Previous Contig 001172:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF003G21Sequence496001172 (25)gb:GDMAP4GEN_25725691e-04G.gallus mRNA for microtubule-associated protein 4.654001172 (25)gb:GDMAP4GEN_25725694e-04G.gallus mRNA for microtubule-associated protein 4.
JMFF006I07Sequence493001172 (25)gb:GDMAP4GEN_25725692e-04G.gallus mRNA for microtubule-associated protein 4.733001172 (25)gb:GDMAP4GEN_25725696e-04G.gallus mRNA for microtubule-associated protein 4.
JMFF024F21Sequence102001172 (25)547001172 (25)
JMFF029P01Sequence315001172 (25)704001172 (25)gb:GDMAP4GEN_25725690.002G.gallus mRNA for microtubule-associated protein 4.
JMFF035D12Sequence490001172 (25)gb:GDMAP4GEN_25725691e-04G.gallus mRNA for microtubule-associated protein 4.723001172 (25)gb:GDMAP4GEN_25725693e-04G.gallus mRNA for microtubule-associated protein 4.
JMFN008P02Sequence620001172 (25)gb:GDMAP4GEN_25725693e-04G.gallus mRNA for microtubule-associated protein 4.
JMFN010H19Sequence591001172 (25)gb:GDMAP4GEN_25725696e-05G.gallus mRNA for microtubule-associated protein 4.
JMFN011M03Sequence582001172 (25)gb:GDMAP4GEN_25725692e-04G.gallus mRNA for microtubule-associated protein 4.
JMFN016G23Sequence599001172 (25)gb:GDMAP4GEN_25725692e-04G.gallus mRNA for microtubule-associated protein 4.
JMFN019I01Sequence604001172 (25)gb:GDMAP4GEN_25725692e-04G.gallus mRNA for microtubule-associated protein 4.
JMFN020I05Sequence228001172 (25)
JMFN020L19Sequence614001172 (25)gb:GDMAP4GEN_25725692e-04G.gallus mRNA for microtubule-associated protein 4.
JMFN025N15Sequence612001172 (25)gb:GDMAP4GEN_25725692e-04G.gallus mRNA for microtubule-associated protein 4.
JMFN029K04Sequence615001172 (25)gb:GDMAP4GEN_25725692e-04G.gallus mRNA for microtubule-associated protein 4.
JMFN031A02Sequence597001172 (25)gb:GDMAP4GEN_25725692e-04G.gallus mRNA for microtubule-associated protein 4.
JMFN039I20Sequence637001172 (25)gb:GDMAP4GEN_25725693e-04G.gallus mRNA for microtubule-associated protein 4.
JMFN040C13Sequence609001172 (25)gb:GDMAP4GEN_25725692e-04G.gallus mRNA for microtubule-associated protein 4.
JMFN042K17Sequence613001172 (25)gb:GDMAP4GEN_25725692e-04G.gallus mRNA for microtubule-associated protein 4.
JMFN045F07Sequence597001172 (25)gb:GDMAP4GEN_25725692e-04G.gallus mRNA for microtubule-associated protein 4.
JMFN045G15Sequence607001172 (25)gb:GDMAP4GEN_25725690.001G.gallus mRNA for microtubule-associated protein 4.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF006I07- TTATTAAA
                      ____________________________________________________________
consensus TTATTAAA
 
. : . : . : . : . : . :
rJMFF029P01- AATATCAGAGTACACATTTTCTTCGATGTAATTAAGCTAATAATAATTAAAC
rJMFF003G21- AATATCAGAGTACACATTTTCTTCGATGTAATTAAGCTAATAATAATTAAAC
rJMFF006I07- TTAAAACAAATATCAGAGTACACATTTTCTTCGATGTAATTAAGCTAATAATAATTAAAC
rJMFF035D12- TACACATTTTCTTCGATGTAATTAAGCTAATAATAATTAAAC
                      ____________________________________________________________
consensus TTAAAACAAATATCAGAGTACACATTTTCTTCGATGTAATTAAGCTAATAATAATTAAAC
 
. : . : . : . : . : . :
rJMFF029P01- CTAAAGAGACGTAACATTGAAAAGGGAATAAACCAAACGTTTTTGTTTTATGTTTTATTT
rJMFF003G21- CTAAAGAGACGTAACATTGAAAAGGGAATAAACCAAACGTTTTTGTTTTATGTTTTATTT
rJMFF006I07- CTAAAGAGACGTAACATTGAAAGGGGAATAAACCAAACGTTTTTGTTTTATGTTTTATTT
rJMFF035D12- CTAAAGAGACGTAACATTGAAAAGGGAATAAACCAAACGTTTTTGTTTTATGTTTTATTT
                      ____________________________________________________________
consensus CTAAAGAGACGTAACATTGAAAAGGGAATAAACCAAACGTTTTTGTTTTATGTTTTATTT
 
