Previous Contig 001222:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF006K13Sequence498001222 (24)sp|Q40401|CRTC_NICPL3e-76Calreticulin precursor.>pir|T16968|T16968 calreticulin cal1 - curled-leaved toba736010844 (15)gb:AF283816_17830743e-44Pinus taeda calreticulin mRNA, complete cds.
JMFF007C05Sequence605001222 (24)sp|Q40401|CRTC_NICPL3e-96Calreticulin precursor.>pir|T16968|T16968 calreticulin cal1 - curled-leaved toba775010844 (15)gb:AF283816_17830748e-58Pinus taeda calreticulin mRNA, complete cds.
JMFF011H11Sequence511001222 (24)sp|Q40401|CRTC_NICPL2e-78Calreticulin precursor.>pir|T16968|T16968 calreticulin cal1 - curled-leaved toba775010844 (15)gb:AF283816_17830743e-61Pinus taeda calreticulin mRNA, complete cds.
JMFF015J08Sequence606001222 (24)sp|Q40401|CRTC_NICPL3e-96Calreticulin precursor.>pir|T16968|T16968 calreticulin cal1 - curled-leaved toba547010844 (15)gb:AF283816_17830743e-04Pinus taeda calreticulin mRNA, complete cds.
JMFF015O07Sequence607001222 (24)sp|Q40401|CRTC_NICPL5e-97Calreticulin precursor.>pir|T16968|T16968 calreticulin cal1 - curled-leaved toba684010844 (15)gb:AF283816_17830742e-44Pinus taeda calreticulin mRNA, complete cds.
JMFF018P09Sequence604001222 (24)sp|Q40401|CRTC_NICPL2e-95Calreticulin precursor.>pir|T16968|T16968 calreticulin cal1 - curled-leaved toba803010844 (15)gb:AF283816_17830744e-71Pinus taeda calreticulin mRNA, complete cds.
JMFF025M14Sequence552001222 (24)sp|Q40401|CRTC_NICPL1e-76Calreticulin precursor.>pir|T16968|T16968 calreticulin cal1 - curled-leaved toba750010844 (15)gb:AF283816_17830749e-43Pinus taeda calreticulin mRNA, complete cds.
JMFF032K02Sequence624001470 (2)sp|Q40401|CRTC_NICPL1e-92Calreticulin precursor.>pir|T16968|T16968 calreticulin cal1 - curled-leaved toba683001222 (24)sp|P93508|CRTC_RICCO5e-45Calreticulin precursor.>pir|T10172|T10172 calreticulin - castor bean>gb:RCU74630
JMFF039F02Sequence541001222 (24)sp|P93508|CRTC_RICCO1e-89Calreticulin precursor.>pir|T10172|T10172 calreticulin - castor bean>gb:RCU74630755001222 (24)sp|P93508|CRTC_RICCO1e-51Calreticulin precursor.>pir|T10172|T10172 calreticulin - castor bean>gb:RCU74630
JMFF042K19Sequence652001222 (24)sp|Q40401|CRTC_NICPLe-104Calreticulin precursor.>pir|T16968|T16968 calreticulin cal1 - curled-leaved toba596010844 (15)gb:AF283816_17830742e-31Pinus taeda calreticulin mRNA, complete cds.
JMFF043D02Sequence634001222 (24)sp|Q40401|CRTC_NICPLe-100Calreticulin precursor.>pir|T16968|T16968 calreticulin cal1 - curled-leaved toba621010844 (15)gb:AF283816_17830743e-28Pinus taeda calreticulin mRNA, complete cds.
JMFF048M08Sequence442001222 (24)sp|Q40401|CRTC_NICPL8e-64Calreticulin precursor.>pir|T16968|T16968 calreticulin cal1 - curled-leaved toba324010844 (15)
JMFS001F11Sequence455001222 (24)sp|Q40401|CRTC_NICPL1e-83Calreticulin precursor.>pir|T16968|T16968 calreticulin cal1 - curled-leaved toba
JMFS015A04Sequence480001222 (24)sp|Q40401|CRTC_NICPL5e-89Calreticulin precursor.>pir|T16968|T16968 calreticulin cal1 - curled-leaved toba
JMFS079H12Sequence623001222 (24)sp|Q40401|CRTC_NICPLe-103Calreticulin precursor.>pir|T16968|T16968 calreticulin cal1 - curled-leaved toba
JMFS080G03Sequence616001222 (24)sp|Q40401|CRTC_NICPLe-101Calreticulin precursor.>pir|T16968|T16968 calreticulin cal1 - curled-leaved toba
JMFS087A08Sequence625001222 (24)sp|Q40401|CRTC_NICPLe-107Calreticulin precursor.>pir|T16968|T16968 calreticulin cal1 - curled-leaved toba
JMFS146E09Sequence618001222 (24)sp|Q40401|CRTC_NICPLe-103Calreticulin precursor.>pir|T16968|T16968 calreticulin cal1 - curled-leaved toba
JMSF001E10Sequence485001222 (24)sp|Q40401|CRTC_NICPL8e-74Calreticulin precursor.>pir|T16968|T16968 calreticulin cal1 - curled-leaved toba712010844 (15)gb:AF283816_17830742e-29Pinus taeda calreticulin mRNA, complete cds.
JMSF004H02Sequence397001222 (24)sp|Q40401|CRTC_NICPL3e-52Calreticulin precursor.>pir|T16968|T16968 calreticulin cal1 - curled-leaved toba197010844 (15)
JMSF010K17Sequence404001222 (24)sp|Q40401|CRTC_NICPL2e-56Calreticulin precursor.>pir|T16968|T16968 calreticulin cal1 - curled-leaved toba759010844 (15)gb:AF283816_17830742e-65Pinus taeda calreticulin mRNA, complete cds.
JMSF022O01Sequence656001222 (24)sp|Q40401|CRTC_NICPLe-105Calreticulin precursor.>pir|T16968|T16968 calreticulin cal1 - curled-leaved toba748010844 (15)gb:AF283816_17830741e-63Pinus taeda calreticulin mRNA, complete cds.
JMSF044B16Sequence731001222 (24)sp|Q40401|CRTC_NICPLe-119Calreticulin precursor.>pir|T16968|T16968 calreticulin cal1 - curled-leaved toba735010844 (15)gb:AF283816_17830745e-55Pinus taeda calreticulin mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF032K02- TAAACCATGAGCATAAAAAAAAATTCCCA
rJMFF039F02- ATAAACCATGAGAATAAAAAAAAATTCCCA
                      ____________________________________________________________
consensus ATAAACCATGAGCATAAAAAAAAATTCCCA
 
