATGATGGATGGGT
JMSF008G08+ GAATATTATGGCTCTGGGGGAAAGGTTGCTGATGAAGATGATGGATGGGT
JMFF026D03+ GAATATTATGGCTCTGGGGGAAAGGTTGCTGATGAAGATGATGGATGGGTAGAGATGAAG
                      ____________________________________________________________
consensus GAATATTATGGCTCTGGGGGAAAGGTTGCTGATGAAGATGATGGATGGGTAGAGATGAAG