Previous Contig 001233:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF023N01Sequence421001233 (8)gb:AB024029_15157423e-58Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K21L19.>gb:AY062789_15736001233 (8)gb:AB024029_15157422e-85Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K21L19.>gb:AY062789_15
JMFF026C12Sequence505001233 (8)gb:AB024029_15157423e-69Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K21L19.>gb:AY062789_15681001233 (8)gb:AY085685_15707522e-77Arabidopsis thaliana clone 17098 mRNA, complete sequence.
JMFF047C08Sequence392001233 (8)gb:AB024029_15157423e-51Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K21L19.>gb:AY062789_15348001233 (8)gb:AY085685_15707521e-10Arabidopsis thaliana clone 17098 mRNA, complete sequence.
JMFN030G15Sequence569001233 (8)gb:AY085685_15707524e-52Arabidopsis thaliana clone 17098 mRNA, complete sequence.
JMFN040O04Sequence622001233 (8)gb:AY085685_15707527e-74Arabidopsis thaliana clone 17098 mRNA, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF047C08- GAGACAAA
                      ____________________________________________________________
consensus GAGACAAA
 
. : . : . : . : . : . :
rJMFF047C08- TTCAAGAAACTTCATACAAAACAACATACACATACTACATACATACAATCTTTTCAAGAT
JMFN030G15+ CATACAAAACAACATACACATACTACATACATACAATCTNTTCAAGAT
rJMFF026C12- AACATACACATACTACATACATACAATCTTTTCAAGAT
rJMFF023N01- AGAT
                      ____________________________________________________________
consensus TTCAAGAAACTTCATACAAAACAACATACACATACTACATACATACAATCTTTTCAAGAT
 
. : . : . : . : . : . :
rJMFF047C08- TACACAATCAATCCATAAAAAACATATATATGCCAAAAAAAAACACTGCCCTCAT--ATC
JMFN030G15+ TACACAATCAATCCATAAAAAACATATATATGCCAAAAAAAAACACTGCCCTCATCCATC
rJMFF026C12- TACACAATCAATCCATAAAAAACATATATATGCCAAAAAAAAACACTGCCCTCAT--ATC
JMFN040O04+ AATCAATCCATAAAAAACATATATATGCCAAAAAAAAACACTGCCCTCATCCATC
rJMFF023N01- TACACAATCAATCCATAAAAAACATATATATGCCAAAAAAAAACACTGCCCTCATCCATC
                      ____________________________________________________________
consensus TACACAATCAATCCATAAAAAACATATATATGCCAAAAAAAAACACTGCCCTCATCCATC
 
. : . : . : . : . : . :
rJMFF047C08- CTTCTTCTCAGTTCACATTTACATCCTACAACATAAAGCTCCTTATTTTTTCAATATAAG
JMFN030G15+ CTTCTTCTCAGTTCACATTTACATCCTACAACATAAAGCTCCTTATTTTTTCAATATAAG
rJMFF026C12- CTTCTTCTCAGTTCACATTTACATCCTACAACATAAAGCTCCTTATTTTTTCAATATAAG
JMFN040O04+ CTTATTCTCAGTTCACATTTACATCCTACAACATAAAGCTCCTTATTTTTTCAATATAAG
rJMFF023N01- CTTCTTCTCAGTTCACATTTACATCCTACAACATAAAGCTCCTTATTTTTTCAATATAAG
                      ____________________________________________________________
consensus CTTCTTCTCAGTTCACATTTACATCCTACAACATAAAGCTCCTTATTTTTTCAATATAAG
 
. : . : . : . : . : . :
rJMFF047C08- ACTTGGTTGCTGCAGCTAGTAGTGTAGTATGTCCTACTTTCCAAAGATGGACTTGATCCA
JMFN030G15+ ACTTGGTTGCTGCAGCTAGTAGTGTAGTATGTCCTACTTTCCAAAGATGGACTTGATCCA
rJMFF026C12- ACTTGGTTGCTGCAGCTAGTAGTGTAGTATGTCCTACTTTCCAAAGATGGACTTGATCCA
JMFN040O04+ ACTTGGTTGCTGCAGCTAGTAGTGTAGTATGTCCTACTTTCCAAAGATGGACTTGATCCA
rJMFF023N01- ACTTGGTTGCTGCAGCTAGTAGTGTAGTATGTCCTACTTTCCAAAGATGGACTTGATCCA
                      ____________________________________________________________
consensus ACTTGGTTGCTGCAGCTAGTAGTGTAGTATGTCCTACTTTCCAAAGATGGACTTGATCCA
 
. : . : . : . : . : . :
rJMFF047C08- CCAAATCCCTTTGTCGCTCGCGACTTCCCCCTCCGGTGGAGTCTCAGAATGCGGTGTCTT
JMFN030G15+ CCAAATCCCTTTGTCGCTCGCGACTTCCCCCTCCGGTGGAGTCTCAGAATGCGGTGTCTT
rJMFF026C12- CCAAATCCCTTTGTCGCTCGCGACTTCCCCCTCCGGTGGAGTCTCANAATGCGGTGTCTT
JMFN040O04+ CCAAATCCCTTTGTCGCTCGCGACTTCCCCCTCCGGTGGAGTCTCAGAATGCGGTGTCTT
rJMFF023N01- CCAAATCCCTTTGTCGCTCGCGACTTCCCCCTCCGGTGGAGTCTCANAATGCGGTGTCTT
                      ____________________________________________________________
consensus CCAAATCCCTTTGTCGCTCGCGACTTCCCCCTCCGGTGGAGTCTCAGAATGCGGTGTCTT
 