. : . : . : . : . : . :
rJMFF032K02- GGCAGCTTCACGAAATATTTAACAGAGAATTCTGTAACTCTAGCCCACATTATAAACCAC
rJMFF039F02- GACAGCTTCACGAAATATTTAACAGAGAATTCTGTAACTCTAGCCCACATTATAAACCAC
                      ____________________________________________________________
consensus GGCAGCTTCACGAAATATTTAACAGAGAATTCTGTAACTCTAGCCCACATTATAAACCAC
 
. : . : . : . : . : . :
rJMFF032K02- AGCCTTCATGCAGCCTCAAAATGTCTAAAACTGAAGCTACCGTAAAAAAATCTAAAGTAG
rJMFF039F02- AGCCTTCATGCAGCCTCAAAATGTCTAAAACTGAAGCTACCGTAAAAAAATCTAAAGTAG
                      ____________________________________________________________
consensus AGCCTTCATGCAGCCTCAAAATGTCTAAAACTGAAGCTACCGTAAAAAAATCTAAAGTAG
 
. : . : . : . : . : . :
rJMFF032K02- AAATTTATAAGTGCAACTGCCGAAGAGTGTGAAGGAAGCTCATTGTTTTGTGATTACATC
rJMFF039F02- AAATTTATAAGTGCAACTGCCGAAGAGTGTGAAGGAAGCTCATTGTTTTGTGATTACATC
                      ____________________________________________________________
consensus AAATTTATAAGTGCAACTGCCGAAGAGTGTGAAGGAAGCTCATTGTTTTGTGATTACATC
 
. : . : . : . : . : . :
rJMFF032K02- AACCTTGGCGATCAGAGCTCATCATGTACATCTTTGGAATCTGATTTTGCATCGGCATCA
rJMFF039F02- AACCTTGGCGATCAGAGCTCATCATGTACATCTTTGGAATCTGATTTTGCATCGGCATCA
                      ____________________________________________________________
consensus AACCTTGGCGATCAGAGCTCATCATGTACATCTTTGGAATCTGATTTTGCATCGGCATCA
 
. : . : . : . : . : . :
rJMFF032K02- TCATCTTCATCATCATCTTCATCCTCAGCATCAGAATCAACTTGATCATCCTTGGATTCC
rJMFF039F02- TCATCTTCATCATCATCTTCATCCTCAGCATCAGAATCAACTTGATCATCCTTGGATTCC
                      ____________________________________________________________
consensus TCATCTTCATCATCATCTTCATCCTCAGCATCAGAATCAACTTGATCATCCTTGGATTCC
 
. : . : . : . : . : . :
rJMFF032K02- TCATTGATACTCTTCTTTTCTGCCTCATCAAATGCAGCCTTCTCAGCATCCTTATTCTTG
rJMFF039F02- TCATTGATACTCTTCTTTTCTGCCTCATCAAATGCAGCCTTCTCAGCATCCTTATTCTTG
                      ____________________________________________________________
consensus TCATTGATACTCTTCTTTTCTGCCTCATCAAATGCAGCCTTCTCAGCATCCTTATTCTTG
 
. : . : . : . : . : . :
rJMFF032K02- CTCCATGTCTCTTCAACCAGCTTCTTTGCATACTCAGGATCATCACATACCAAAACATTG
rJMFF039F02- CTCCATGTCTCTTCAACCAGCTTCTTTGCATACTCAGGATCATCACATACCAAAACATTG
JMFF039F02+ GGATCATCACATACCAAAACATTG
                      ____________________________________________________________
consensus CTCCATGTCTCTTCAACCAGCTTCTTTGCATACTCAGGATCATCACATACCAAAACATTG
 
. : . : . : . : . : . :
rJMFF032K02- TCAAACAAAGTTCCAGATTTCACCTGCCACAATTCAATGCCCACATACTTCAAATTTGGG
rJMFF039F02- TCAAACAAAGTTCCAGATTTCACCTGCCACAATTCAATGCCCACATACTTCAAATTTGGG
JMFF039F02+ TCAAACAAAGTTCCAGATTTCACCTGCCACAATTCAATGCCCACATACTTCAAATTTGGG
                      ____________________________________________________________
consensus TCAAACAAAGTTCCAGATTTCACCTGCCACAATTCAATGCCCACATACTTCAAATTTGGG
 
. : . : . : . : . : . :
rJMFF032K02- AAAACATAGAGATCTGGGTCATCTTTGAAGTCTGGGTTATTAATCATAGGTGCCTTCCAC
rJMFF039F02- AAAACATAGAGATCTGGGTCATCTTTGAAGTCTGGGTTATTAATCATAGGTGCCTTCCAC
JMFF039F02+ AAAACATAGAGATCTGGGTCATCTTTGAAGTCTGGGTTATTAATCATAGGTGCCTTCCAC
                      ____________________________________________________________
consensus AAAACATAGAGATCTGGGTCATCTTTGAAGTCTGGGTTATTAATCATAGGTGCCTTCCAC
 
. : . : . : . : . : . :
rJMFF032K02- TTTCCCTTGTAGTTGGGGTTCTTAATTTGCTTTGGCGTCCACGGGCCCTTGTACTCAGGG
rJMFF039F02- TTTCCCTTGTAGTTGGGGTTCTTAATTTGCTTTGGCGTCCACGGGCCCTTGTACTCAGGG
JMFF039F02+ TTTCCCTTGTAGTTGGGGTTCTTAATTTGCTTTGGCGTCCACGGGCCCTTGTACTCAGGG
                      ____________________________________________________________
consensus TTTCCCTTGTAGTTGGGGTTCTTAATTTGCTTTGGCGTCCACGGGCCCTTGTACTCAGGG
 
