Previous Contig 001196:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF025B01Sequence467001196 (11)pir|H86229|H862296e-04hypothetical protein [imported] - Arabidopsis thaliana>gb:AE005172_889967 Arabid723013527 (4)pir|H86229|H862292e-58hypothetical protein [imported] - Arabidopsis thaliana>gb:AE005172_889967 Arabid
JMFS014D02Sequence625001196 (11)pir|H86229|H862292e-32hypothetical protein [imported] - Arabidopsis thaliana>gb:AE005172_889967 Arabid
JMFS026B08Sequence627001196 (11)pir|H86229|H862293e-31hypothetical protein [imported] - Arabidopsis thaliana>gb:AE005172_889967 Arabid
JMFS028B10Sequence622001196 (11)pir|H86229|H862293e-33hypothetical protein [imported] - Arabidopsis thaliana>gb:AE005172_889967 Arabid
JMFS120D04Sequence627001196 (11)pir|H86229|H862292e-32hypothetical protein [imported] - Arabidopsis thaliana>gb:AE005172_889967 Arabid
JMFS128B03Sequence626001196 (11)pir|H86229|H862291e-34hypothetical protein [imported] - Arabidopsis thaliana>gb:AE005172_889967 Arabid
JMFS148G06Sequence620001196 (11)pir|H86229|H862291e-31hypothetical protein [imported] - Arabidopsis thaliana>gb:AE005172_889967 Arabid
JMSF008C08Sequence337001196 (11)820011423 (2)pir|H86366|H863668e-06protein F26F24.12 [imported] - Arabidopsis thaliana>gb:AE005172_891278 Arabidops
JMSF010O18Sequence264001196 (11)780011423 (2)pir|H86366|H863660.001protein F26F24.12 [imported] - Arabidopsis thaliana>gb:AE005172_891278 Arabidops
JMSF011O10Sequence227001196 (11)777022459gb:AF529177_18090289e-68Arabidopsis thaliana anaphase promoting complex/cyclosome subunit (CDC16) mRNA,
JMSF044C05Sequence733001196 (11)pir|H86229|H862296e-49hypothetical protein [imported] - Arabidopsis thaliana>gb:AE005172_889967 Arabid738013527 (4)pir|H86229|H862291e-52hypothetical protein [imported] - Arabidopsis thaliana>gb:AE005172_889967 Arabid

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF044C05+ TGCAACCGGAAACTGTGGTGGATTTCCAAACATCTC
                      ____________________________________________________________
consensus TGCAACCGGAAACTGTGGTGGATTTCCAAACATCTC
 
. : . : . : . : . : . :
JMFS028B10+ C
JMFS128B03+ C
JMSF044C05+ AATCTCATTCGAGAGCTTATCAGCAGATGCCTTAATAGGCATCCCAGTGCAGTGAAACCC
                      ____________________________________________________________
consensus AATCTCATTCGAGAGCTTATCAGCAGATGCCTTAATAGGCATCCCAGTGCAGTGAAACCC
 
. : . : . : . : . : . :
JMFS014D02+ AGGGCAAAAGCACGTTTTCACCCCTCAATCTATGATAAGCAGCAGCAAACTCGAGTTT
JMFS148G06+ CAAAAGCACGTTTTCACCCCTCAATCTATGATAAGCAGCAGCAAACTCGAGTTT
JMFS120D04+ AAGGGCAAAAGCACGTTTTCACCCCTCAATCTATGATAAGCAGCAGCAAACTCGAGTTT
JMFS026B08+ AAAGCACGTTTTCACCCCTCAATCTATGATAAGCAGCAGCAAACTCGAGTTT
JMFS028B10+ AAAGGGCAAAAGCACGTTTTCACCCCTCAATCTATGATAAGCAGCAGCAAACTCGAGTTT
JMFS128B03+ AAAGGGCAAAAGCACGTTTTCACCCCTCAATCTATGATAAGCAGCAGCAAACTCGAGTTT
JMSF044C05+ AAAGGGCAAAAGCACGTTTTCACCCCTCAATCTATGATAAGCAGCAGCAAACTCGAGTTT
                      ____________________________________________________________
consensus AAAGGGCAAAAGCACGTTTTCACCCCTCAATCTATGATAAGCAGCAGCAAACTCGAGTTT
 
