Previous Contig 001183:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF024N05Sequence412001183 (5)pir|F96541|F965415e-30unknown protein [imported] - Arabidopsis thaliana>gb:AE005173_892970 Arabidopsis705001183 (5)gb:BT002789_16363913e-65Arabidopsis thaliana clone RAFL15-04-J16 (R20176) unknown protein (At1g50510) mR
JMFS024H11Sequence627001183 (5)pir|F96541|F965411e-72unknown protein [imported] - Arabidopsis thaliana>gb:AE005173_892970 Arabidopsis
JMSF038E07Sequence691001183 (5)pir|F96541|F965415e-72unknown protein [imported] - Arabidopsis thaliana>gb:AE005173_892970 Arabidopsis937001183 (5)gb:BT002789_16363914e-99Arabidopsis thaliana clone RAFL15-04-J16 (R20176) unknown protein (At1g50510) mR

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF024N05- ATCTCGTAAAAAGAAATAAGGGTGCAAGAGGTTCTTACTTGTGAA
rJMSF038E07- AAGGGTGCAAGAGGTTCTTACTTGTGAA
                      ____________________________________________________________
consensus ATCTCGTAAAAAGAAATAAGGGTGCAAGAGGTTCTTACTTGTGAA
 
. : . : . : . : . : . :
rJMFF024N05- TGTTAGAGTTCATACTAGCATCCACG-TTGTAAAACATCATAGTAACATCCTCTGCTTGT
rJMSF038E07- TGTTAGAGTTCATACTAGCATCCACGNTTGTAAAACATCATAGTAACATCCTCTGCTTGT
                      ____________________________________________________________
consensus TGTTAGAGTTCATACTAGCATCCACGNTTGTAAAACATCATAGTAACATCCTCTGCTTGT
 
. : . : . : . : . : . :
rJMFF024N05- TCTGAATAAACGGCAAAGTTACATTATTTCACTAATGAAGACAAGACGGTAACAGTTGTA
rJMSF038E07- TCTGAATAAACGGCAAAGTTACATTATTTCACTAATGAAGACAAGACGGTAACAGTTGTA
                      ____________________________________________________________
consensus TCTGAATAAACGGCAAAGTTACATTATTTCACTAATGAAGACAAGACGGTAACAGTTGTA
 
. : . : . : . : . : . :
rJMFF024N05- TGTAATATTGTAATGTGATCGATCATATAATCTGCGCCTATTTCAAGTATGACAGCGGAG
rJMSF038E07- TGTAATATTGTAATGTGATCGATCATATAATCTGCGCCTATTTCAAGTATGACAGCGGAG
                      ____________________________________________________________
consensus TGTAATATTGTAATGTGATCGATCATATAATCTGCGCCTATTTCAAGTATGACAGCGGAG
 
. : . : . : . : . : . :
rJMFF024N05- CTGAGCTAGGCTAACAGCAATTTTAGCACCAATAAGAGCATTGTTTTTCACAAGTGCAAT
rJMSF038E07- CTGAGCTAGGCTAACAGCAATTTTAGCACCAATAAGAGCATTGTTTTTCACAAGTGCAAT
                      ____________________________________________________________
consensus CTGAGCTAGGCTAACAGCAATTTTAGCACCAATAAGAGCATTGTTTTTCACAAGTGCAAT
 
. : . : . : . : . : . :
rJMFF024N05- ATTAGAAGCTAGAGAAGCTCCTCCAGTTAATTCATTTACTCTAGCCAGCAGGAATGGGGT
rJMSF038E07- ATTAGAAGCTAGAGAAGCTCCTCCAGTTAATTCATTTACTCTAGCCAGCAGGAATGGGGT
                      ____________________________________________________________
consensus ATTAGAAGCTAGAGAAGCTCCTCCAGTTAATTCATTTACTCTAGCCAGCAGGAATGGGGT
 
. : . : . : . : . : . :
rJMFF024N05- TTGAGCATTTCCTGTTATGTTTTTCTCCTCAGATTCTAGAAGAGCTCTTTGTATTGCAGA
rJMSF038E07- TTGAGCATTTCCTGTTATGTTTTTCTCCTCAGATTCTAGAAGAGCTCTTTGTATTGCAGA
                      ____________________________________________________________
consensus TTGAGCATTTCCTGTTATGTTTTTCTCCTCAGATTCTAGAAGAGCTCTTTGTATTGCAGA
 
. : . : . : . : . : . :
rJMFF024N05- TTCAATTAAGCTTCCTGAAGCAGAATGTTCTTTTGGGATAGGGACTGCTATTATGATCCC
rJMSF038E07- TTCAATTAAGCTTCCTGAAGCAGAATGTTCTTTTGGGATAGGGACTGCTATTATGATCCC
                      ____________________________________________________________
consensus TTCAATTAAGCTTCCTGAAGCAGAATGTTCTTTTGGGATAGGGACTGCTATTATGATCCC
 