. : . : . : . : . : . :
rJMFF032K02- TTAGCAATGGTTGGGGCAGTCCACTCACCATCCTCCTCATCATCCCAGTCCTCA
rJMFF039F02- TTAGCAATGGTTGGGGCAGTCCACTCACCATCCTCCTCATCATCCCAGTCCTCAGGCTTC
JMFF039F02+ TTAGCAATGGTTGGGGCAGTCCACTCACCATCCTCCTCATCATCCCAGTCCTCAGGCTTC
                      ____________________________________________________________
consensus TTAGCAATGGTTGGGGCAGTCCACTCACCATCCTCCTCATCATCCCAGTCCTCAGGCTTC
 
. : . : . : . : . : . :
rJMFF039F02- TTAGCATCAGAATCTGGAATTTTCCTTGGGGGATGTCATCATACCCCCTCTGGCTTCTTA
JMFF039F02+ TTAGCATCAGAATCTGGAA-TTTCCTT-GGGGATGTCATCATA-CCCCTCTGGCTTCTTA
                      ____________________________________________________________
consensus TTAGCATCAGAATCTGGAATTTTCCTTGGGGGATGTCATCATACCCCCTCTGGCTTCTTA
 
. : . : . : . : . : . :
rJMFF039F02- TCTTC
JMFF039F02+ TCTTCAGGGTCATCTAAATATTCATTCTCATCCCAATCTGCAGGTTTCTTGGCTTCTGGA
JMFS087A08+ TGGCTTCAGGA
JMSF044B16+ TCATCCCAATCTTCAGGTTTCTTGGCTTCAGGA
                      ____________________________________________________________
consensus TCTTCAGGGTCATCTAAATATTCATTCTCATCCCAATCTTCAGGTTTCTTGGCTTCAGGA
 
. : . : . : . : . : . :
JMFF039F02+ TCCTTAATTTTCTTTGGTGGGAGCAGACTCCAATCCTTGTACAAGCTACCTGTCTGCTTC
JMFS087A08+ TCCTTAATTTTCTTGGTGGGAAGCAGATTCCAATCAGTGTATAAGCTACCAGACTGCTTC
JMSF044B16+ TCCTTAATTTTCTTTGGTGGAAGCAGATTCCAATCAGTGTATAAGCTACCAGACTGCTTC
JMFF042K19+ GAAGCAGATTCCAATCAGTGTATAAGCTACCAGACTGCTTC
JMFF043D02+ GTATAAGCTACCAGACTGCTTC
JMFS146E09+ GAAGCAGATTCCAATCAGTGTATAAGCTACCAGACTGCTTC
JMFS079H12+ GAAGCAGATTCCAATCAGTGTATAAGCTACCAGACTGCTTC
JMFS080G03+ GTATAAGCTACCAGACTGCTTC
JMSF022O01+ GAAGCAGATTCCAATCAGTGTATAAGCTACCAGACTGCTTC
                      ____________________________________________________________
consensus TCCTTAATTTTCTTTGGTGGAAGCAGATTCCAATCAGTGTATAAGCTACCAGACTGCTTC
 
. : . : . : . : . : . :
JMFF039F02+ TCCACATTGTCAATGAGAATACTATATGTAGCATCGGGGCGGAGGATGAAGGTATAGACA
JMFS087A08+ TCCTCATTGTCAATGAGAATACTATATGTAGCATCAGGGCGGAGAATGAAGGTATAGACA
JMSF044B16+ TCCTCATTGTCAATGAGAATACTATATGTAGCATCAGGGCGGAGAATGAAGGTATAGACA
JMFS015A04+ TCATTGTCAATGAGAATACTATATGTAGCATCAGGGCGGAGAATGAAGGTATAGACA
JMFF042K19+ TCCTCATTGTCAATGAGAATACTATATGTAGCATCAGGGCGGAGAATGAAGGTATAGACA
JMFF043D02+ TCCTCATTGTCAATGAGAATACTATATGTAGCATCAGGGCGGAGAATGAAGGTATAGACA
JMFS146E09+ TCCTCATTGTCAATGAGAATACTATATGTAGCATCAGGGCGGAGAATGAAGGTATAGACA
JMFS079H12+ TCCTCATTGTCAATGAGAATACTATATGTAGCATCAGGGCGGAGAATGAAGGTATAGACA
JMFS080G03+ TCCTCATTGTCAATGAGAATACTATATGTAGCATCAGGGCGGAGAATGAAGGTATAGACA
JMFF015O07+ ATTGTCAATGAGAATACTATATGTAGCATCAGGGCGGAGAATGAAGGTATAGACA
JMFF015J08+ TTGTCAATGAGAATACTATATGTAGCATCAGGGCGGAGAATGAAGGTATAGACA
JMFF018P09+ GTCAATGAGAATACTATATGTAGCATCAGGGCGGAGAATGAAGGTATAGACA
JMFS001F11+ ATGAGAATACTATATGTAGCATCAGGGCGNAGAATGAAGGTATAGACA
JMFF007C05+ TGTCAATGAGAATACTATATGTAGCATCAGGGCGGAGAATGAAGGTATAGACA
JMSF022O01+ TCCTCATTGTCAATGAGAATACTATATGTAGCATCAGGGCGGAGAATGAAGGTATAGACA
                      ____________________________________________________________
consensus TCCTCATTGTCAATGAGAATACTATATGTAGCATCAGGGCGGAGAATGAAGGTATAGACA
 
