Previous Contig 001227:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF025P21Sequence534001227 (5)gb:AY086429_15714771e-15Arabidopsis thaliana clone 250775 mRNA, complete sequence.>gb:BT004005_1637121 A690001227 (5)gb:AY086429_15714771e-16Arabidopsis thaliana clone 250775 mRNA, complete sequence.>gb:BT004005_1637121 A
JMSF010G08Sequence387001227 (5)
JMSF025F03Sequence675001227 (5)gb:AY086429_15714771e-16Arabidopsis thaliana clone 250775 mRNA, complete sequence.>gb:BT004005_1637121 A683001227 (5)gb:AY086429_15714771e-16Arabidopsis thaliana clone 250775 mRNA, complete sequence.>gb:BT004005_1637121 A

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF025F03- TTTAGCTTTGATATAAGTTTGACAGAAGGG
JMSF025F03+ TGATATAAGTTTGACAGAAGGG
rJMFF025P21- TTTAGCTTTGATATAAGTTTGACAGAAGGG
                      ____________________________________________________________
consensus TTTAGCTTTGATATAAGTTTGACAGAAGGG
 
. : . : . : . : . : . :
rJMSF025F03- GATTAAGAAGACGCAATTCATCGAACAGAAGATGTGCATAGCATTTCTAACAGTTTCACG
JMSF025F03+ GATTAAGAAGACGCAATTCATCGAACAGAAGATGTGCATAGCATTTCTAACAGTTTCACG
rJMFF025P21- GATTAAGAAGACGCAATTCATCGAACAGAAGATGTGCATAGCATTTCTAACAGTTTCACG
                      ____________________________________________________________
consensus GATTAAGAAGACGCAATTCATCGAACAGAAGATGTGCATAGCATTTCTAACAGTTTCACG
 
. : . : . : . : . : . :
rJMSF025F03- AAAGTAGAAAAGTTTCAATCTTGCATTGCAGAAGTAGTAGTAGTGGCAGAGGATTGCCTT
JMSF025F03+ AAAGTAGAAAAGTTTCAATCTTGCATTGCAGAAGTAGTAGTAGTGGCAGAGGATTGCCTT
rJMFF025P21- AAAGTAGAAAAGTTTCAATCTTGCATTGCAGAAGTAGTAGTAGTGGCAGAGGATTGCCTT
                      ____________________________________________________________
consensus AAAGTAGAAAAGTTTCAATCTTGCATTGCAGAAGTAGTAGTAGTGGCAGAGGATTGCCTT
 
. : . : . : . : . : . :
rJMSF025F03- ATTGTTCGAAGCTGTTGGATCCACTGACTCTCCGGGACCCGACCCGCCCAATCCGGAGCT
JMSF025F03+ ATTGTTCGAAGCTGTTGGATCCACTGACTCTCCGGGACCCGACCCGCCCAATCCGGAGCT
rJMFF025P21- ATTGTTCGAAGCTGTTGGATCCACTGACTCTCCGGGACCCGACCCGCCCAATCCGGAGCT
JMFF025P21+ CGAAGCTGTTGGATCCACTGACTCTCCGGGACCCGACCCGCCCAATCCGGAGCT
                      ____________________________________________________________
consensus ATTGTTCGAAGCTGTTGGATCCACTGACTCTCCGGGACCCGACCCGCCCAATCCGGAGCT
 
. : . : . : . : . : . :
rJMSF025F03- ACGCCGCCGAACGAGACACCGCGCATGGCCTCCATGACTCTCGTCGCGTTCTCCGGCGTC
JMSF025F03+ ACGCCGCCGAACGAGACACCGCGCATGGCCTCCATGACTCTCGTCGCGTTCTCCGGCGTC
rJMFF025P21- ACGCCGCCGAACGAGACACCGCGCATGGCCTCCATGACTCTCGTCGCGTTCTCCGGCGTC
JMFF025P21+ ACGCCGCCGAACGAGACACCGCGCATGGCCTCCATGACTCTCGTCGCGTTCTCCGGCGTC
                      ____________________________________________________________
consensus ACGCCGCCGAACGAGACACCGCGCATGGCCTCCATGACTCTCGTCGCGTTCTCCGGCGTC
 
. : . : . : . : . : . :
rJMSF025F03- AACGGAGCACTGCGGCGGTTATCGTCGTCTCTGAACGCTCTCCGAACAGCAGAATCAGAA
JMSF025F03+ AACGGAGCACTGCGGCGGTTATCGTCGTCTCTGAACGCTCTCCGAACAGCAGAATCAGAA
JMSF010G08+ CTGAACGCTCTCCGAACAGCAGAATCAGAA
rJMFF025P21- AACGGAGCACTGCGGCGGTTATCGTCGTCTCTGAACGCTCTCCGAACAGCAGAATCAGAA
JMFF025P21+ AACGGAGCACTGCGGCGGTTATCGTCGTCTCTGAACGCTCTCCGAACAGCAGAATCAGAA
                      ____________________________________________________________
consensus AACGGAGCACTGCGGCGGTTATCGTCGTCTCTGAACGCTCTCCGAACAGCAGAATCAGAA
 