. : . : . : . : . : . :
JMFS014D02+ AGACAACGAAAATGCATGTCCCAGATGAAGATAGCCATTCATATACGGGAAAGGAAAGTT
JMFS148G06+ AGACAACGAAAATGCATGTCCCAGATGAAGATAGCCATTCATATACGGGAAAGGAAAGTT
JMFS120D04+ AGACAACGAAAATGCATGTCCCAGATGAAGATAGCCATTCATATACGGGAAAGGAAAGTT
JMFS026B08+ AGACAACGAAAATGCATGTCCCAGATGAAGATAGCCATTCATATACGGGAAAGGAAAGTT
JMFS028B10+ AGACAACGAAAATGCATGTCCCAGATGAAGATAGCCATTCATATACGGGAAAGGAAAGTT
JMFS128B03+ AGACAACGAAAATGCATGTCCCAGATGAAGATAGCCATTCATATACGGGAAAGGAAAGTT
JMSF044C05+ AGACAACGAAAATGCATGTCCCAGATGAAGATAGCCATTCATATACGGGAAAGGAAAGTT
                      ____________________________________________________________
consensus AGACAACGAAAATGCATGTCCCAGATGAAGATAGCCATTCATATACGGGAAAGGAAAGTT
 
. : . : . : . : . : . :
JMFS014D02+ CCCAAAAAACTTTTCACCCGGCAAGGGACGAGAATCTTTGGGCTCAGCTCTGAAAACATT
JMFS148G06+ CCCAAAAAACTTTTCACCCGGCAAGGGACGAGAATCTTTGGGCTCAGCTCTGAAAACATT
JMFS120D04+ CCCAAAAAACTTTTCACCCGGCAAGGGACGAGAATCTTTGGGCTCAGCTCTGAAAACATT
JMFS026B08+ CCCAAAAAACTTTTCACCCGGCAAGGGACGAGAATCTTTGGGCTCAGCTCTGAAAACATT
JMFS028B10+ CCCAAAAAACTTTTCACCCGGCAAGGGACGAGAATCTTTGGGCTCAGCTCTGAAAACATT
JMFS128B03+ CCCAAAAAACTTTTCACCCGGCAAGGGACGAGAATCTTTGGGCTCAGCTCTGAAAACATT
JMSF044C05+ CCCAAAAAACTTTTCACCCGGCAAGGGACGAGAATCTTTGGGCTCAGCTCTGAAAACATT
                      ____________________________________________________________
consensus CCCAAAAAACTTTTCACCCGGCAAGGGACGAGAATCTTTGGGCTCAGCTCTGAAAACATT
 
. : . : . : . : . : . :
JMFS014D02+ CCCCTCTTCCCACCACTTTTGAACCTGCGACTCTATTTCCAACAACCGATCCCTCCTAGC
JMFS148G06+ CCCCTCTTCCCACCACTTTTGAACCTGCGACTCTATTTCCAACAACCGATCCCTCCTAGC
JMFS120D04+ CCCCTCTTCCCACCACTTTTGAACCTGCGACTCTATTTCCAACAACCGATCCCTCCTAGC
JMFS026B08+ CCCCTCTTCCCACCACTTTTGAACCTGCGACTCTATTTCCAACAACCGATCCCTCCTAGC
JMFS028B10+ CCCCTCTTCCCACCACTTTTGAACCTGCGACTCTATTTCCAACAACCGATCCCTCCTAGC
JMFS128B03+ CCCCTCTTCCCACCACTTTTGAACCTGCGACTCTATTTCCAACAACCGATCCCTCCTAGC
JMSF044C05+ CCCCTCTTCCCACCACTTTTGAACCTGCGACTCTATTTCCAACAACCGATCCCTCCTAGC
JMFF025B01+ CTCTTCCCACCACTTTTGAACCTGCGACTCTATTTCCAACAACCGATCCCTCCTAGC
                      ____________________________________________________________
consensus CCCCTCTTCCCACCACTTTTGAACCTGCGACTCTATTTCCAACAACCGATCCCTCCTAGC
 