. : . : . : . : . : . :
JMFF039F02+ TGAGTCAGTTGGTCAGTCTCACATGGGACATC
JMFS087A08+ TGGGTTAGCTGGTCAGTCTCACATGGAACATCCTTCTTGATCAATTGGTTTGTCCCATTA
JMSF044B16+ TGGGTTAGCTGGTCAGTCTCACATGGAACATCCTTCTTGATCAATTGGTTTGTCCCATTA
JMFS015A04+ TGGGTTAGCTGGTCAGTCTCACATGGAACATCCTTCTTGATCAATTGGTTTGTCCCATTA
JMFF042K19+ TGGGTTAGCTGGTCAGTCTCACATGGAACATCCTTCTTGATCAATTGGTTTGTCCCATTA
JMFF043D02+ TGGGTTAGCTGGTCAGTCTCACATGGAACATCCTTCTTGATCAATTGGTTTGTCCCATCA
JMFS146E09+ TGGGTTAGCTGGTCAGTCTCACATGGAACATCCTTCTTGATCAATTGGTTTGTCCCATTA
JMFS079H12+ TGGGTTAGCTGGTCAGTCTCACATGGAACATCCTTCTTGATCAATTGGTTTGTCCCATTA
JMFS080G03+ TGGGTTAGCTGGTCAGTCTCACATGGAACATCCTTCTTGATCAATTGGTTTGTCCCATTA
JMFF015O07+ TGGGTTAGCTGGTCAGTCTCACATGGAACATCCTTCTTGATCAATTGGTTTGTCCCATTA
JMFF015J08+ TGGGTTAGCTGGTCAGTCTCACATGGAACATCCTTCTTGATCAATTGGTTTGTCCCATTA
JMFF018P09+ TGGGTTAGCTGGTCAGTCTCACATGGAACATCCTTCTTGATCAATTGGTTTGTCCCATTA
JMFF011H11+ TTGATCAATTGGTTTGTCCCATTA
JMFF006K13+ TCCCATTA
JMFS001F11+ TGGGTTAGCTGGTCAGTCTCACATGGAACATCCTTCTTGATCAATTGGTTTGTCCCATTA
JMFF007C05+ TGGGTTAGCTGGTCAGTCTCACATGGAACATCCTTCTTGATCAATTGGTTTGTCCCATTA
JMSF022O01+ TGGGTTAGCTGGTCAGTCTCACATGGAACATCCTTCTTGATCAATTGGTTTGTCCCATTA
JMFF025M14+ TTTGTCCCATTA
                      ____________________________________________________________
consensus TGGGTTAGCTGGTCAGTCTCACATGGAACATCCTTCTTGATCAATTGGTTTGTCCCATTA
 
. : . : . : . : . : . :
JMFS087A08+ TAGGTAAGAATAGCATGGACTTTTTTGGTGCTGTAGCCACAGATGTCTGGTCCAAACATG
JMSF044B16+ TAGGTAAGAATAGCATGGACTTTTTTGGTGCTGTAGCCACAGATGTCTGGTCCAAACATG
JMFS015A04+ TAGGTAAGAATAGCATGGACTTTTTTGGTGCTGTAGCCACAGATGTCTGGTCCAAACATG
JMFF042K19+ TAGGTAAGAATAGCATGGACTTTTTTGGTGCTGTAGCCACAGATGTCTGGTCCAAACATG
JMFF043D02+ TAGGTAAGAATAGCATGGACTTTTTTGGTGCTGTAGCCACAGATGTCTGGTCCAAACATG
JMFS146E09+ TAGGTAAGAATAGCATGGACTTTTTTGGTGCTGTAGCCACAGATGTCTGGTCCAAACATG
JMFS079H12+ TAGGTAAGAATAGCATGGACTTTTTTGGTGCTGTAGCCACAGATGTCTGGTCCAAACATG
JMFS080G03+ TAGGTAAGAATAGCATGGACTTTTTTGGTGCTGTAGCCACAGATGTCTGGTCCAAACATG
JMFF015O07+ TAGGTAAGAATAGCATGGACTTTTTTGGTGCTGTAGCCACAGATGTCTGGTCCAAACATG
JMFF015J08+ TAGGTAAGAATAGCATGGACTTTTTTGGTGCTGTAGCCACAGATGTCTGGTCCAAACATG
JMFF018P09+ TAGGTAAGAATAGCATGGACTTTTTTGGTGCTGTAGCCACAGATGTCTGGTCCAAACATG
JMFF011H11+ TAGGTAAGAATAGCATGGACTTTTTTGGTGCTGTAGCCACAGATGTCTGGTCCAAACATG
JMFF006K13+ TAGGTAAGAATAGCATGGACTTTTTTGGTGCTGTAGCCACAGATGTCTGGTCCAAACATG
JMFS001F11+ TAGGTAAGAATAGCATGGACTTTTTTGGTGCTGTAGCCACAGATGTCTGGTCCAAACATG
JMFF048M08+ TCCAAACATG
JMFF007C05+ TAGGTAAGAATAGCATGGACTTTTTTGGTGCTGTAGCCACAGATGTCTGGTCCAAACATG
JMSF022O01+ TAGGTAAGAATAGCATGGACTTTTTTGGTGCTGTAGCCACAGATGTCTGGTCCAAACATG
JMSF001E10+ AATAGCATGGACTTTTTTGGTGCTGTAGCCACAGATGTCTGGTCCAAACATG
JMFF025M14+ TAGGTAAGAATAGCATGGACTTTTTTGGTGCTGTAGCCACAGATGTCTGGTCCAAACATG
                      ____________________________________________________________
consensus TAGGTAAGAATAGCATGGACTTTTTTGGTGCTGTAGCCACAGATGTCTGGTCCAAACATG
 
