Previous Contig 001219:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF025K22Sequence635001219 (5)gb:AP003626_18316741e-42Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P042786001219 (5)gb:AP003626_18316741e-54Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P042
JMFN025E04Sequence628001219 (5)gb:AP003626_18316743e-56Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P042
JMSF021C05Sequence602001219 (5)gb:AP004184_18386746e-27Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ12548001219 (5)gb:AP004184_18386745e-27Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ12

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF021C05+ TTTTTTTTTTCGGTGTAATGAAAATGAACCTTATA
                      ____________________________________________________________
consensus TTTTTTTTTTCGGTGTAATGAAAATGAACCTTATA
 
. : . : . : . : . : . :
rJMSF021C05- ATGGATCATGGTCCACAGTATAATGATTGTTGCCACCACT
JMSF021C05+ TCAATGATTCACCTTACCAGATGGATCATGGTCCACAGTATAATGATTGTTGCCACCAC-
                      ____________________________________________________________
consensus TCAATGATTCACCTTACCAGATGGATCATGGTCCACAGTATAATGATTGTTGCCACCACT
 
. : . : . : . : . : . :
rJMSF021C05- TAATCTGGCTGGTTGTACCCAGAAAAGCAAAGAATTATATTTCTGTTTTCATATATATAG
JMSF021C05+ TAATCTGGCTGGTTGTACCCAGAAAAGCAAAGAATTATATTTCTGTTTTCATATATATAG
rJMFF025K22- ATTTCTGTTTTC-TATATATAG
                      ____________________________________________________________
consensus TAATCTGGCTGGTTGTACCCAGAAAAGCAAAGAATTATATTTCTGTTTTCATATATATAG
 
. : . : . : . : . : . :
rJMSF021C05- GCATTATAGCAAGAAATGAGAGTGGAGATTTGCAGAAAATGAGGAGAGAAGTTACAGATT
JMSF021C05+ GCATTATAGCAAGAAATGAGAGTGGAGATTTGCAGAAAATGAGGAGAGAAGTTACAGATT
rJMFF025K22- GCATTATAGCAAGAAATGAGAGTGGAGATTTGCAGAAAATGAGGAGAGAAGTTACAGATT
                      ____________________________________________________________
consensus GCATTATAGCAAGAAATGAGAGTGGAGATTTGCAGAAAATGAGGAGAGAAGTTACAGATT
 
. : . : . : . : . : . :
rJMSF021C05- CCAGAGCAGCACAAATAATGACATTACACACAGGAGATAGATAGAGTTTAGGAATTCACA
JMSF021C05+ CCAGAGCAGCACAAATAATGACATTACACACAGGAGATAGATAGAGTTTAGGAATTCACA
rJMFF025K22- CCAGAGCAGCACAAATAATGACATTACACACAGGAGATAGATAGAGTTTAGGAATTCACA
                      ____________________________________________________________
consensus CCAGAGCAGCACAAATAATGACATTACACACAGGAGATAGATAGAGTTTAGGAATTCACA
 
. : . : . : . : . : . :
rJMSF021C05- AGGACTAAAAAGTTCACTTTTTTAACTTGCAAGCCTTGTTACCATTGCAGCATCCAAAAG
JMSF021C05+ AGGACTAAAAAGTTCACTTTTTTAACTTGCAAGCCTTGTTACCATTGCAGCATCCAAAAG
rJMFF025K22- AGGACTAAAAAGTTCACTTTTTTAACTTGCAAGCCTTGTTACCATTGCAGCATCCAAAAG
                      ____________________________________________________________
consensus AGGACTAAAAAGTTCACTTTTTTAACTTGCAAGCCTTGTTACCATTGCAGCATCCAAAAG
 
. : . : . : . : . : . :
rJMSF021C05- AGAACACATAAAATGGGCCAACTTATCTGAAGCATCATCATAGGGTTTCAAGTCCAGAGA
JMSF021C05+ AGAACACATAAAATGGGCCAACTTATCTGAAGCATCATCATAGGGTTTCAAGTCCAGAGA
rJMFF025K22- AGAACACATAAAATGGGCCAACTTATCTGAAGCATCATCATAGGGTTTCAAGTCCAGAGA
JMFN025E04+ AAGCATCATCATAGGGTTTCAAGTCCAGAGA
                      ____________________________________________________________
consensus AGAACACATAAAATGGGCCAACTTATCTGAAGCATCATCATAGGGTTTCAAGTCCAGAGA
 