. : . : . : . : . : . :
JMFS014D02+ AAAACTCTTCCCACTCTCCTCTGCCATTATTTCCCTACCAGCAGAACTGCAAAAACTGAA
JMFS148G06+ AAAACTCTTCCCACTCTCCTCTGCCATTATTTCCCTACCAGCAGAACTGCAAAAACTGAA
JMFS120D04+ AAAACTCTTCCCACTCTCCTCTGCCATTATTTCCCTACCAGCAGAACTGCAAAAACTGAA
JMFS026B08+ AAAACTCTTCCCACTCTCCTCTGCCATTATTTCCCTACCAGCAGAACTGCAAAAACTGAA
JMFS028B10+ AAAACTCTTCCCACTCTCCTCTGCCATTATTTCCCTACCAGCAG---------AACTGAA
JMFS128B03+ AAAACTCTTCCCACTCTCCTCTGCCATTATTTCCCTACCAGCAG---------AACTGAA
JMSF044C05+ AAAACTCTTCCCACTCTCCTCTGCCATTATTTCCCTACCAGCAGAACTGCAAAAACTGAA
JMFF025B01+ AAAACTCTTCCCACTCTCCTCTGCCATTATTTCCCTACCAGCAGAACTGCAAAAACTGAA
                      ____________________________________________________________
consensus AAAACTCTTCCCACTCTCCTCTGCCATTATTTCCCTACCAGCAGAACTGCAAAAACTGAA
 
. : . : . : . : . : . :
JMFS014D02+ GATAGATAGATGGAATGGAGGCTTGGGATGAAGATAGCGGCGCCTCAGAACATGAGCCAC
JMFS148G06+ GATAGATAGATGGAATGGAGGCTTGGGATGAAGATAGCGGCGCCTCAGAACATGAGCCAC
JMFS120D04+ GATAGATAGATGGAATGGAGGCTTGGGATGAAGATAGCGGCGCCTCAGAACATGAGCCAC
JMFS026B08+ GATAGATAGATGGAATGGAGGCTTGGGATGAAGATAGCGGCGCCTCAGAACATGAGCCAC
JMFS028B10+ GATAGATAGATGGAATGGAGGCTTGGGATGAAGATAGCGGCGCCTCAGAACATGAGCCAC
JMFS128B03+ GATAGATAGATGGAATGGAGGCTTGGGATGAAGATAGCGGCGCCTCAGAACATGAGCCAC
JMSF044C05+ GATAGATAGATGGAATGGAGGCTTGGGATGAAGATAGCGGCGCCTCAGAACATGAGCCAC
JMFF025B01+ GATAGATAGATGGAATGGAGGCTTGGGATGAAGATAGCGGCGCCTCAGAACATGAGCCAC
                      ____________________________________________________________
consensus GATAGATAGATGGAATGGAGGCTTGGGATGAAGATAGCGGCGCCTCAGAACATGAGCCAC
 