. : . : . : . : . : . :
rJMFF024N05- AGTTTGAAGCCCAAGTTTAATGTTTGCATCAATTAGTCGAGCACAGTCTTCTGGCGTATC
rJMSF038E07- AGTTTGAAGCCCAAGTTTAATGTTTGCATCAATTAGTCGAGCACAGTCTTCTGGCGTATC
                      ____________________________________________________________
consensus AGTTTGAAGCCCAAGTTTAATGTTTGCATCAATTAGTCGAGCACAGTCTTCTGGCGTATC
 
. : . : . : . : . : . :
rJMFF024N05- TACCCGACAAGGTGCCTTGCAGCCGCTGGCTTCTGTAAAGAAAGCAGGAAATTCATTGGT
rJMSF038E07- TACCCGACAAGGTGCCTTGCAGCCGCTGGCTTCTGTAAAGAAAGCAGGAAATTCATTGGT
                      ____________________________________________________________
consensus TACCCGACAAGGTGCCTTGCAGCCGCTGGCTTCTGTAAAGAAAGCAGGAAATTCATTGGT
 
. : . : . : . : . : . :
rJMFF024N05- CTGATAAGCAGCAACACAAACCCCTTGAGTTTCCAAATACTCGAGAGTTCTTGGAATATC
rJMSF038E07- CTGATAAGCAGCAACACAAACCCCTTGAGTTTCCAAATACTCGAGAGTTCTTGGAATATC
JMFS024H11+ TTCCAAATACTCGAGAGTTCTTGGAATATC
JMSF038E07+ CTGATAAGCAGCAACACAAACCCCTTGAG-TTCCAAATACTCGAGAGTTCTTGGAATATC
                      ____________________________________________________________
consensus CTGATAAGCAGCAACACAAACCCCTTGAGTTTCCAAATACTCGAGAGTTCTTGGAATATC
 
. : . : . : . : . : . :
rJMFF024N05- TAATATTGACTTCACACCAGCTGAGATTACAGTTACAGGAGTCCTTCCAAGCTCAGTAAG
rJMSF038E07- TAATATTGACTTCACACCAGCTGAGATTACAGTTACAGGAGTCCTTCCAAGCTCAGTAAG
JMFS024H11+ TAATATTGACTTCACACCAGCTGAGATTACAGTTACAGGAGTCCTTCCAAGCTCAGTAAG
JMSF038E07+ TAATATTGACTTCACACCAGCTGAGATTACAGTTACAGGAGTCCTTCCAAGCTCAGTAAG
                      ____________________________________________________________
consensus TAATATTGACTTCACACCAGCTGAGATTACAGTTACAGGAGTCCTTCCAAGCTCAGTAAG
 
. : . : . : . : . : . :
rJMFF024N05- G
rJMSF038E07- GTCAGAAGATACATCCATTGTATTCTCTCCATCTCTATGCACTCCTCCAACACCACCAGT
JMFS024H11+ GTCAGAAGATACATCCATTGTATTCTCTCCATCTCTATGCACTCCTCCAACACCACCAGT
JMSF038E07+ GTCAGAAGATACATCCATTGTATTCTCTCCATCTCTATGCACTCCTCCAACACCACCAGT
                      ____________________________________________________________
consensus GTCAGAAGATACATCCATTGTATTCTCTCCATCTCTATGCACTCCTCCAACACCACCAGT
 
. : . : . : . : . : . :
rJMSF038E07- TACAAATATAGGAATCCCAGCCATAGAAGCAAAAAACATTGTTGCAGAAACAGTAGTTGC
JMFS024H11+ TACAAATATAGGAATCCCAGCCATAGAAGCAAAAAACATTGTTGCAGAAACAGTAGTTGC
JMSF038E07+ TACAAATATAGGAATCCCAGCCATAGAAGCAAAAAACATTGTTGCAGAAACAGTAGTTGC
                      ____________________________________________________________
consensus TACAAATATAGGAATCCCAGCCATAGAAGCAAAAAACATTGTTGCAGAAACAGTAGTTGC
 
. : . : . : . : . : . :
rJMSF038E07- ACCATTTCCTTTAGTAGCCACAACATGTGCAATATCTCTACGAGCGGTCTTTCGAGCTTT
JMFS024H11+ ACCATTTCCTTTAGTAGCCACAACATGTGCAATATCTCTACGAGCGGTCTTTCGAGCTTT
JMSF038E07+ ACCATTTCCTTTAGTAGCCACAACATGTGCAATATCTCTACGAGCGGTCTTTCGAGCTTT
                      ____________________________________________________________
consensus ACCATTTCCTTTAGTAGCCACAACATGTGCAATATCTCTACGAGCGGTCTTTCGAGCTTT
 
