Previous Contig 001200:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF025D24Sequence607001200 (2)pir|T47594|T475946e-09hypothetical protein T12E18.40 - Arabidopsis thaliana>gb:ATT12E18_1554323 Arabid769009385 (2)pir|T47594|T475941e-46hypothetical protein T12E18.40 - Arabidopsis thaliana>gb:ATT12E18_1554323 Arabid
JMFF036F04Sequence581001200 (2)pir|T47594|T475945e-09hypothetical protein T12E18.40 - Arabidopsis thaliana>gb:ATT12E18_1554323 Arabid620009385 (2)pir|T47594|T475949e-31hypothetical protein T12E18.40 - Arabidopsis thaliana>gb:ATT12E18_1554323 Arabid

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF025D24+ TGATGTA
                      ____________________________________________________________
consensus TGATGTA
 
. : . : . : . : . : . :
JMFF036F04+ CCTCACTAACTAAGCATTTTCCATAGCTAAGGGAATTACCT
JMFF025D24+ GCTGACGGTTGACAGCATTCCTCACTAACTAAGCATTTTCCATAGCTAAGGGAATTACCT
                      ____________________________________________________________
consensus GCTGACGGTTGACAGCATTCCTCACTAACTAAGCATTTTCCATAGCTAAGGGAATTACCT
 
. : . : . : . : . : . :
JMFF036F04+ TTGGGCACATGAGGGACTTCACTGAGTTTAATCNTAGGCTGAATACAAGTACTCCTCTCC
JMFF025D24+ TTGGGCACATGAGGGACTTCACTGAGTTTAATCCTAGGCTGAATACAAGTACTCCTCTCC
                      ____________________________________________________________
consensus TTGGGCACATGAGGGACTTCACTGAGTTTAATCCTAGGCTGAATACAAGTACTCCTCTCC
 
. : . : . : . : . : . :
JMFF036F04+ TGTAATGAAGCTGAAAACCCCTCAGAGAATCCATTTTTCCTCAAAACTTCATTTACTTGA
JMFF025D24+ TGTAATGAAGCTGAAAACCCCTCAGAGAATCCATTTTTCCTCAAAACTTCATTTACTTGA
                      ____________________________________________________________
consensus TGTAATGAAGCTGAAAACCCCTCAGAGAATCCATTTTTCCTCAAAACTTCATTTACTTGA
 
. : . : . : . : . : . :
JMFF036F04+ TTATCATCAGCTGTATTTGTGCATCCAGTCTGATATGCAATAGAAGGGGTGGGAGCAATC
JMFF025D24+ TTATCATCAGCTGTATTTGTGCATCCAGTCTGATATGCAATAGAAGGGGTGGGAGCAATC
                      ____________________________________________________________
consensus TTATCATCAGCTGTATTTGTGCATCCAGTCTGATATGCAATAGAAGGGGTGGGAGCAATC
 
. : . : . : . : . : . :
JMFF036F04+ TCACCCAATGCTTCTGGGAAAGCATTACGCAGGATAGTCAGTTCTGCTTCCTGGAACCCT
JMFF025D24+ TCACCCAATGCTTCTGGGAAAGCATTACGCAGGATAGTCAGTTCTGCTTCCTGGAACCCT
                      ____________________________________________________________
consensus TCACCCAATGCTTCTGGGAAAGCATTACGCAGGATAGTCAGTTCTGCTTCCTGGAACCCT
 
. : . : . : . : . : . :
JMFF036F04+ AAATTATCTGAAATACAGTCCCCAAGGACACTTCTGTCCCGGGACACAGCATCATGTGTA
JMFF025D24+ AAATTATCTGAAATACAGTCCCCAAGGACACTTCTGTCCCGGGACACAGCATCATGTGTA
                      ____________________________________________________________
consensus AAATTATCTGAAATACAGTCCCCAAGGACACTTCTGTCCCGGGACACAGCATCATGTGTA
 
. : . : . : . : . : . :
JMFF036F04+ GCATGCTGCTGAAAATCAGCTCCATGTCCACTGAAATCATGTAAATTGGGTTCATCCAGA
JMFF025D24+ GCATGCTGCTGAAAATCAGCTCCATGTCCACTGAAATCATGTAAATTGGGTTCATCCAGA
                      ____________________________________________________________
consensus GCATGCTGCTGAAAATCAGCTCCATGTCCACTGAAATCATGTAAATTGGGTTCATCCAGA
 
. : . : . : . : . : . :
JMFF036F04+ AAACCAAGATCAGAGGCATTGAAAATTTCATTTCGAATTTTCTTTCGCATGGCATAGTAC
JMFF025D24+ AAACCAAGATCAGAGGCATTGAAAATTTCATTTCGAATTTTCTTTCGCATGGCATAGTAC
                      ____________________________________________________________
consensus AAACCAAGATCAGAGGCATTGAAAATTTCATTTCGAATTTTCTTTCGCATGGCATAGTAC
 
. : . : . : . : . : . :
JMFF036F04+ TGTTTGCGGATGCTCATGATTTTTCTCTTTTGAGGAACCTCCTTGTTTCCTTTAATGTTT
JMFF025D24+ TGTTTGCGGATGCTCATGATTTTTCTCTTTTGAGGAACCTCCTTGTTTCCTTTAATGTTT
                      ____________________________________________________________
consensus TGTTTGCGGATGCTCATGATTTTTCTCTTTTGAGGAACCTCCTTGTTTCCTTTAATGTTT
 
. : . : . : . : . : . :
JMFF036F04+ TCCGATCTATTAAACTTTAAAGAAGGCTGACACCAGAAAGTTCAAGCTCTATCATACAAG
JMFF025D24+ TCCGATCTATTAAACTTTAAAGAAGGCTGACACCAGAAAGTTCAAGCTCTATCATACAAG
                      ____________________________________________________________
consensus TCCGATCTATTAAACTTTAAAGAAGGCTGACACCAGAAAGTTCAAGCTCTATCATACAAG