. : . : . : . : . : . :
JMFS087A08+ ATACTGTAAGGGGTGTCACCGCCAAATTTCTTTTGATCAATGTCACCACTAAGCAGTTTC
JMSF044B16+ ATACTGTAAGGGGTGTCACCGCCAAATTTCTTTTGATCAATGTCACCACTAAGCAGTTTC
JMFS015A04+ ATACTGTAAGGGGTGTCACCGCCAAATTTCTTTTGATCAATGTCACCACTAAGCAGTTTC
JMFF042K19+ ATACTGTAAGGGGTGTCACCGCCAAATTTCTTTTGATCAATGTCACCACTAAGCAGTTTC
JMFF043D02+ ATACTGTAAGGGGTGTCACCGCCAAATTTCTTTTGATCAATGTCACCACTAAGCAGTTCC
JMFS146E09+ ATACTGTAAGGGGTGTCACCGCCAAATTTCTTTTGATCAATGTCACCACTAAGCAGTTTC
JMFS079H12+ ATACTGTAAGGGGTGTCACCGCCAAATTTCTTTTGATCAATGTCACCACTAAGCAGTTTC
JMFS080G03+ ATACTGTAAGGGGTGTCACCGCCAAATTTCTTTTGATCAATGTCACCACTAAGCAGTTTC
JMFF015O07+ ATACTGTAAGGGGTGTCACCGCCAAATTTCTTTTGATCAATGTCACCACTAAGCAGTTTC
JMFF015J08+ ATACTGTAAGGGGTGTCACCGCCAAATTTCTTTTGATCAATGTCACCACTAAGCAGTTTC
JMFF018P09+ ATACTGTAAGGGGTGTCACCGCCAAATTTCTTTTGATCAATGTCACCACTAAGCAGTTTC
JMFF011H11+ ATACTGTAAGGGGTGTCACCGCCAAATTTCTTTTGATCAATGTCACCACTAAGCAGTTTC
JMSF004H02+ CTAAGCAGTTTC
JMFF006K13+ ATACTGTAAGGGGTGTCACCGCCAAATTTCTTTTGATCAATGTCACCACTAAGCAGTTTC
JMFS001F11+ ATACTGTAAGGGGTGTCACCGCCAAATTTCTTTTGATCAATGTCACCACTAAGCAGTTTC
JMFF048M08+ ATACTGTAAGGGGTGTCAACGCCAAATTTCTTTTGATCAATGTCACCACTAAGCAGTTTC
JMFF007C05+ ATACTGTAAGGGGTGTCACCGCCAAATTTCTTTTGATCAATGTCACCACTAAGCAGTTTC
JMSF022O01+ ATACTGTAAGGGGTGTCACCGCCAAATTTCTTTTGATCAATGTCACCACTAAGCAGTTTC
JMSF010K17+ CTTTTGATCAATGTCACCACTAAGCAGTTTC
JMSF001E10+ ATACTGTAAGGGGTGTCACCGCCAAATTTCTTTTGATCAATGTCACCACTAAGCAGTTTC
JMFF025M14+ ATACTGTAAGGGGTGTCACCGCCAAATTTCTTTTGATCAATGTCACCACTAAGCAGTTTC
                      ____________________________________________________________
consensus ATACTGTAAGGGGTGTCACCGCCAAATTTCTTTTGATCAATGTCACCACTAAGCAGTTTC
 
. : . : . : . : . : . :
JMFS087A08+ ATGTATCCACCACCACAGTCAAGCTTTTGCTCATGCTTAACTGAAAATTGGAAAACTAGG
JMSF044B16+ ATGTATCCACCACCACAGTCAAGCTTTTGCTCATGCTTAACTGAAAATTGGAAAACTAGG
JMFS015A04+ ATGTATCCACCACCACAGTCAAGCTTTTGCTCATGCTTAACTGAAAATTGGAAAACTAGG
JMFF042K19+ ATGTATCCACCACCACAGTCAAGCTTTTGCTCATGCTTAACTGAAAATTGGAAAACTAGG
JMFF043D02+ ATGTATCCACCACCACAGTCAAGCTTTTGCTCATGCTTAACTGAAAATTGGAAAACTAGG
JMFS146E09+ ATGTATCCACCACCACAGTCAAGCTTTTGCTCATGCTTAACTGAAAATTGGAAAACTAGG
JMFS079H12+ ATGTATCCACCACCACAGTCAAGCTTTTGCTCATGCTTAACTGAAAATTGGAAAACTAGG
JMFS080G03+ ATGTATCCACCACCACAGTCAAGCTTTTGCTCATGCTTAACTGAAAATTGGAAAACTAGG
JMFF015O07+ ATGTATCCACCACCACAGTCAAGCTTTTGCTCATGCTTAACTGAAAATTGGAAAACTAGG
JMFF015J08+ ATGTATCCACCACCACAGTCAAGCTTTTGCTCATGCTTAACTGAAAATTGGAAAACTAGG
JMFF018P09+ ATGTATCCACCACCACAGTCAAGCTTTTGCTCATGCTTAACTGAAAATTGGAAAACTGGG
JMFF011H11+ ATGTATCCACCACCACAGTCAAGCTTTTGCTCATGCTTAACTGAAAATTGGAAAACTAGG
JMSF004H02+ ATGTATCCACCACCACAGTCAAGCTTTTGCTCATGCTTAACTGAAAATTGGAAAACTAGG
JMFF006K13+ ATGTATCCACCACCACAGTCAAGCTTTTGCTCATGCTTAACTGAAAATTGGAAAACTAGG
JMFS001F11+ ATGTATCCACCACCACAGTCAAGCTTTTGCTCATGCTTAACTGAAAATTGGAAAACTAGG
JMFF048M08+ ATGTATCCACCACCACAGTCAAGCTTTTGCTCATGCTTAACTGAAAATTGGAAAACTAGG
JMFF007C05+ ATGTATCCACCACCACAGTCAAGCTTTTGCTCATGCTTAACTGAAAATTGGAAAACTAGG
JMSF022O01+ ATGTATCCACCACCACAGTCAAGCTTTTGCTCATGCTTAACTGAAAATTGGAAAACTAGG
JMSF010K17+ ATGTATCCACCACCACAGTCAAGCTTTTGCTCATGCTTAACTGAAAATTGGAAAACTAGG
JMSF001E10+ ATGTATCCACCACCACAGTCAAGCTTTTGCTCATGCTTAACTGAAAATTGGAAAACTAGG
JMFF025M14+ ATGTATCCACCACCACAGTCAAGCTTTTGCTCATGCTTAACTGAAAATTGGAAAACTAGG
                      ____________________________________________________________
consensus ATGTATCCACCACCACAGTCAAGCTTTTGCTCATGCTTAACTGAAAATTGGAAAACTAGG
 