. : . : . : . : . : . :
rJMSF038E07- GCTTCCTAGGATTGCCAGCCTCTCCAATTCTTCCATACTC-AACCTATGCACGGGTATGC
JMFS024H11+ GCTTCCTAGGATTGCCAGCCTCTCCAATTCTTCCATACTCAAACCTATGCAC-GGTATGC
JMSF038E07+ GCTTCCTAGGATTGCCAGCCTCTCCAATTCTTCCATACTCAAACCTATGCAC-GGTATGC
JMFF024N05+ AGGATTGCCAGCCTCTCCAATTCTTCCATACTCAAACCTATGCAC-GGTATGC
                      ____________________________________________________________
consensus GCTTCCTAGGATTGCCAGCCTCTCCAATTCTTCCATACTCAAACCTATGCAC-GGTATGC
 
. : . : . : . : . : . :
rJMSF038E07- CATCCAAAAT
JMFS024H11+ CATCCAAAATAGCAATAGTGGCAGGTTCAGCTCCATTGGAACTCACAATTTCCTCCACCT
JMSF038E07+ CATCCAAAATAGCAATAGTGGCAGGTTCAGCTCCATTGGAACTCACAATTTCCTCCACCT
JMFF024N05+ CATCCAAAATAGCAATAGTGGCAGGTTCAGCTCCATTGGAACTCACAATTTCCTCCACCT
                      ____________________________________________________________
consensus CATCCAAAATAGCAATAGTGGCAGGTTCAGCTCCATTGGAACTCACAATTTCCTCCACCT
 
. : . : . : . : . : . :
JMFS024H11+ GTTTTGCTGTTTCCAGATTTTGAGGATAAGGCATTCCATGAGAGATAATGGTAGATTCAA
JMSF038E07+ GTTTTGCTGTTTCCAGATTTTGAGGATAAGGCATTCCATGAGAGATAATGGTAGATTCAA
JMFF024N05+ GTTTTGCTGTTTCCAGATTTTGAGGATAAGGCATTCCATGAGAGATAATGGTAGATTCAA
                      ____________________________________________________________
consensus GTTTTGCTGTTTCCAGATTTTGAGGATAAGGCATTCCATGAGAGATAATGGTAGATTCAA
 
. : . : . : . : . : . :
JMFS024H11+ GTGCAACAACTGGTCGTCCATGTGCTAATGCTTCAGAAACTTTAGGGGATATCTTAATCA
JMSF038E07+ GTGCAACAACTGGTCGTCCATGTGCTAATGCTTCAGAAACTTTAGGGGATATCTTAATCA
JMFF024N05+ GTGCAACAACTGGTCGTCCATGTGCTAATGCTTCAGAAACTTTAGGGGATATCTTAATCA
                      ____________________________________________________________
consensus GTGCAACAACTGGTCGTCCATGTGCTAATGCTTCAGAAACTTTAGGGGATATCTTAATCA
 
. : . : . : . : . : . :
JMFS024H11+ ACCCCTCATAACAACCCTTGACTAGAGTCGAACTAGTTAAGTGCCTCTGGATGATTGCTA
JMSF038E07+ ACCCCTCATAACAACCCTTGACTAGAGTCGAACTAGTTAAGTGCCTCTGGATGATTGCTA
JMFF024N05+ ACCCCTCATAACAACCCTTGACTAGAGTCGAACTAGTTAAGTGCCTCTGGATGATTGCTA
                      ____________________________________________________________
consensus ACCCCTCATAACAACCCTTGACTAGAGTCGAACTAGTTAAGTGCCTCTGGATGATTGCTA
 
. : . : . : . : . : . :
JMFS024H11+ GCCTGGACACAGCCGGAGACTCCATTTTGAGAGATAACTGATAACTCGTCGAG
JMSF038E07+ GCCTGGACACAGCCGGAGACTCCATTTTGAGAGATAACTGATAACTCGTCGAGCGATTCG
JMFF024N05+ GCCTGGACACAGCCGGAGACTCCATTTTGAGAGATAACTGATAACTCGTCGAGCGATTCG
                      ____________________________________________________________
consensus GCCTGGACACAGCCGGAGACTCCATTTTGAGAGATAACTGATAACTCGTCGAGCGATTCG
 
. : . : . : . : . : . :
JMSF038E07+ CCGGCGCCGGTGGAGGAGAAAAGACGGAAGTC
JMFF024N05+ CCGGCGCCGGTGGAGGAGAAAAGACGGAAGTCCTAGGCGTAGTATAAAACCTGGGGATTT
                      ____________________________________________________________
consensus CCGGCGCCGGTGGAGGAGAAAAGACGGAAGTCCTAGGCGTAGTATAAAACCTGGGGATTT