. : . : . : . : . : . :
JMFS014D02+ ACTGAGGAAGAGCAACGGGTCGCTGACTCGCTGTTGAATACTTGAATGTTGATGCTGGAT
JMFS148G06+ ACTGAGGAAGAGCAACGGGTCGCTGACTCGCTGTTGAATACTTGAATGTTGATGCTGGAT
JMFS120D04+ ACTGAGGAAGAGCAACGGGTCGCTGACTCGCTGTTGAATACTTGAATGTTGATGCTGGAT
JMFS026B08+ ACTGAGGAAGAGCAACGGGTCGCTGACTCGCTGTTGAATACTTGAATGTTGATGCTGGAT
JMFS028B10+ ACTGAGGAAGAGCAACGGGTCGCTGACTCGCTGTTGAATACTTGAATGTTGATGCTGGAT
JMFS128B03+ ACTGAGGAAGAGCAACGGGTCGCTGACTCGCTGTTGAATACTTGAATGTTGATGCTGGAT
JMSF044C05+ ACTGAGGAAGAGCAACGGGTCGCTGACTCGCTGTTGAATACTTGAATGTTGATGCTGGAT
JMFF025B01+ ACTGAGGAAGAGCAACGGGTCGCTGACTCGCTGTTGAATACTTGAATGTTGATGCTGGAT
                      ____________________________________________________________
consensus ACTGAGGAAGAGCAACGGGTCGCTGACTCGCTGTTGAATACTTGAATGTTGATGCTGGAT
 
. : . : . : . : . : . :
JMFS014D02+ AGAGCCGTCGGCTGGTAGGAGACTAGGAGTGGTACCTGCTGTCAGCCTGGACTGCTGACC
JMFS148G06+ AGAGCCGTCGGCTGGTAGGAGACTAGGAGTGGTACCTGCTGTCAGCCTGGACTGCTGACC
JMFS120D04+ AGAGCCGTCGGCTGGTAGGAGACTAGGAGTGGTACCTGCTGTCAGCCTGGACTGCTGACC
JMFS026B08+ AGAGCCGTCGGCTGGTAGGAGACTAGGAGTGGTACCTGCTGTCAGCCTGGACTGCTGACC
JMFS028B10+ AGAGCCGTCGGCTGGTAGGAGACTAGGAGTGGTACCTGCTGTCAGCCTGGACTGCTGACC
JMFS128B03+ AGAGCCGTCGGCTGGTAGGAGACTAGGAGTGGTACCTGCTGTCAGCCTGGACTGCTGACC
JMSF044C05+ AGAGCCGTCGGCTGGTAGGAGACTAGGAGTGGTACCTGCTGTCAGCCTGGACTGCTGACC
JMSF011O10+ ACC
JMFF025B01+ AGAGCTGTCGGCTGGTAGGAGACTAGGAGTGGTACCTGCTGTCAGCCTGGACTGCTGACC
                      ____________________________________________________________
consensus AGAGCCGTCGGCTGGTAGGAGACTAGGAGTGGTACCTGCTGTCAGCCTGGACTGCTGACC
 
. : . : . : . : . : . :
JMFS014D02+ TGCTGTCTACTGCAGTACTGTGACGGGGGACGGGAGAAGTGGAGAATAGGAGGTGGTCGG
JMFS148G06+ TGCTGTCTACTGCAGTACTGTGACGGGGGACGGGAGAAGTGGAGAATCGGAGGTGGTCGG
JMFS120D04+ TGCTGTCTACTGCAGTACTGTGACGGGGGACGGGAGAAGTGGAGAATCGGAGGTGGTCGG
JMFS026B08+ TGCTGTCTACTGCAGTACTGTGACGGGGGACGGGAGAAGTGGAGAATCGGAGGTGGTCGG
JMFS028B10+ TGCTGTCTACTGCAGTACTGTGACGGGGGACGGGAGAAGTGGAGAATCGGAGGTGGTCGG
JMFS128B03+ TGCTGTCTACTGCAGTACTGTGACGGGGGACGGGAGAAGTGGAGAATCGGAGGTGGTCGG
JMSF044C05+ TGCTGTCTACTGCAGTACTGTGACGGGGGACGGGAGAAGTGGAGAATCGGAGGTGGTCGG
JMSF008C08+ CGGAGGTGGTCGG
JMSF011O10+ TGCTGTCTACTGCAGTACTGTGACGGGGGATGGGAGAAGTGGAGAACCGGAGGTGGTCGG
JMSF010O18+ CGGAGGTGGTCGG
JMFF025B01+ TGCTGTCTACTGCAGTACTGTGACGGGGGACGGGAGAAGTGGAGAATCGGAGGTGGTCGG
                      ____________________________________________________________
consensus TGCTGTCTACTGCAGTACTGTGACGGGGGACGGGAGAAGTGGAGAATCGGAGGTGGTCGG
 