. : . : . : . : . : . :
rJMFF024F21- TATTCTTTCATCTTATTTGTTT
rJMFF029P01- TTTATTTTTTTTTCTTATTGCTACTAATTAATTAATTATATTCTTTCATCTTATTTGTTT
rJMFF003G21- TTTATTTTTTTTTCTTATTGCTACTAATTAATTAATTATATTCTTTCATCTTATTTGTTT
rJMFF006I07- TTTATTTTTTTTTCTTATTGCTACTAATTAATTAATTATATTCTTTCATCTTATTTGTTT
JMFN029K04- CTTATTGCTACTAATTAATTAATTATATTCTTTCATCTTATTTGTTT
rJMFF035D12- TTTATTTTTTTTTCTTATTGCTACTAATTAATTAATTATATTCTTTCATCTTATTTGTTT
JMFN039I20+ ATTCTTTCATCTTATTGGTTT
                      ____________________________________________________________
consensus TTTATTTTTTTTTCTTATTGCTACTAATTAATTAATTATATTCTTTCATCTTATTTGTTT
 
. : . : . : . : . : . :
rJMFF024F21- TGTTTTGTTTTCATCTT-AGNAGATNGCTACGCGCCGTTGCTGATAATTTCTGCNGGGGG
rJMFF029P01- TGTTTTGTTTTCATCTT-AGTAGATAGCTACGCGCCGTTGCTGATAATTTCTGCAGGGGG
rJMFF003G21- TGTTTTGTTTTCATCTT-AGTAGATAGCTACGCGCCGTTGCTGATAATTTCTGCAGGGGG
rJMFF006I07- TGTTTTGTTTTCATCTT-AGTAGATAGCTACGCGCCGTTGCTGATAATTTCTGCAGGGGG
JMFN029K04- TGTTTTGTTTTCATCTT-AGTAAATAGCTACGCGCCGTTGCTGATAATTTCTGCAGGGGG
rJMFF035D12- TGTTTTGTTTTCATCTT-AGTAGATAGCTACGCGCCGTTGCTGATAATTTCTGCAGGGGG
JMFN039I20+ GGTTTG--TTTCATCTTAAGTAGATAGCTACGCGCCGTTGCTGATAATTTCTGCAGGGGG
JMFN042K17+ CATCTT-AGTAGATAGCTACGCGCCGTTGCTGATAATTTCTGCAGGGGG
JMFN025N15+ GATAGCTACGCGCCGTTGCTGATAATTTCTGCAGGGGG
JMFN045G15+ GCTACGCGCCGTTGCTGATAATTTCTGCAGGGGG
JMFN040C13+ GCTACGCGCCGTGNCTGATAATTTCTGCAGGGGG
JMFN016G23+ GCTACGCGCCGTTGCTGATAATTTCTGCAGGGGG
JMFN045F07+ TACGCGCCGTTGCTGATAATTTCTGCAGGGGG
JMFN019I01+ GCTACGCGCCGTGNCTGATAA-TTCTGCAGGGGG
JMFN010H19+ CGTTGCTGATAATTTCTGCAGGGGG
JMFN031A02+ GATAATTTCTGCAGGGGG
JMFN020L19+ AGATAGCTACGCGCCG-TGCTGAT-ATTTCTGCAGGGGG
JMFN011M03+ GTTGCTGATAATTTCTGCAGGGGG
JMFN008P02+ T-AGTAGATAGCTACGCGCCGTTGCTGATAATTTCTGCAGGGGG
                      ____________________________________________________________
consensus TGTTTTGTTTTCATCTT-AGTAGATAGCTACGCGCCGTTGCTGATAATTTCTGCAGGGGG
 
. : . : . : . : . : . :
rJMFF024F21- CANACTACTACCGGCGTNNCTCCCTCCGGCGGCGGCNGNTGACCCNCCTCCGCCGAGGCC
rJMFF029P01- CACACTACTACCGGCGTCGCTCCCTCCGGCGGCGGCGGCTGACCCGCCTCCGCCAAGGCC
rJMFF003G21- CACACTACTACCGGCGTCGCTCCCTCCGGCGGCGGCGGCTGACCCGCCTCCGCCAAGGCC
rJMFF006I07- CACACTACTACCGGCGTCGCTCCCTCCGGCGGCGGCGGCTGACCCGCCTCCGCCAAGGCC
JMFN029K04- CACACTACTACCGGCGTCGCTCCCTCCGGCGGCGGCGGCTGACCCGCCTCCGCCAAGGCC
rJMFF035D12- CACACTACTACCGGCGTCGCTCCCTCCGGCGGCGGCGGCTGACCCGCCTCCGCCAAGGCC
JMFN039I20+ CACACTACTACCGGCGTCGCTCCCTCCGGCGGCGGCGGCTGACCCGCCTCCGCCAAGGCC
JMFN042K17+ CACACTACTACCGGCGTCGCTCCCTCCGGCGGCGGCGGCTGACCCGCCTCCGCCAAGGCC
JMFN025N15+ CACACTACTACCGGCGTCGCTCCCTCCGGCGGCGGCGGCTGACCCGCCTCCGCCAAGGCC
JMFN045G15+ CACACTACTACCGGCGTCGCTCCCTCCGGCGGCGGCGGCTGACCCGCCTCCGCCAAGGCC
JMFN040C13+ CACACTACTACCGGCGTCGCTCCCTCCGGCGGCGGCGGCTGACCCGCCTCCGCCAAGGCC
JMFN016G23+ CACACTACTACCGGCGTCGCTCCCTCCGGCGGCGGCGGCTGACCCGCCTCCGCCAAGGCC
JMFN045F07+ CACACTACTACCGGCGTCGCTCCCTCCGGCGGCGGCGGCTGACCCGCCTCCGCCAAGGCC
JMFN019I01+ CACACTACTACCGGCGTCGCTCCCTCCGGCGGCGGCGGCTGACCCGCCACCGCCAAGGCC
JMFN010H19+ CACACTACTACCGGCGTCGCTCCCTCCGGCGGCGGCGGCTGACCCGCCTCCGCCAAGGCC
JMFN031A02+ CACACTACTACCGGCGTCGCTCCCTCCGGCGGCGGCGGCTGACCCGCCTCCGCCAAGGCC
JMFN020L19+ CACACTACTACCGGCGTCGCTCCCTCCGGCGGCGGCGGCTGACCCGCCTCCGCCAAGGCC
JMFN011M03+ CACACTACTACCGGCGTCGCTCCCTCCGGCGGCGGCGGCTGACCCGCCTCCGCCAAGGCC
JMFN008P02+ CACACTACTACCGGCGTCGCTCCCTCCGGCGGCGGCGGCTGACCCGCCTCCGCCAAGGCC
                      ____________________________________________________________
consensus CACACTACTACCGGCGTCGCTCCCTCCGGCGGCGGCGGCTGACCCGCCTCCGCCAAGGCC
 
