Previous Contig 001186:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF024N23Sequence412001186 (2)gb:PTR306829_17027231e-16Populus tremula x Populus tremuloides mRNA for aux/IAA protein (IAA6 gene).705006788 (21)gb:AY087765_15727921e-68Arabidopsis thaliana clone 38286 mRNA, complete sequence.
JMFN031K09Sequence602001186 (2)pir|H71407|H714073e-50auxin-induced protein - Arabidopsis thaliana

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN031K09+ GTCGGCACATATTCAGAGGTGTTGAGTAGATCCATCAGTTTCCTCT
                      ____________________________________________________________
consensus GTCGGCACATATTCAGAGGTGTTGAGTAGATCCATCAGTTTCCTCT
 
. : . : . : . : . : . :
JMFN031K09+ CATTCATGAAATCTATCATTCCCTGGGCCCCATAATTGCCAGTAGTGAAGGAACTGAACA
                      ____________________________________________________________
consensus CATTCATGAAATCTATCATTCCCTGGGCCCCATAATTGCCAGTAGTGAAGGAACTGAACA
 
. : . : . : . : . : . :
JMFN031K09+ TGTTGGCCAAAGCATCAGAGAGTTGATTGTAGGTGTTATACACCTTCAAGTCCACCTTGC
                      ____________________________________________________________
consensus TGTTGGCCAAAGCATCAGAGAGTTGATTGTAGGTGTTATACACCTTCAAGTCCACCTTGC
 
. : . : . : . : . : . :
JMFN031K09+ GCAGGTAAGGTGCACCATCCATGCTCACCTTCACAAAATTATTACCACTTTTCTGATCAC
                      ____________________________________________________________
consensus GCAGGTAAGGTGCACCATCCATGCTCACCTTCACAAAATTATTACCACTTTTCTGATCAC
 
. : . : . : . : . : . :
JMFN031K09+ CTTCTTCACCATTATTGCTCTTCTGATGATGGGCCATTACATTCTTTCTGTAACTCCTAA
JMFF024N23+ CCATTATTGCTCTTCTGATGATGGGCCATTACATTCTTTCTGTAACTCCTAA
                      ____________________________________________________________
consensus CTTCTTCACCATTATTGCTCTTCTGATGATGGGCCATTACATTCTTTCTGTAACTCCTAA
 
. : . : . : . : . : . :
JMFN031K09+ CTGGTGGCCAACCCACCACTTGTGCCTTGGCAGGGGGCTTGATGGGGTCCTTGTTAGGCT
JMFF024N23+ CTGGTGGCCAACCCACCACTTGTGCCTTGGCAGGGGGCTTGATGGGGTCCTTGTTAGGCT
                      ____________________________________________________________
consensus CTGGTGGCCAACCCACCACTTGTGCCTTGGCAGGGGGCTTGATGGGGTCCTTGTTAGGCT
 
. : . : . : . : . : . :
JMFN031K09+ CCGGAGGAGCTTGCATCTTAGTCTCCGAGAGATCCAAGCAAGAGCCGTCGGATTGAAGGT
JMFF024N23+ CCGGAGGAGCTTGCATCTTAGTCTCCGAGAGATCCAAGCAAGAGCCGTCGGATTGAAGGT
                      ____________________________________________________________
consensus CCGGAGGAGCTTGCATCTTAGTCTCCGAGAGATCCAAGCAAGAGCCGTCGGATTGAAGGT
 
. : . : . : . : . : . :
JMFN031K09+ TGAGTTTGAGATCAACGGTCTCAGAGAAGCCTCGTTTTCCGGTGGTCTTCATGGACTCAT
JMFF024N23+ TGAGTTTGAGATCAACGGTCTCAGAGAAGCCTCGTTTTCCGGTGGTCTTCATGGACTCAT
                      ____________________________________________________________
consensus TGAGTTTGAGATCAACGGTCTCAGAGAAGCCTCGTTTTCCGGTGGTCTTCATGGACTCAT
 
. : . : . : . : . : . :
JMFN031K09+ TTTCATTTCCACCGCCGCTGCCGCCGGGAAGGCCCAGGCAAAGTTCAGTCTCTTTGAGAT
JMFF024N23+ TTTCATTTCCACCGCCGCTGCCGCCGGGAAGGCCCAGGCAAAGTTCAGTCTCTTTGAGAT
                      ____________________________________________________________
consensus TTTCATTTCCACCGCCGCTGCCGCCGGGAAGGCCCAGGCAAAGTTCAGTCTCTTTGAGAT
 
. : . : . : . : . : . :
JMFN031K09+ TCAGGCCGCCGTGTCCGAGCATATTCGTCATTTTCACGGAAGTACAGCTTTCTCTTCGCG
JMFF024N23+ TCAGGCCGCCGTGTCCGAGCATATTCGTCATTTTCACGGAAGTACAGCTTTCTCTTCGCG
                      ____________________________________________________________
consensus TCAGGCCGCCGTGTCCGAGCATATTCGTCATTTTCACGGAAGTACAGCTTTCTCTTCGCG
 
. : . : . : . : . : . :
JMFN031K09+ CCTTAATTTACTTTCT
JMFF024N23+ CCTTAATTTACTTTCTTCTTCTTCTTCAATAATAATATTTCAATGTAGATGAGAGAGAAT
                      ____________________________________________________________
consensus CCTTAATTTACTTTCTTCTTCTTCTTCAATAATAATATTTCAATGTAGATGAGAGAGAAT