Previous Contig 001190:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF015E22Sequence475001190 (2)pir|B71445|B714451e-20probable glycerol-3-phosphate permease - Arabidopsis thaliana>gb:ATCHRIV46_15455587009369 (2)pir|B71445|B714452e-17probable glycerol-3-phosphate permease - Arabidopsis thaliana>gb:ATCHRIV46_15455
JMFF024O16Sequence439001190 (2)pir|B71445|B714453e-15probable glycerol-3-phosphate permease - Arabidopsis thaliana>gb:ATCHRIV46_15455731009369 (2)pir|B71445|B714456e-38probable glycerol-3-phosphate permease - Arabidopsis thaliana>gb:ATCHRIV46_15455

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF015E22+ TT
                      ____________________________________________________________
consensus TT
 
. : . : . : . : . : . :
JMFF015E22+ GATCTGCNTGAATCCAATTCTCTCTTCACGAAAACATCACCANCTGGCCAAAAGTTGGAA
                      ____________________________________________________________
consensus GATCTGCNTGAATCCAATTCTCTCTTCACGAAAACATCACCANCTGGCCAAAAGTTGGAA
 
. : . : . : . : . : . :
JMFF015E22+ CTCAAGGTGGCANTATCGATAGACGAATTTGGATCCAAAACACTCTTGACTATGCTACTT
JMFF024O16+ AACACTCTTGACTATGCTACTT
                      ____________________________________________________________
consensus CTCAAGGTGGCANTATCGATAGACGAATTTGGATCCAAAACACTCTTGACTATGCTACTT
 
. : . : . : . : . : . :
JMFF015E22+ GGCTTCCTGGAAGCATGGTAAGATGTATATGCTATAAATGTTACAAACAAAACCACGTAT
JMFF024O16+ GGCTTCCTGGAAGCATGGTAAGATGTATATGCTATAAATGTTACAAACAAAACCACGTAT
                      ____________________________________________________________
consensus GGCTTCCTGGAAGCATGGTAAGATGTATATGCTATAAATGTTACAAACAAAACCACGTAT
 
. : . : . : . : . : . :
JMFF015E22+ CTATATGTCTTAAAGCTCCAATCTTTACCTCTGATGGTTCTTATCAGAGAAATCCCAGGT
JMFF024O16+ CTATATGTCTTAAAGCTCCAATCTTTACCTCTGATGGTTCTTATCAGAGAAATCCCAGGT
                      ____________________________________________________________
consensus CTATATGTCTTAAAGCTCCAATCTTTACCTCTGATGGTTCTTATCAGAGAAATCCCAGGT
 
. : . : . : . : . : . :
JMFF015E22+ GGGTTTCCCCTCGTAATCCCCTCAGCCTCCCGAGACATCTTGAAACGAAACTCAAACGAA
JMFF024O16+ GGGTTTCCCCTCGTAATCCCCTCAGCCTCCCGAGACATCTTGAAACGAAACTCAAACGAA
                      ____________________________________________________________
consensus GGGTTTCCCCTCGTAATCCCCTCAGCCTCCCGAGACATCTTGAAACGAAACTCAAACGAA
 
. : . : . : . : . : . :
JMFF015E22+ ACCAAACGAATCTGGCATCCNTGAAATTGAAAAACTCAAGCGCGTTTGCCGCGATGCCCA
JMFF024O16+ ACCAAACGAATCTGGCATCCTTGAAATTGAAAAACTCAAGCGCGTTTGCCGCGATGCCCA
                      ____________________________________________________________
consensus ACCAAACGAATCTGGCATCCTTGAAATTGAAAAACTCAAGCGCGTTTGCCGCGATGCCCA
 
. : . : . : . : . : . :
JMFF015E22+ AGATNGAAGTGCTGACACTGCANTGAATCGAAGGGATTTTTCTTCTGGTTTCGCGAGAGA
JMFF024O16+ AGATTGAAG---TGACACTGCANTGAATCGAAGGGATTTTTCTTCTGGTTTCGCGAGAGA
                      ____________________________________________________________
consensus AGATTGAAGTGCTGACACTGCANTGAATCGAAGGGATTTTTCTTCTGGTTTCGCGAGAGA
 
. : . : . : . : . : . :
JMFF015E22+ GTAAGAAAAGAGAAGGCGGTGGGCGAGAGAGAGAGAGAGAGAGAGAG
JMFF024O16+ GTAAGAAAAGAGAAGGCGGTGGGCGAGAGAGAGAGAGAGAGAGAGAGCATGGACGTTCGA
                      ____________________________________________________________
consensus GTAAGAAAAGAGAAGGCGGTGGGCGAGAGAGAGAGAGAGAGAGAGAGCATGGACGTTCGA
 
. : . : . : . : . : . :
JMFF024O16+ AACGAACGATTGGAATTTGGAAATGGAGAGAGAGACAGAGAAGGAAGTGTTGCGACTACC
                      ____________________________________________________________
consensus AACGAACGATTGGAATTTGGAAATGGAGAGAGAGACAGAGAAGGAAGTGTTGCGACTACC