Previous Contig 001216:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF025K10Sequence574001216 (2)741009105 (3)gb:AP001300_18210132e-17Arabidopsis thaliana genomic DNA, chromosome 3, BAC clone:F5N5.
JMSF031J15Sequence645001216 (2)

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF031J15+ TCCGCCGACAGAGTCCTCAGAAGGGCAGGAAATTGCTTCTCGAAAAGCCGCT
                      ____________________________________________________________
consensus TCCGCCGACAGAGTCCTCAGAAGGGCAGGAAATTGCTTCTCGAAAAGCCGCT
 
. : . : . : . : . : . :
JMSF031J15+ TGAACCGCGACTTCGCCACAGGCTTAACCGGAGACGGTTGTTTAGGTGAGGTGAAATCTA
JMFF025K10+ AGACGGTTGTTTAGGTGAGGTGAAATCTA
                      ____________________________________________________________
consensus TGAACCGCGACTTCGCCACAGGCTTAACCGGAGACGGTTGTTTAGGTGAGGTGAAATCTA
 
. : . : . : . : . : . :
JMSF031J15+ TAGGCTGAATCCTCATGGAACCACCAATGTAAAATCACTTGTAATATTTCATTCCCTCCA
JMFF025K10+ TAGGCTGAATCCTCATGGAACCACCAATGTAAAATCACTTGTAATATTTCATTCCCTCCA
                      ____________________________________________________________
consensus TAGGCTGAATCCTCATGGAACCACCAATGTAAAATCACTTGTAATATTTCATTCCCTCCA
 
. : . : . : . : . : . :
JMSF031J15+ CTCCATCGGAGCCGAAGCTTACTCAAATTACCCCCAAATATTTACTTCTACCTAGCTAAT
JMFF025K10+ CTCCATCGGAGCCGAAGCTTACTCAAATTACCCCCAAATATTTACTTCTACCTAGCTAAT
                      ____________________________________________________________
consensus CTCCATCGGAGCCGAAGCTTACTCAAATTACCCCCAAATATTTACTTCTACCTAGCTAAT
 
. : . : . : . : . : . :
JMSF031J15+ TTCTATTCTAGAGCAAGAAATTACTAATAATTCTTTTTAAAACCTAAAAAGCAGTGGTAT
JMFF025K10+ TTCTATTCTAGAGCAAGAAATTACTAATAATTCTTTTTAAAACCTAAAAAGCAGTGGTAT
                      ____________________________________________________________
consensus TTCTATTCTAGAGCAAGAAATTACTAATAATTCTTTTTAAAACCTAAAAAGCAGTGGTAT
 
. : . : . : . : . : . :
JMSF031J15+ ATCTATGATCTTCGAAAGCAAATATACCTTTATCCGGCGGAATACCGGTGTTCTAAGCTA
JMFF025K10+ ATCTATGATCTTCGAAAGCAAATATACCTTTATCCGGCGGAATACCGGTGTTCTAAGCTA
                      ____________________________________________________________
consensus ATCTATGATCTTCGAAAGCAAATATACCTTTATCCGGCGGAATACCGGTGTTCTAAGCTA
 
. : . : . : . : . : . :
JMSF031J15+ GGAATAACTTGGAGTCTGAGTTGAGAGAAACACCGTCGTCCTTTGTTTAGGGTTTAGAAA
JMFF025K10+ GGAATAACTTGGAGTCTGAGTTGAGAGAAACACCGTCGTCCTTTGTTTAGGGTTTAGAAA
                      ____________________________________________________________
consensus GGAATAACTTGGAGTCTGAGTTGAGAGAAACACCGTCGTCCTTTGTTTAGGGTTTAGAAA
 
. : . : . : . : . : . :
JMSF031J15+ GAAGATGAGGCTAGACGAGAGGAGGTCACCGATTTCGCAGCCG
JMFF025K10+ GAAGATGAGGCTAGACGAGAGGAGGTCACCGATTTCGCAGCCGCCGAAGAGATGTACGAT
                      ____________________________________________________________
consensus GAAGATGAGGCTAGACGAGAGGAGGTCACCGATTTCGCAGCCGCCGAAGAGATGTACGAT
 
. : . : . : . : . : . :
JMFF025K10+ CCTTCGACGGAGTATCCATATCTCCGGCGACAGAATCGATTTGCCGATAAGGAATATCGA
                      ____________________________________________________________
consensus CCTTCGACGGAGTATCCATATCTCCGGCGACAGAATCGATTTGCCGATAAGGAATATCGA
 
. : . : . : . : . : . :
JMFF025K10+ CTTCTCACCTACTTTCAGAGTTTCAGATAGAGAATTGGTAAACAGATAATATCTATCTGA
                      ____________________________________________________________
consensus CTTCTCACCTACTTTCAGAGTTTCAGATAGAGAATTGGTAAACAGATAATATCTATCTGA
 
. : . : . : . : . : . :
JMFF025K10+ ACAGTGAGAGAGAGTTTTAGCGGTGGTTGGACAGTTGTTATGAAAACCACCCGGTAAGGC
                      ____________________________________________________________
consensus ACAGTGAGAGAGAGTTTTAGCGGTGGTTGGACAGTTGTTATGAAAACCACCCGGTAAGGC