. : . : . : . : . : . :
JMFS014D02+ CTGTG----------ACGCGGCTGCGTCGCTGGGAGTAGGGCAGTAGGCGACCGCGACAA
JMFS148G06+ CTGTG----------ACGCGGCTGCGTCGCTGGGAGTAGGGCAGTAGGCGACCGCGACAA
JMFS120D04+ CTGTG----------ACGCGGCTGCGTCGCTGGGAGTAGGGCAGTAGGCGACCGCGACAA
JMFS026B08+ CTGTG----------ACGCGGCTGAGTCGCTGGGAGTAGGGCAGTAGGCGACCGCGACAA
JMFS028B10+ CTGTG----------ACGCGGCTGCGTCGCTGGGAGTAGGGCAGTAGGCGACCGCGACAA
JMFS128B03+ CTGTG----------ACGCGGCTGCGTCGCTGGGAGTAGGGCAGTAGGCGACCGCGACAA
JMSF044C05+ CTGTG----------ACGCGGCTGCGTCGCTGGGAGTAGGGCAGTAGGCGACCGCGACAA
JMSF008C08+ CTGTG----------ACGCGGCTGCGTCGCTGGGAGTAGGGCAGTAGGCGACCGCCACAG
JMSF011O10+ CTGTGCTAGTGTGCTGGTCGGCTGCGTGGCTGGGAGTAGGGCAGTAGGCGACCGCGA-AG
JMSF010O18+ CTGTG----------ACGCGGCTGCGTCGCTGGGAGTAGGGCAGTAGGCGACCGC
JMFF025B01+ CTGTG----------ACGCGGCTGCGTCGCTGGGAGTAGGGCAGTAGGCGACCGCGACAA
                      ____________________________________________________________
consensus CTGTG----------ACGCGGCTGCGTCGCTGGGAGTAGGGCAGTAGGCGACCGCGACAA
 
. : . : . : . : . : . :
JMFS014D02+ AGGGACTGAGGGAGAGACGGAGAGTTGGAGAAACGGC
JMFS148G06+ AGGGACTGAGGGAGAGACGGAGAGTTGGAGAAACGG
JMFS120D04+ AGGGACTGAGGGAGAGACGGAGAGTTGGAGAAACGGCA
JMFS026B08+ AGGGACTGAGGGAGAGACGGAGAGTTGGAGAAACGGCAGAA
JMFS028B10+ AGGGACTGAGGGAGAGACGGAGAG-TGGAGAAACGGCAGAA
JMFS128B03+ AGGGACTGAGGGAGAGACGGAGAGTTGGAGAAACGGC
JMSF044C05+ AGGGACTGAGGGAGAGACGGAGAGTTGGAGAAACGGCAGAA
JMSF008C08+ AGGGACTGAGGGTGAGACGGAGAGTTGAAGAA
JMSF011O10+ AGGGACTGAGGGAGAGACGGAGAGTTGGAGAA
JMFF025B01+ AGGGACTGAGGGAGAGACGGAGAGTTGGAGAAACGGCAGAAATCGCAGAATGGGGAAATT
                      ____________________________________________________________
consensus AGGGACTGAGGGAGAGACGGAGAGTTGGAGAAACGGCAGAAATCGCAGAATGGGGAAATT