Previous Contig 001228:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF026A03Sequence578001228 (3)712009422 (3)gb:CQ759959_14516603e-70Sequence 5 from Patent WO2004003185.
JMSF014E22Sequence109001228 (3)676009422 (3)gb:CQ759959_14516607e-65Sequence 5 from Patent WO2004003185.
JMSF022C02Sequence662001228 (3)gb:AK131259_19178262e-10Homo sapiens cDNA FLJ16191 fis, clone BRTHA2013610, moderately similar to Arabid

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF022C02+ CTTCATCCACACT
                      ____________________________________________________________
consensus CTTCATCCACACT
 
. : . : . : . : . : . :
JMSF022C02+ TTTCTTAATGAATGTTGTAATGCTCTCGGCATGGTTTTTGTGGATGATACCGACTGAACT
                      ____________________________________________________________
consensus TTTCTTAATGAATGTTGTAATGCTCTCGGCATGGTTTTTGTGGATGATACCGACTGAACT
 
. : . : . : . : . : . :
JMSF022C02+ CTGCAAAAACTCAACCATCTTTCCACTGGACGAACCATAGAACTTATCCCTGTATAGCTG
                      ____________________________________________________________
consensus CTGCAAAAACTCAACCATCTTTCCACTGGACGAACCATAGAACTTATCCCTGTATAGCTG
 
. : . : . : . : . : . :
JMSF022C02+ CTTAAGCTGGGCAACACCTTCAAAGCCCTTCTCCACGAGCTTCTTGAAATTCCTTGGCCC
                      ____________________________________________________________
consensus CTTAAGCTGGGCAACACCTTCAAAGCCCTTCTCCACGAGCTTCTTGAAATTCCTTGGCCC
 
. : . : . : . : . : . :
JMSF022C02+ GACACCGGGTATTGTCAGCAAATCTGGACTCCCAGGTTGTATTGTGCCGGCGCCGGCGCC
                      ____________________________________________________________
consensus GACACCGGGTATTGTCAGCAAATCTGGACTCCCAGGTTGTATTGTGCCGGCGCCGGCGCC
 
. : . : . : . : . : . :
JMSF022C02+ GGAGCTCCCACTCCTCTGCCTCCGCTGAGACCTCATCATTTTCCCGCTCTCATCACCAGT
                      ____________________________________________________________
consensus GGAGCTCCCACTCCTCTGCCTCCGCTGAGACCTCATCATTTTCCCGCTCTCATCACCAGT
 
. : . : . : . : . : . :
JMSF022C02+ CACGTGACTCGCGTCCTCGTGCTTCAAGCTATTCAACCCCTCAGCTTCACCTTCCGGCGC
                      ____________________________________________________________
consensus CACGTGACTCGCGTCCTCGTGCTTCAAGCTATTCAACCCCTCAGCTTCACCTTCCGGCGC
 
. : . : . : . : . : . :
JMSF022C02+ CGCTACAACGCTCTCCGAATCCCCCGCCGCAACCGTAGCGAACCACGCGGCGTGGGCCCC
JMFF026A03+ CCCCGCCGCAACCGTAGCGAACCACGCGGCGTGGGCCCC
                      ____________________________________________________________
consensus CGCTACAACGCTCTCCGAATCCCCCGCCGCAACCGTAGCGAACCACGCGGCGTGGGCCCC
 
. : . : . : . : . : . :
JMSF022C02+ CCGCGCATTCTCCTGCTTGAGAACGACCCACGCCCTCACGGGGGCCCTGCTCTCGAGAGA
JMFF026A03+ CCGCGCATTCTCCTGCTTGAGAACGACCCACGCCCTCACGGGGGCCCTGCTCTCGAGAGA
                      ____________________________________________________________
consensus CCGCGCATTCTCCTGCTTGAGAACGACCCACGCCCTCACGGGGGCCCTGCTCTCGAGAGA
 