. : . : . : . : . : . :
rJMFF047C08- GTGAAGCTTGCTTACATCGTACCCCACCTCTTTCGCCTTCTC
JMFN030G15+ GTGAAGCTTGCTTACATCGTACCCCACCTCTTTCGCCTTCTCAACCAGCTCGTTGTAGGT
rJMFF026C12- GTGAAGCTTGCTTACATCGTACCCCACCTCTTTCGCCTTCTCAACCAGCTCGTTGTAGGT
JMFN040O04+ GTGAAGCTTGCTTACATCGTACCCCACCTCTTTCGCCTTCTCAACCAGCTCGTTGTAGGT
rJMFF023N01- GTGAAGCTTGCTTACATCGTACCCCACCTCTTTCGCCTTCTCAACCAGCTCGTTGTAGGT
JMFF026C12+ CCTTCTCAACCAGCTCGTTGTAGGT
                      ____________________________________________________________
consensus GTGAAGCTTGCTTACATCGTACCCCACCTCTTTCGCCTTCTCAACCAGCTCGTTGTAGGT
 
. : . : . : . : . : . :
JMFN030G15+ CTCATCATCAAGCCGAGGCTGCCTACACAATATCCAGAGATAACTCCTGCTTGGCTGGCC
rJMFF026C12- CTCATCATCAAGCCGAGGCTGCCTACACAATATCCAGAGATAACTCCTGCTTGGCTGGCC
JMFN040O04+ CTCATCATCAAGCCGAGGCTGCCTACACAATATCCAGAGATAACTCCTGCTTGGCTGGCC
rJMFF023N01- CTCATCATCAAGCCGAGGCTGCCTACACAATATCCAGAGATAACTCCTGCTTGGCTGGCC
JMFF023N01+ GGCTGGCC
JMFF026C12+ CTCATCATCAAGCCGAGGCTGCCTACACAATATCCAGAGATAACTCCTGCTTGGCTGGCC
                      ____________________________________________________________
consensus CTCATCATCAAGCCGAGGCTGCCTACACAATATCCAGAGATAACTCCTGCTTGGCTGGCC
 
. : . : . : . : . : . :
JMFN030G15+ AATCAAAGCATACTGGTAATCAGGGTCAATGTGCAAAACCCAGTAGTCCCCAGTGACAGG
rJMFF026C12- AATCAAAGCATACTGGTAATCAGGGTCAATGTGCAAAACCCAGTAGTCCCCAGTGACAGG
JMFN040O04+ AATCAAAGCATACTGGTAATCAGGGTCAATGTGCAAAACCCAGTAGTCCCCAGTGACAGG
rJMFF023N01- AATCAAAGCATACTGGTAATCAGGGTCAATGTGCAAAACCCAGTAGTCCCCAGTGACAGG
JMFF023N01+ AATCAAAGCATACTGGTAATCAGGGTCAATGTGCAAAACCCAGTAGTCCCCAGTGACAGG
JMFF047C08+ ATGTGCAAAACCCAGTAGTCCCCAGTGACAGG
JMFF026C12+ AATCAAAGCATACTGGTAATCAGGGTCAATGTGCAAAACCCAGTAGTCCCCAGTGACAGG
                      ____________________________________________________________
consensus AATCAAAGCATACTGGTAATCAGGGTCAATGTGCAAAACCCAGTAGTCCCCAGTGACAGG
 
. : . : . : . : . : . :
JMFN030G15+ GAATATGGGCAAGAAAGGGGGAACATAAAACCTGACCTTGAGCTTAGCCTCATCGCTTTT
rJMFF026C12- GAATATGGGCAAGAAAGGGGGAACATAAAACCTGACCTTGAGCTTAGCCTCATCGCTTTT
JMFN040O04+ GAATATGGGCAAGAAAGGGGGAACATAAAACCTGACCTTGAGCTTAGCCTCATCGCTTTT
rJMFF023N01- GAATATGGGCAAGAAAGGGGGAACATAAAACCTGACCTTGAGCTTAGCCTCATCGCTTTT
JMFF023N01+ GAATATGGGCAAGAAAGGGGGAACATAAAACCTGACCTTGAGCTTAGCCTCATCGCTTTT
JMFF047C08+ GAATATGGGCAAGAAAGGGGGAACATAAAACCTGACCTTGAGCTTAGCCTCATCGCTTTT
JMFF026C12+ GAATATGGGCAAGAAAGGGGGAACATAAAACCTGACCTTGAGCTTAGCCTCATCGCTTTT
                      ____________________________________________________________
consensus GAATATGGGCAAGAAAGGGGGAACATAAAACCTGACCTTGAGCTTAGCCTCATCGCTTTT
 