. : . : . : . : . : . :
rJMSF025F03- GCAGCTCGGATCCTCTCCTCCTCTTCTTCCTCTTCATCATCCTCATCGCTCAGATCCAGA
JMSF025F03+ GCAGCTCGGATCCTCTCCTCCTCTTCTTCCTCTTCATCATCCTCATCGCTCAGATCCAGA
JMSF010G08+ GCAGCTCGGATCCTCTCCTCCTCTTCTTCCTCTTCATCATCCTCATCGCTCAGATCCAGA
rJMFF025P21- GCAGCTCGGATCCTCTCCTCCTCTTCTTCCTCTTCATCATCCTCATCGCTCAGATCCAGA
JMFF025P21+ GCAGCTCGGATCCTCTCCTCCTCTTCTTCCTCTTCATCATCCTCATCGCTCAGATCCAGA
                      ____________________________________________________________
consensus GCAGCTCGGATCCTCTCCTCCTCTTCTTCCTCTTCATCATCCTCATCGCTCAGATCCAGA
 
. : . : . : . : . : . :
rJMSF025F03- CACGACACTCCGTTCTCAACACAACGCGCGTAGCCGTTCGGCAATCGATTGAAATTGCTA
JMSF025F03+ CACGACACTCCGTTCTCAACACAACGCGCGTAGCCGTTCGGCAATCGATTGAAATTGCTA
JMSF010G08+ CACGACACTCCGTTCTCAACACAACGCGCGTAGCCGTTCGGCAATCGATTGAAATTGCTA
rJMFF025P21- CACGACACTCCGTTCTCAACACAACGCGCGTAGCCGTTCGGCAATCGATTGAAATTGCTA
JMFF025P21+ CACGACACTCCGTTCTCAACACAACGCGCGTAGCCGTTCGGCAATCGATTGAAATTGCTA
                      ____________________________________________________________
consensus CACGACACTCCGTTCTCAACACAACGCGCGTAGCCGTTCGGCAATCGATTGAAATTGCTA
 
. : . : . : . : . : . :
rJMSF025F03- CCGGACAGATCTCGATCTCCGTTACCGAGATTTGAATGTTGATCGGAGAACTCTTCGTCC
JMSF025F03+ CCGGACAGATCTCGATCTCCGTTACCGAGATTTGAATGTTGATCGGAGAACTCTTCGTCC
JMSF010G08+ CCGGACAGATCTCGATCTCCGTTACCGAGATTTGAATGTTGATCGGAGAACTCTTCGTCC
rJMFF025P21- CCGGACAGATCTCGATCTCCGTTACCGAGATTTGAATGTTGATCGGAGAACTCTTCGTCC
JMFF025P21+ CCGGACAGATCTCGATCTCCGTTACCGAGATTTGAATGTTGATCGGAGAACTCTTCGTCC
                      ____________________________________________________________
consensus CCGGACAGATCTCGATCTCCGTTACCGAGATTTGAATGTTGATCGGAGAACTCTTCGTCC
 
. : . : . : . : . : . :
rJMSF025F03- TCGTCATCTCCGTCGCCCGAGGAGATTGGCTGATAGTATTCTGGCGCTTCGTCGGAGTTC
JMSF025F03+ TCGTCATCTCCGTCGCCCGAGGAGATTGGCTGATAGTATTCTGGCGCTTCGTCGGAGTTC
JMSF010G08+ TCGTCATCTCCGTCGCCCGAGGAGATTGGCTGATAGTATTCTGGCGCTTCGTCGGAGTTC
rJMFF025P21- TCGTCATCTCCGTCGCCCGAGGAGATTGGCTGATAGTATTCTGGCGCTTCGTCGGAGTTC
JMFF025P21+ TCGTCATCTCCGTCGCCCGAGGAGATTGGCTGATAGTATTCTGGCGCTTCGTCGGAGTTC
                      ____________________________________________________________
consensus TCGTCATCTCCGTCGCCCGAGGAGATTGGCTGATAGTATTCTGGCGCTTCGTCGGAGTTC
 
. : . : . : . : . : . :
rJMSF025F03- GTATCCGAATCGCTTTCTCCGGCGTTCACTTGGTTGAATTCCGGCGGAGAGTTCGACACC
JMSF025F03+ GTATCCGAATCGCTTTCTCCGGCGTTCACTTGGTTGAATTCCGGCGGAGAGTTCGACACC
JMSF010G08+ GTATCCGAATCGCTTTCTCCGGCGTTCACTTGGTTGAATTCCGGCGGAGAGTTCGACACC
rJMFF025P21- GTATCCGAATCGCTTTCTCCGGCGTTCACTTGGTTGAATTCCGGCGGAGAGTTCGACACC
JMFF025P21+ GTATCCGAATCGCTTTCTCCGGCGTTCACTTGGTTGAATTCCGGCGGAGAGTTCGACACC
                      ____________________________________________________________
consensus GTATCCGAATCGCTTTCTCCGGCGTTCACTTGGTTGAATTCCGGCGGAGAGTTCGACACC
 
. : . : . : . : . : . :
rJMSF025F03- GCGTTCATTGTGCCTCAGCTAGAGAGAAACCGATAAGCTGAGATGAATGACT
JMSF025F03+ GCGTTCATTGTGCCTCAGCTAGAGAGAAACCGATAAGCTGAGATGAATGACT
JMSF010G08+ GCGTTCATTGTGCCTCAGCTAGAGAGAAACCGATAAGCTGAGATGAATGACT
rJMFF025P21- GCGTTCATTGTGCCTCAGCTAGAGAGAAACCGATAAGCTGAGATGAATGACT
JMFF025P21+ GCGTTCATTGTGCCTCAGCTAGAGAGAAACCGATAAGCTGAGATGAATGACTGAAAGTTC
                      ____________________________________________________________
consensus GCGTTCATTGTGCCTCAGCTAGAGAGAAACCGATAAGCTGAGATGAATGACTGAAAGTTC