Previous Contig 001199:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF010I24Sequence502001199 (3)703008656 (2)gb:AP005885_18596559e-42Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P065
JMFF025D20Sequence615001199 (3)707008656 (2)gb:AP005885_18596553e-42Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P065
JMSF048C11Sequence681001199 (3)

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF048C11+ TCAGACCCGAGGGGGGACTGCTGCTG
                      ____________________________________________________________
consensus TCAGACCCGAGGGGGGACTGCTGCTG
 
. : . : . : . : . : . :
JMSF048C11+ CAACAGATGATCACTTGGATAGCAGTCAAAACCGGTTTTATTTCCCATGCTTACATTCAT
JMFF025D20+ CCCATGCTTACATTCAT
                      ____________________________________________________________
consensus CAACAGATGATCACTTGGATAGCAGTCAAAACCGGTTTTATTTCCCATGCTTACATTCAT
 
. : . : . : . : . : . :
JMSF048C11+ AATTAGATCATCCACCGGGGATGAGGTAGCTACTGGAAACGAATCAAACGATTGAATGAC
JMFF025D20+ AATTAGATCATCCACCGGGGATGAGGTAGCTACTGGAAACGAATCAAACGATTGAATGAC
                      ____________________________________________________________
consensus AATTAGATCATCCACCGGGGATGAGGTAGCTACTGGAAACGAATCAAACGATTGAATGAC
 
. : . : . : . : . : . :
JMSF048C11+ ATCCATAAGAAGATTTCCATTGATAAGATCTTCAACATCTAGACATGGAAGGATATCGGG
JMFF010I24+ ATCTAGACATGGAAGGATATCGGG
JMFF025D20+ ATCCATAAGAAGATTTCCATTGATAAGATCTTCAACATCTAGACATGGAAGGATATCGGG
                      ____________________________________________________________
consensus ATCCATAAGAAGATTTCCATTGATAAGATCTTCAACATCTAGACATGGAAGGATATCGGG
 
. : . : . : . : . : . :
JMSF048C11+ ACTCATAAAGCTAGAAATATTGCTGATTTCTGAACCAAATGACCAAGCAGGATCACAAAA
JMFF010I24+ ACTCATAAAGCTAGAAATATTGCTGATTTCTGAACCAAATGACCAAGCAGGATCACAAAA
JMFF025D20+ ACTCATAAAGCTAGAAATATTGCTGATTTCTGAACCAAATGACCAAGCAGGATCACAAAA
                      ____________________________________________________________
consensus ACTCATAAAGCTAGAAATATTGCTGATTTCTGAACCAAATGACCAAGCAGGATCACAAAA
 
. : . : . : . : . : . :
JMSF048C11+ TTCACTATTTAAGAAAGACGACGATGAAGTTCCTGGTAGAATTGTCTCCTGTTCCATTTC
JMFF010I24+ TTCACTATTTAAGAAAGACGACGATGAAGTTCCTGGTAGAATTGTCTCCTGTTCCATTTC
JMFF025D20+ TTCACTATTTAAGAAAGACGACGATGAAGTTCCTGGTAGAATTGTCTCCTGTTCCATTTC
                      ____________________________________________________________
consensus TTCACTATTTAAGAAAGACGACGATGAAGTTCCTGGTAGAATTGTCTCCTGTTCCATTTC
 
. : . : . : . : . : . :
JMSF048C11+ CTTAAAGTGTTGTTTCATTTCATCCACAAATTCAATCCTCCAATGAATTTCAGTGATCAG
JMFF010I24+ CTTAAAGTGTTGTTTCATTTCATCCACAAATTCAATCCTCCAATGAATTTCAGTGATCAG
JMFF025D20+ CTTAAAGTGTTGTTTCATTTCATCCACAAATTCAATCCTCCAATGAATTTCAGTGATCAG
                      ____________________________________________________________
consensus CTTAAAGTGTTGTTTCATTTCATCCACAAATTCAATCCTCCAATGAATTTCAGTGATCAG
 
. : . : . : . : . : . :
JMSF048C11+ AAAACAGCATGAAACAGGCTATTGAAGATTGATGCAGTCACTGGGAGTAACCCAAAGAAG
JMFF010I24+ AAAACAGCATGAAACAGG--GTTGAAGATTGATGCAGTCACTGGGAGTAACCCAAAGAAG
JMFF025D20+ AAAACAGCATGAAACAGG--GTTGAAGATTGATGCAGTCACTGGGAGTAACCCAAAGAAG
                      ____________________________________________________________
consensus AAAACAGCATGAAACAGG--GTTGAAGATTGATGCAGTCACTGGGAGTAACCCAAAGAAG
 
. : . : . : . : . : . :
JMSF048C11+ AAATGCAGCTATGTATGTATGGCTTCCCTAACCAAACGGCCAAACCCCAGAACTGAACTG
JMFF010I24+ AAATGCAGCTATGTATGTATGGCTTCCCTAACCAAACGGCCAAACCCCAGAACTGAACTG
JMFF025D20+ AAATGCAGCTATGTATGTATGGCTTCCCTAACCAAACGGCCAAACCCCAGAACTGAACTG
                      ____________________________________________________________
consensus AAATGCAGCTATGTATGTATGGCTTCCCTAACCAAACGGCCAAACCCCAGAACTGAACTG
 
. : . : . : . : . : . :
JMSF048C11+ TTCTAATCTCAGTGGTTTTGAAGGAGTGAACAGATGAAGAGGTATGGGAAATCTTGTGAA
JMFF010I24+ TTCTAATCTCAGTGGTTTTGAAGGAGTGAACAGATGAAGAGGTATGGGAAATCTTGTGAA
JMFF025D20+ TTCTAATCTCAGTGGTTTTGAAGGAGTGAACAGATGAAGAGGTATGGGAAATCTTGTGAA
                      ____________________________________________________________
consensus TTCTAATCTCAGTGGTTTTGAAGGAGTGAACAGATGAAGAGGTATGGGAAATCTTGTGAA
 
. : . : . : . : . : . :
JMSF048C11+ AAGCAAGATGTTCAGAAAAAAGACGAAATGGGAAACAGAAGGGATCAGGATTCAGGAGAG
JMFF010I24+ AAGCAAGATGTTCAGAAAAAAGACGAAATGGGAAACAGAAGGGATCAGGATTCAGGAGAG
JMFF025D20+ AAGCAAGATGTTCAGAAAAAAGACGAAATGGGAAACAGAAGGGATCAGGATTCAGGAGAG
                      ____________________________________________________________
consensus AAGCAAGATGTTCAGAAAAAAGACGAAATGGGAAACAGAAGGGATCAGGATTCAGGAGAG
 
. : . : . : . : . : . :
JMSF048C11+ AGAGCTAAAGAAAACAGAAAGATGGAGAGGAATTATAAAGTGGGATTTTAA
JMFF010I24+ AGAGCTAAAGAAAACAGAAAGATGGAGAGGAATTATAAAGTGGGATTTTAA
JMFF025D20+ AGAGCTAAAGAAAACAGAAAGATGGAGAGGAATTATAAAGTGGGATTTTAATATAGAGAG
                      ____________________________________________________________
consensus AGAGCTAAAGAAAACAGAAAGATGGAGAGGAATTATAAAGTGGGATTTTAATATAGAGAG