Previous Contig 001177:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF023D01Sequence380001177 (2)gb:AP004343_18405422e-07Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC clone:P061
JMFF024J22Sequence512001177 (2)gb:AP004343_18405424e-14Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC clone:P061754009358 (2)gb:AF229849_17790032e-43Vigna radiata pectin methylesterase isoform alpha (PME2) mRNA, partial cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF024J22+ GCNTTCGAGACAGGTGTACTGGTTGGTCATGG
                      ____________________________________________________________
consensus GCNTTCGAGACAGGTGTACTGGTTGGTCATGG
 
. : . : . : . : . : . :
JMFF024J22+ CGGTGCTGAGGAGTGTCTGCAAGTCGGCGTAGCGCTTTGCCGGAGAATTCTCGAGACCGT
                      ____________________________________________________________
consensus CGGTGCTGAGGAGTGTCTGCAAGTCGGCGTAGCGCTTTGCCGGAGAATTCTCGAGACCGT
 
. : . : . : . : . : . :
JMFF023D01+ AACGCGTCGGAGAACAGTTCCAGGCAGACGTGGAGAG
JMFF024J22+ CGAGGACTGTCCGGAGATCCGCCAACGTGTCGGAGAAAAGTTCCAGGCAGACGTAGAGAG
                      ____________________________________________________________
consensus CGAGGACTGTCCGGAGATCCGCCAACGTGTCGGAGAACAGTTCCAGGCAGACGTGGAGAG
 
. : . : . : . : . : . :
JMFF023D01+ CGCGCCTCTCCATCGTTCCCAGGTCGGGAACCACCCTCCGGATGCGGCTGCAGTTAGCGG
JMFF024J22+ CGCGGCTCTCCATCGTTCCCAGGTCGGGAACCACCCTCCGGATGCGGCTGCAGTTAGCGG
                      ____________________________________________________________
consensus CGCGGCTCTCCATCGTTCCCAGGTCGGGAACCACCCTCCGGATGCGGCTGCAGTTAGCGG
 
. : . : . : . : . : . :
JMFF023D01+ CGGCTGTTTTAATCTCCGACACGGTGACATTCACGGTGGCGGAGATTATTTCGGGGATAG
JMFF024J22+ CGGCTGTTGTAATCTCCGACACGGTGACATTCACGGTGGCGGAGATTATTTCGGGGATAG
                      ____________________________________________________________
consensus CGGCTGTTTTAATCTCCGACACGGTGACATTCACGGTGGCGGAGATTATTTCGGGGATAG
 
. : . : . : . : . : . :
JMFF023D01+ ATTTGGCGCGAAGATCGGGGGTTTTCACTAAGGTTGACACGCAGAGATCTCGGTAGAGGC
JMFF024J22+ ATTTGGCGCGAAGATCGGGGGTTTTCACTAAGGTTGACACGCAGAGATCACGGTAGAGGC
                      ____________________________________________________________
consensus ATTTGGCGCGAAGATCGGGGGTTTTCACTAAGGTTGACACGCAGAGATCTCGGTAGAGGC
 
. : . : . : . : . : . :
JMFF023D01+ TGTGATCACAAGCTGAATGGGCAACCTGATGAATGTCGTGTGAGGTTGTCGCGTTCATGG
JMFF024J22+ TGCGATCACAAGCTGAATGGGCAACCTGATGAATGTCGTCCGAGGTTGTCGCGTTCATGG
                      ____________________________________________________________
consensus TGTGATCACAAGCTGAATGGGCAACCTGATGAATGTCGTGTGAGGTTGTCGCGTTCATGG
 
. : . : . : . : . : . :
JMFF023D01+ CGGAGGATTGGAAGACTGTTAAAGACAAGAACGGCGCTAGTAGCACGACAGGAACCAACA
JMFF024J22+ CGTAGGATTGGAAGACTGTTAGAGACAAGAACGCCGCTAGTAGCACGACAGGAACCAACA
                      ____________________________________________________________
consensus CGTAGGATTGGAAGACTGTTAGAGACAAGAACGGCGCTAGTAGCACGACAGGAACCAACA
 
. : . : . : . : . : . :
JMFF023D01+ TTATGGGATTCCGTCCGAGGTTATCCATTTCG
JMFF024J22+ TTATCGGATTCCGTCCGAGGTTCTGCATTTCGGAATCTATAGTACTGTGATATGATCGCC
                      ____________________________________________________________
consensus TTATGGGATTCCGTCCGAGGTTCTGCATTTCGGAATCTATAGTACTGTGATATGATCGCC