. : . : . : . : . : . :
JMFS087A08+ GTCTTGCCCTTGTTATTAAACTCCGGGAACTCAGCTGAGATGGCATAGAACCTGTAGTCT
JMSF044B16+ GTCTTGCCCTTGTTATTAAACTCCGGGAACTCAGCTGAGATGGCATAGAACCTGTAGTCT
JMFS015A04+ GTCTTGCCCTTGTTATTAAACTCCGGGAACTCAGCTGAGATGGCATAGAACCTGTAGTCT
JMFF042K19+ GTCTTGCCCTTGTTATTAAACTCCGGGAACTCAGCTGAGATGGCATAGAACCTGTAGTCT
JMFF043D02+ GTCTTGCCCTTGTTATTAAACTCCGGGAACTCAGCTGAGATGGCATAGAACCTGTAGTCT
JMFS146E09+ GTCTTGCCCTTGTTATTAAACTCCGGGAACTCAGCTGAGATGGCATAGAACCTGTAGTCT
JMFS079H12+ GTCTTGCCCTTGTTATTAAACTCCGGGAACTCAGCTGAGATGGCATAGAACCTGTAGTCT
JMFS080G03+ GTCTTGCCCTTGTTATTAAACTCCGGGAACTCAGCTGAGATGGCATAGAACCTGTAGTCT
JMFF015O07+ GTCTTGCCCTTGTTATTAAACTCCGGGAACTCAGCTGAGATGGCATAGAACCTGTAGTCT
JMFF015J08+ GTCTTGCCCTTGTTATTAAACTCCGGGAACTCAGCTGAGATGGCATAGAACCTGTAGTCT
JMFF018P09+ GTCTTGCCCTTGTTATTAAACTCCGGGAACTCAGCTGAGATGGCATAGAACCTGTAGTCT
JMFF011H11+ GTCTTGCCCTTGTTATTAAACTCCGGGAACTCAGCTGAGATGGCATAGAACCTGTAGTCT
JMSF004H02+ GTCTTGCCCTTGTTATTAAACTCCGGGAACTCAGCTGAGATGGCATAGAACCTGTAGTCT
JMFF006K13+ GTCTTGCCCTTGTTATTAAACTCCGGGAACTCAGCTGAGATGGCATAGAACCTGTAGTCT
JMFS001F11+ GTCTTGCCCTTGTTATTAAACTCCGGGAACTCAGCTGAGATGGCATAGAACCTGTAGTCT
JMFF048M08+ GTCTTGCCCTTGTTATTAAACTCCGGGAACTCAGCTGAGATGGCATAGAACCTGTAGTCT
JMFF007C05+ GTCTTGCCCTTGTTATTAAACTCCGGGAACTCAGCTGAGATGGCATAGAACCTGTAGTCT
JMSF022O01+ GTCTTGCCCTTGTTATTAAACTCCGGGAACTCAGCTGAGATGGCATAGAACCTGTAGTCT
JMSF010K17+ GTCTTGCCCTTGTTATTAAACTCCGGGAACTCAGCTGAGATGGCATAGAACCTGTAGTCT
JMSF001E10+ GTCTTGCCCTTGTTATTAAACTCCGGGAACTCAGCTGAGATGGCATAGAACCTGTAGTCT
JMFF025M14+ GTCTTGCCCTTGTTATTAAACTCCGGGAACTCAGCTGAGATGGCATAGAACCTGTAGTCT
                      ____________________________________________________________
consensus GTCTTGCCCTTGTTATTAAACTCCGGGAACTCAGCTGAGATGGCATAGAACCTGTAGTCT
 
. : . : . : . : . : . :
JMFS087A08+ TCACTGGTCTGAATACCTTTGTCGTTAGGGTCTCCATTCCATTTACCAGAGGTGTAGTTC
JMSF044B16+ TCACTGGTCTGAATACCTTTGTCGTTAGGGTCTCCATTCCATTTACCAGAGGTGTAGTTC
JMFS015A04+ TCACTGGTCTGAATACCTTTGTCGTTAGGGTCTCCATTCCATTTACCAGAGGTGTAGTTC
JMFF042K19+ TCACTGGTCTGAATACCTTTGTCGTTAGGGTCTCCATTCCATTTACCAGAGGTGTAGTTC
JMFF043D02+ TCACTGGTCTGAATACCTTTGTCGTTAGGGTCTCCATTCCATTTACCAGAGGTGTAGTTC
JMFS146E09+ TCACTGGTCTGAATACCTTTGTCGTTAGGGTCTCCATTCCATTTACCAGAGGTGTAGTTC
JMFS079H12+ TCACTGGTCTGAATACCTTTGTCGTTAGGGTCTCCATTCCATTTACCAGAGGTGTAGTTC
JMFS080G03+ TCACTGGTCTGAATACCTTTGTCGTTAGGGTCTCCATTCCATTTACCAGAGGTGTAGTTC
JMFF015O07+ TCACTGGTCTGAATACCTTTGTCGTTAGGGTCTCCATTCCATTTACCAGAGGTGTAGTTC
JMFF015J08+ TCACTGGTCTGAATACCTTTGTCGTTAGGGTCTCCATTCCATTTACCAGAGGTGTAGTTC
JMFF018P09+ TCACTGGTCTGAATACCTTTGTCGTTAGGGTCTCCATTCCATTTACCAGAGGTGTAGTTC
JMFF011H11+ TCACTGGTCTGAATACCTTTGTCGTTAGGGTCTCCATTCCATTTACCAGAGGTGTAGTTC
JMSF004H02+ TCACTGGTCTGAATACCTTTGTCGTTAGGGTCTCCATTCCATTTACCAGAGGTGTAGTTC
JMFF006K13+ TCACTGGTCTGAATACCTTTGTCGTTAGGGTCTCCATTCCATTTACCAGAGGTGTAGTTC
JMFS001F11+ TCACTGGTCTGAATACCTTTGTCGTTAGGGTCTCCATTCCATTTACCAGAGGTGTAGTTC
JMFF048M08+ TCACTGGTCTGAATACCTTTGTCGTTAGGGTCTCCATTCCATTTACCAGAGGTGTAGTTC
JMFF007C05+ TCACTGGTCTGAATACCTTTGTCGTTAGGGTCTCCATTCCATTTACCAGAGGTGTAGTTC
JMSF022O01+ TCACTGGTCTGAATACCTTTGTCGTTAGGGTCTCCATTCCATTTACCAGAGGTGTAGTTC
JMSF010K17+ TCACTGGTCTGAATACCTTTGTCGTTAGGGTCTCCATTCCATTTACCAGAGGTGTAGTTC
JMSF001E10+ TCACTGGTCTGAATACCTTTGTCGTTAGGGTCTCCATTCCATTTACCAGAGGTGTAGTTC
JMFF025M14+ TCACTGGTCTGAATACCTTTGTCGTTAGGGTCTCCATTCCATTTACCAGAGGTGTAGTTC
                      ____________________________________________________________
consensus TCACTGGTCTGAATACCTTTGTCGTTAGGGTCTCCATTCCATTTACCAGAGGTGTAGTTC
 