. : . : . : . : . : . :
JMFN030G15+ AGGGTCAGCCTTGTATGCAGTTCCCTCGATGTAACCTCTCT
rJMFF026C12- AGGGTCAGCCTTGTATGCAGTTCCCTCGATGTAACCTCTCTTCCCACCACTCCAAGTCTC
JMFN040O04+ AGGGTCAGCCTTGTATGCAGTTCCCTCGATGTAACCTCTCTTCCCACCACTCCAAGTCTC
rJMFF023N01- AGGGTCAGCCTTGTATGCAGTTCCCTCGATGTAACCTCTCTTCCCACCACTCCAAGTCTC
JMFF023N01+ AGGGTCAGCCTTGTATGCAGTTCCCTCGATGTAACCTCTCTTCCCACCACTCCAAGTCTC
JMFF047C08+ AGGGTCAGCCTTGTATGCAGTTCCCTCGATGTAACCTCTCTTCCCACCACTCCAAGTCTC
JMFF026C12+ AGGGTCAGCCTTGTATGCAGTTCCCTCGATGTAACCTCTCTTCCCACCACTCCAAGTCTC
                      ____________________________________________________________
consensus AGGGTCAGCCTTGTATGCAGTTCCCTCGATGTAACCTCTCTTCCCACCACTCCAAGTCTC
 
. : . : . : . : . : . :
rJMFF026C12- ATTCAACACATGAACTGTGCCATCAGGGTTTAGAGTGTAGGTAGCCCTGGTGTCCACCCC
JMFN040O04+ ATTCAACACATGAACTGTGCCATCAGGGTTTAGAGTGTAGGTAGCCCTGGTGTCCACCCC
rJMFF023N01- ATTCAACACATGAACTGTGCCATCAGGGTTTANAGTGTAGGTAGCCCTGGTGTCCACCCC
JMFF023N01+ ATTCAACACATGAACTGTGCCATCAGGGTTTAGAGTGTAGGTAGCCCTGGTGTCCACCCC
JMFF047C08+ ATTCAACACATGAACTGTGCCATCAGGGTTTAGAGTGTAGGTAGCCCTGGTGTCCACCCC
JMFF026C12+ ATTCAACACATGAACTGTGCCATCAGGGTTTAGAGTGTAGGTAGCCCTGGTGTCCACCCC
                      ____________________________________________________________
consensus ATTCAACACATGAACTGTGCCATCAGGGTTTAGAGTGTAGGTAGCCCTGGTGTCCACCCC
 
. : . : . : . : . : . :
rJMFF026C12- ATCTTTGGGCTGAAATCTTGATGGGAATGANGCTATCTCGTACCA
JMFN040O04+ ATCTTTGGGCTGAAATCTTGATGGGAA
rJMFF023N01- ATCTTTGGGCTGAAATCTTGATGGGAATGANGCTATCTCGTACCACCTCCCCATGTACCT
JMFF023N01+ ATCTTTGGGCTGAAATCTTGATGGGAATGAGGCTATCTCGTACCACCTCCCCATGTACCT
JMFF047C08+ ATCTTTGGGCTGAAATCTTGATGGGAATGAGGCTATCTCGTACCACCTCCCCATGTACCT
JMFF026C12+ ATCTTTGGGCTGAAATCTTGATGGGAATGAGGCTATCTCGTACCACCTCCCCATGTACCT
                      ____________________________________________________________
consensus ATCTTTGGGCTGAAATCTTGATGGGAATGAGGCTATCTCGTACCACCTCCCCATGTACCT
 
. : . : . : . : . : . :
rJMFF023N01- CTCCACATCAAGATTTCTCACTACTTCCATCTCTTTTGTGCTACCCATTTCTTTGATTTT
JMFF023N01+ CTCCACATCAAGATTTCTCACTACTTCCATCTCTTTTGTGCTACCCATTTCTTTGATTTT
JMFF047C08+ CTCCACATCAAGATTTCTCACTACTTCCATCTCTTTTGTGCTACCCATTTCTTTGATTTT
JMFF026C12+ CTCCACATCAAGATTTCTCACTACTTCCATCTCTTTTGTGCTACCCATTTCTTTGATTTT
                      ____________________________________________________________
consensus CTCCACATCAAGATTTCTCACTACTTCCATCTCTTTTGTGCTACCCATTTCTTTGATTTT
 
. : . : . : . : . : . :
rJMFF023N01- GATT
JMFF023N01+ GATTTTAAGGAAGGGTTTTGTTTGGAGTTTTAGTGTTTCTCTATATGGGATAT
JMFF047C08+ GATTTTAAGGAAGGGTTTTGTTTGGAGTTTTAGTGTTTCTCTATATGGGATAT
JMFF026C12+ GATTTTAAGGAAGGGTTTTGTTTGGAGTTTTAGTGTTTCTCTATATGGGATATGGCAATT
                      ____________________________________________________________
consensus GATTTTAAGGAAGGGTTTTGTTTGGAGTTTTAGTGTTTCTCTATATGGGATATGGCAATT