. : . : . : . : . : . :
rJMSF021C05- GCCCTTATATCTTGTTCAGCTTTTCTGCTACGATGACGGGGTTTGCCTTGGCTATCGCAT
JMSF021C05+ GCCCTTATATCTTGTTCAGCTTTTCTGCTACGATGACGGGGTTTGCCTTGGCTATCGCAT
rJMFF025K22- GCCCTTATATCTTGTTCAGCTTTTCTGCTACGATGACGGGGTTTGCCTTGGCTATCGCAT
JMFN025E04+ GCCCTTATATCTTGTTCAGCTTTTCTGCTACGATGACGGGGTTTGCCTTGGCTATCGCAT
                      ____________________________________________________________
consensus GCCCTTATATCTTGTTCAGCTTTTCTGCTACGATGACGGGGTTTGCCTTGGCTATCGCAT
 
. : . : . : . : . : . :
rJMSF021C05- CCCGAGCAGCGTTCTGATAGTCGAACGGGCATTGGTGTTTATCAGAGTAACGGTGAGCGG
JMSF021C05+ CCCGAGCAGCGTTCTGATAGTCGAACGGGCATTGGTGTTTATCAGAGTAACGGTGAGCGG
rJMFF025K22- CCCGAGCAGCGTTCTGATAGTCGAACGGGCATTGGTGTTTATCAGAGTAACGGTGAGCGG
JMFN025E04+ CCCGAGCAGCGTTCTGATAGTCGAACGGGCATTGGTGTTTATCAGAGTAACGGTGAGCGG
JMFF025K22+ CGGGCATTGGTGTTTATCAGAGTAACGGTGAGCGG
                      ____________________________________________________________
consensus CCCGAGCAGCGTTCTGATAGTCGAACGGGCATTGGTGTTTATCAGAGTAACGGTGAGCGG
 
. : . : . : . : . : . :
rJMSF021C05- CGCAGAAGAGGTTCCCGCACTTGCAACTGAACCCGGTCAGGCCCACCCGTTTGCGGCAAG
JMSF021C05+ CGCAGAAGAGGTTCCCGCACTTGCAACTGAACCCGGTCAGGCCCACCCGTTTGCGGCAAG
rJMFF025K22- CGCAGAAGAGGTTCCCGCACTTGCAACTGAACCCGGTCAGGCCCACCCGTTTGCGGCAAG
JMFN025E04+ CGCAGAAGAGGTTCCCGCACTTGCAACTGAAGCCGGTCAGGCCCACCCGTTTGCGGCAAG
JMFF025K22+ CGCAGAAGAGGTTCCCGCACTTGCAACTGAACCCGGTCAGGCCCACCCGTTTGCGGCAAG
                      ____________________________________________________________
consensus CGCAGAAGAGGTTCCCGCACTTGCAACTGAACCCGGTCAGGCCCACCCGTTTGCGGCAAG
 
. : . : . : . : . : . :
rJMSF021C05- TATTGCACCTGCTAGGCCCTTCTTTCG
JMSF021C05+ TATTGCACCTGCTAGGCCCTTCTTTCG
rJMFF025K22- TATTGCCCCTGCTAGGCCCTTCTTTCGCCTTCGCCTCTGAGCTCTGGCCCGATGATGATG
JMFN025E04+ TATTGCACCTGCTAGGCCCTTCTTTCGCCTTCGCCTCTGAGCTCTGGCCCGATGATGATG
JMFF025K22+ TATTGCCCCTGCTAGGCCCTTCTTTCGCCTTCGCCTCTGAGCTCTGGCCCGATGATGATG
                      ____________________________________________________________
consensus TATTGCACCTGCTAGGCCCTTCTTTCGCCTTCGCCTCTGAGCTCTGGCCCGATGATGATG
 