. : . : . : . : . : . :
JMFS087A08+ CACTCCCCAGCCATATTCTCATCCTTCTTCCAGTCAGACTTGACCCATCTACTCTCCCAC
JMSF044B16+ CACTCCCCAGCCATATTCTCATCCTTCTTCCAGTCAGACTTGACCCATCTACTCTCCCAC
JMFS015A04+ CACTCCCCAGCCATATTCTCATCCTTCTTCCAGTCAGACTTGACCCATCTACTCTCCCAC
JMFF042K19+ CACTCCCCAGCCATATTCTCATCCTTCTTCCAGTCAGACTTGACCCATCTACTCTCCCAC
JMFF043D02+ CACTCCCCAGCCATATTCTCATCCTTCTTCCAGTCAGACTTGACCCATCTACTCTCCCAC
JMFS146E09+ CACTCCCCAGCCATATTCTCATCCTTCTTCCAGTCAGACTTGACCCATCTACTCTCCCAC
JMFS079H12+ CACTCCCCAGCCATATTCTCATCCTTCTTCCAGTCAGACTTGACCCATCTACTCTCCCAC
JMFS080G03+ CACTCCCCAGCCATATTCTCATCCTTCTTCCAGTCAGACTTGACCCATCTACTCTCCCAC
JMFF015O07+ CACTCCCCAGCCATATTCTCATCCTTCTTCCAGTCAGACTTGACCCATCTACTCTCCCAC
JMFF015J08+ CACTCCCCAGCCATATTCTCATCCTTCTTCCAGTCAGACTTGACCCATCTACTCTCCCAC
JMFF018P09+ CACTCCCCAGCCATATTCTCATCCTTCTTCCAGTCAGACTTGACCCATCTACTCTCCCAC
JMFF011H11+ CACTCCCCAGCCATATTCTCATCCTTCTTCCAGTCAGACTTGACCCATCTACTCTCCCAC
JMSF004H02+ CACTCCCCAGCCATATTCTCATCCTTCTTCCAGTCAGACTTGACCCATCTACTCTCCCAC
JMFF006K13+ CACTCCCCAGCCATATTCTCATCCTTCTTCCAGTCAGACTTGACCCATCTACTCTCCCAC
JMFS001F11+ CACTCCCCAGCCATATTCTCATCCTTCTTCCAGTCAGACTTGACCCA
JMFF048M08+ CACTCCCCAGCCATATTCTCATCCTTCTTCCAGTCAGACTTGACCCATCTACTCTCCCAC
JMFF007C05+ CACTCCCCAGCCATATTCTCATCCTTCTTCCAGTCAGACTTGACCCATCTACTCTCCCAC
JMSF022O01+ CACTCCCCAGCCATATTCTCATCCTTCTTCCAGTCAGACTTGACCCATCTACTCTCCCAC
JMSF010K17+ CACTCCCCAGCCATATTCTCATCCTTCTTCCAGTCAGACTTGACCCATCTACTCTCCCAC
JMSF001E10+ CACTCCCCAGCCATATTCTCATCCTTCTTCCAGTCAGACTTGACCCATCTACTCTCCCAC
JMFF025M14+ CACTCCCCAGCCATATTCTCATCCTTCTTCCAGTCAGACTTGACCCATCTACTCTCCCAC
                      ____________________________________________________________
consensus CACTCCCCAGCCATATTCTCATCCTTCTTCCAGTCAGACTTGACCCATCTACTCTCCCAC
 