. : . : . : . : . : . :
JMSF022C02+ ACACCGGCAGATACGGCAACTCCCGCGCAGGGAAGTGACGGTTTTGGCTACTGCTTTGGA
JMSF014E22+ GGA
JMFF026A03+ ACACCGGCAGATACGGCAACTCCCGCGCAGGGAAGTGACGGTTTTGGCTACTGCTTTGGA
                      ____________________________________________________________
consensus ACACCGGCAGATACGGCAACTCCCGCGCAGGGAAGTGACGGTTTTGGCTACTGCTTTGGA
 
. : . : . : . : . : . :
JMSF022C02+ GCCGGCGCCGGAGAATGTATTTCCGGCGGCGGAGTAAGGAAGGGGGGAGTGGCGCAGA-C
JMSF014E22+ GCCGGCGCCGGAGAATGTATTTCCGGCGGCGGAGTAAGGAAGGGGAGAGTGGCGCAGATC
JMFF026A03+ GCCGGCGCCGGAGAATGTATTTCCGGCGGCGGAGTAAGGAAGGGGAGAGTGGCGCAGA-C
                      ____________________________________________________________
consensus GCCGGCGCCGGAGAATGTATTTCCGGCGGCGGAGTAAGGAAGGGGAGAGTGGCGCAGA-C
 
. : . : . : . : . : . :
JMSF022C02+ GGTGGAGAGTGGCCGTGGAAGGCATTGGCGCAGTAGCGGGTCT
JMSF014E22+ GGTGGAGAGTGGCCGTGGAAGGCATTGGCGCAGTAGCGGGTCT
JMFF026A03+ GGTGGAGAGTGGCCGTGGAAGGCATTGGCGCAGTAGCGGGTCTGGGTTTAGGGGAAAAGG
                      ____________________________________________________________
consensus GGTGGAGAGTGGCCGTGGAAGGCATTGGCGCAGTAGCGGGTCTGGGTTTAGGGGAAAAGG
 
. : . : . : . : . : . :
JMFF026A03+ GCGTTTGGCGGTTCTTGTAAAACCCTAGAGAGAGAAAGTCGTGGGGGAAAGAGAGAGGGA
                      ____________________________________________________________
consensus GCGTTTGGCGGTTCTTGTAAAACCCTAGAGAGAGAAAGTCGTGGGGGAAAGAGAGAGGGA
 
. : . : . : . : . : . :
JMFF026A03+ GAGAGCTAACGGATAAGGCTGCCGGGGGACCAAGTGGATTTCTGCTTATCAGCTTCTGCA
                      ____________________________________________________________
consensus GAGAGCTAACGGATAAGGCTGCCGGGGGACCAAGTGGATTTCTGCTTATCAGCTTCTGCA
 
. : . : . : . : . : . :
JMFF026A03+ TCCCTTTGGCGCATCTCACAGTCACTGCAGGAAGGGAGTTCTTGAGGGAGTGAATACGTA
                      ____________________________________________________________
consensus TCCCTTTGGCGCATCTCACAGTCACTGCAGGAAGGGAGTTCTTGAGGGAGTGAATACGTA
 
. : . : . : . : . : . :
JMFF026A03+ CGTAATAATAGCTATATATGAAGTGTTTGTGTATATATATGTAGAGAGAGAAAGCTGTAA
                      ____________________________________________________________
consensus CGTAATAATAGCTATATATGAAGTGTTTGTGTATATATATGTAGAGAGAGAAAGCTGTAA
 
. : . : . : . : . : . :
JMFF026A03+ AAAATGGCTGGTTTTGTGTATGGTGGATTGGTGGGAAGTCGAGAATTTGAGAACTCAAAC
                      ____________________________________________________________
consensus AAAATGGCTGGTTTTGTGTATGGTGGATTGGTGGGAAGTCGAGAATTTGAGAACTCAAAC