. : . : . : . : . : . :
rJMFF025K22- AATCGGAAGAAGCTTGTGGAGAAATGACCTTCAGTTCCAACGGCCCGGATTGCACGTCAA
JMFN025E04+ AATCGGAAGAAGCTTGTGGAGAAATGACCTTCAGTTCCAACGGCCCGGATTGCACGTCAA
JMFF025K22+ AATCGGAAGAAGCTTGTGGAGAAATGACCTTCAGTTCCAACGGCCCGGATTGCACGTCAA
                      ____________________________________________________________
consensus AATCGGAAGAAGCTTGTGGAGAAATGACCTTCAGTTCCAACGGCCCGGATTGCACGTCAA
 
. : . : . : . : . : . :
rJMFF025K22- TTGCAACAGCAGCAGCAGCAGCCGTGGATTCTTTAGGGTTGCTTGCGTTTCCATTAACAA
JMFN025E04+ TTGCAACAGCAGCAGCAGCAGCCGTGGATTCTTTAGGGTTGCTTGCGTTTCCATTAACAA
JMFF025K22+ TTGCAACAGCAGCAGCAGCAGCCGTGGATTCTTTAGGGTTGCTTGCGTTTCCATTAACAA
                      ____________________________________________________________
consensus TTGCAACAGCAGCAGCAGCAGCCGTGGATTCTTTAGGGTTGCTTGCGTTTCCATTAACAA
 
. : . : . : . : . : . :
rJMFF025K22- TGTTCTCGATGGACGAAGCGGCTAGCTTGGCCTGTTCCTGCTTCAAGATCATGTCTTTGT
JMFN025E04+ TGTTCTCGATGGACGAAGCGGCTAGCTTGGCCTGTTCCTGCTTCAAGATCATGTCTTTGT
JMFF025K22+ TGTTCTCGATGGACGAAGCGGCTAGCTTGGCCTGTTCCTGCTTCAAGATCATGTCTTTGT
                      ____________________________________________________________
consensus TGTTCTCGATGGACGAAGCGGCTAGCTTGGCCTGTTCCTGCTTCAAGATCATGTCTTTGT
 
. : . : . : . : . : . :
rJMFF025K22- GGCACTTGGAACACATATTCATCGTGGCTGCACTCCCAAAGAAGCC
JMFN025E04+ GGCACTTGGAACACATATTCATCGTGGCTGCACTCCCAAAGAAGCCGCAATTGTTAACAC
JMFF025K22+ GGCACTTGGAACACATATTCATCGTGGCTGCACTCCCAAAGAAGCCGCAATTGTTAACAC
                      ____________________________________________________________
consensus GGCACTTGGAACACATATTCATCGTGGCTGCACTCCCAAAGAAGCCGCAATTGTTAACAC
 
. : . : . : . : . : . :
JMFN025E04+ AAAAGATTGGGCCTTCTGAAGCTTGGCAACCTGTCTCTTTTGAAGACTCCATT
JMFF025K22+ AAAAGATTGGGCCTTCTGAAGCTTGGCAACCTGTCTCTTTTGAAGACTCCATTGTGCAAT
                      ____________________________________________________________
consensus AAAAGATTGGGCCTTCTGAAGCTTGGCAACCTGTCTCTTTTGAAGACTCCATTGTGCAAT
 
. : . : . : . : . : . :
JMFF025K22+ ATCCTCCTTAATTGAAGATTGAAGATGAGACAATCGGAGAAAACGAGGGATAAGACCAAG
                      ____________________________________________________________
consensus ATCCTCCTTAATTGAAGATTGAAGATGAGACAATCGGAGAAAACGAGGGATAAGACCAAG
 
. : . : . : . : . : . :
JMFF025K22+ AATGGAATTAAGAGGATTAAATTAAAGAGAGCGTCTTCTGCAGAGAGATAAAGGAGAAAT
                      ____________________________________________________________
consensus AATGGAATTAAGAGGATTAAATTAAAGAGAGCGTCTTCTGCAGAGAGATAAAGGAGAAAT
 
. : . : . : . : . : . :
JMFF025K22+ CGTGGGGAAGGGGAAAGGGGTTGAATGGTAAATCTGGGTGAAAGATTTTTGCAAACAATT
                      ____________________________________________________________
consensus CGTGGGGAAGGGGAAAGGGGTTGAATGGTAAATCTGGGTGAAAGATTTTTGCAAACAATT