. : . : . : . : . : . :
JMFS087A08+ CCATCGTCAAAGCGCTCCTCGAATATGACTCCCGCGGAGACGAAAGCAACAAGGAGATAT
JMSF044B16+ CCATCGTCAAAGCGCTCCTCGAATATGACTCCCGCGGAGACGAAAGCAACAAGGAGATAT
JMFS015A04+ CCA
JMFF042K19+ CCATCGTCAAAGCGCTCCTCGAATATGACTCCCGCGGAGACGAAAGCAACAAGGAGATAT
JMFF043D02+ CCATCGTCAAAGCGCTCCTCGAATATGACTCCCGCGGAGACGAAAGCAACAAGGAGATAT
JMFS146E09+ CCATCGTCAAAGCGCTCCTCGAATATGACTCCCGCGGAGACGAAAGCAACAAGGAGATAT
JMFS079H12+ CCATCGTCAAAGCGCTCCTCGAATATGACTCCCGCGGAGACGAAAGCAACAAGGAGATAT
JMFS080G03+ CCATCGTCAAAGCGCTCCTCGAATATGACTCCCGCGGAGACGAAAGCAACAAGGAGATAT
JMFF015O07+ CCATCGTCAAAGCGCTCCTCGAATATGACTCCCGCGGAGACGAAAGCAACAAGGAGATAT
JMFF015J08+ CCATCGTCAAAGCGCTCCTCGAATATGACTCCCGCGGAGACGAAAGCAACAAGGAGATAT
JMFF018P09+ CCATCGTCAAAGCGCTCCTCGAATATGACTCCCGCGGAGACGAAAGCAACAAGGAGATAT
JMFF011H11+ CCATCGTCAAAGCGCTCCTCGAATATGACTCCCGCGGAGACGAAAGCAACAAGGAGATAT
JMSF004H02+ CCATCGTCAAAGCGCTCCTCGAATATGACTCCCGCGGAGACGAAAGCAACAAGGAGATAT
JMFF006K13+ CCATCGTCAAAGCGCTCCTCGAATATGACTCCCGCGGAGACGAAAGCAACAAGGAGATAT
JMFF048M08+ CCATCGTCAAAGCGCTCCTCGAATATGACTCCCGCGGAGACGAAAGCAACAAGGAGATAT
JMFF007C05+ CCATCGTCAAAGCGCTCCTCGAATATGACTCCCGCGGAGACGAAAGCAACAAGGAGATAT
JMSF022O01+ CCATCGTCAAAGCGCTCCTCGAATATGACTCCCGCGGAGACGAAAGCAACAAGGAGATAT
JMSF010K17+ CCATCGTCAAAGCGCTCCTCGAATATGACTCCCGCGGAGACGAAAGCAACAAGGAGATAT
JMSF001E10+ CCATCGTCAAAGCGCTCCTCGAATATGACTCCCGCGGAGACGAAAGCAACAAGGAGATAT
JMFF025M14+ CCATCGTCAAAGCGCTCCTCGAATATGACTCCCGCGGAGACGAAAGCAACAAGGAGATAT
                      ____________________________________________________________
consensus CCATCGTCAAAGCGCTCCTCGAATATGACTCCCGCGGAGACGAAAGCAACAAGGAGATAT
 
. : . : . : . : . : . :
JMFS087A08+ AGCTTGGCTAGAGA
JMSF044B16+ AGCTTGGCTAGAGAGAGAAACACCGAATTTAATCTTCTAAGAGCAGCCATGGCTGAAGAG
JMFF042K19+ AGCTTGGTTAGAGAGAGAAACACCGAATTTAATCTTCTAAGAGCAGCCAT-GCTGAAGAG
JMFF043D02+ AGCTTGGCTAGAGAGAGAAACACCGAATTTAATCTTCTAAGAGCAGCCATGGCTGAAGAG
JMFS146E09+ AGCTTGGCTAGAGAGAGAAACACCGAATTTAATCTTC
JMFS079H12+ AGCTTGGCTAGAGAGAGAAACACCGAATTTAATCTTCTAAGA
JMFS080G03+ AGCTTGGCTAGAGAGAGAAACACCGAATTTAATCTTCTAAGAGCAGCCATGGCT
JMFF015O07+ AGCTTGGCTAGAGAGAGAAACACCGAATTTAATCTTCTAAGAGCAGCCATGGCTGAAGAG
JMFF015J08+ AGCTTGGCTAGAGAGAGAAACACCGAATTTAATCTTCTAAGAGCAGCCATGGCTGAAGAG
JMFF018P09+ AGCTTGGCTAGAGAGAGAAACACCGAATTTAATCTTCTAAGAGCAGCCATGGCTGAAGAG
JMFF011H11+ AGCTTGGCTAGAGAGAGAAACACCGAATTTAATCTTCTAAGAGCAGCCATGGCTGAAGAG
JMSF004H02+ AGCT
JMFF006K13+ AGCTTGGCTAGAGAGAGAAACACCGAATTTAATCTTCTAAGAGCAGCCATGGCTGAAGAG
JMFF048M08+ AGCTTGGCTAGAGAGAGAAACACCGAATTTAATCTTCTAAGAGCAGCCATGGCTGAAGAG
JMFF007C05+ AGCTTGGCTAGAGAGAGAAACACCGAATTTAATCTTCTAAGAGCAGCCATGGCTGAAGAG
JMSF022O01+ AGCTTGGCTAGAGAGAGAAACACCGAATTTAATCTTCTAAGAGCAGCCATGGCTGAAGAG
JMSF010K17+ AGCTTGGCTAGAGAGAGAAACACCGAATTTAATCTTCTAAGAGCAGCCATGGCTGAAGAG
JMSF001E10+ AGCTTGGCTAGAGAGAGAAACACCGAATTTAATCTTCTAAGAGCAGCCATGGCTGAAGAG
JMFF025M14+ AGCTTGGCTAGAGAGAGAAACACCGAATTTAATCTTCTAAGAGCAGCCATGGCTGAAGAG
                      ____________________________________________________________
consensus AGCTTGGCTAGAGAGAGAAACACCGAATTTAATCTTCTAAGAGCAGCCATGGCTGAAGAG
 
. : . : . : . : . : . :
JMSF044B16+ AGAAAATGGACTC
JMFF042K19+ AGAAAATGGACT
JMFF043D02+ AGAAAATGGACT
JMFF015O07+ AGAAAATGGACT
JMFF015J08+ AGAAAATGGACT
JMFF018P09+ AGAAAATGGAC
JMFF011H11+ AGAAAAT
JMFF006K13+ AGAAAATGGA
JMFF048M08+ AGAAAATGGACT
JMFF007C05+ AGAAAATGGACT
JMSF022O01+ AGAAAATGGACTC
JMSF010K17+ AGAAAATGGACTC
JMSF001E10+ AGAAAATGGACTC
JMFF025M14+ AGAAAATGGACTGAATGAAGAACTGAGAGAGACCCTATTTGTATACGCGAAATATACTTT
                      ____________________________________________________________
consensus AGAAAATGGACTCAATGAAGAACTGAGAGAGACCCTATTTGTATACGCGAAATATACTTT