. : . : . : . : . : . :
rJMFF024F21- ATCATCAANTCTANNCCCNGATGGGCCTCCGGGACCTCCNCCTATCGATCCAANCGGTGA
rJMFF029P01- AGCATCAAGTCTAGTCCCAAATGGGCCTCCGGGACCTCCACCTATCGATCCAAACGGTGA
rJMFF003G21- AGCATCAAGTCTAGTCCCAAATGGGCCTCCGGGACCTCCACCTATCGATCCAAACGGTGA
rJMFF006I07- AGCATCAAGTCTAGTCCCAAATGGGCCTCCGGGACCTCCACCTACCGATCCAAACGGTGA
JMFN029K04- AGCATCAAGTCTAGTCCCAAATGGGCCTCCGGGACCTCCACCTATCGATCCAAACGGTGA
rJMFF035D12- AGCATCAAGTCTAGTCCCAAATGGGCCTCCGGGACCTCCACCTATCGATCCAAACGGTGA
JMFN039I20+ AGCATCAAGTCTAGTCCCAAATGGGCCTCCGGGACCTCCACCTATCGATCCAAACGGTGA
JMFN042K17+ AGCATCAAGTCTAGTCCCAAATGGGCCTCCGGGACCTCCACCTATCGATCCAAACGGTGA
JMFN025N15+ AGCATCAAGTCTAGTCCCAAATGGGCCTCCGGGACCTCCACCTATCGATCCAAACGGTGA
JMFN045G15+ AGCATCAAGTCTAGTCCCAAATGGGCCTCCGGGACCTCCACCTATCGATCCAAACGGTGA
JMFN040C13+ AGCATCAAGTCTAGTCCCAAATGGGCCTCCGGGACCTCCACCTATCGATCCAAACGGTGA
JMFN016G23+ AGCATCAAGTCTAGTCCCAAATGGGCCTCCGGGACCTCCACCTATCGATCCAAACGGTGA
JMFN045F07+ AGCATCAAGTCTAGTCCCAAATGGGCCTCCGGGACCTCCACCTATCGATCCAAACGGTGA
JMFN019I01+ AGCATCAAGTCTAGTCCCAAATGGGCCTCCGGGACCTCCACCTATCGATCCAAACGGTGA
JMFN010H19+ AGCATCAAGTCTAGTCCCAAATGGGCCTCCGGGACCTCCACCTATCGATCCAAACGGTGA
JMFN031A02+ AGCATCAAGTCTAGTCCCAAATGGGCCTCCGGGACCTCCACCTATCGATCCAAACGGTGA
JMFN020L19+ AGCATCAAGTCTAGTCCCAAATGGGCCTCCGGGACCTCCACCTATCGATCCAAACGGTGA
JMFN011M03+ AGCATCAAGTCTAGTCCCAAATGGGCCTCCGGGACCTCCACCTATCGATCCAAACGGTGA
JMFN008P02+ AGCATCAAGTCTAGTCCCAAATGGGCCTCCGGGACCTCCACCTATCGATCCAAACGGTGA
JMFF035D12+ ATCCAAACGGTGA
JMFF006I07+ GATCCAAACGGTGA
JMFF003G21+ ATCGATCCAAACGGTGA
                      ____________________________________________________________
consensus AGCATCAAGTCTAGTCCCAAATGGGCCTCCGGGACCTCCACCTATCGATCCAAACGGTGA
 
. : . : . : . : . : . :
rJMFF024F21- TGAGCCAANAGGAANGCCTCCATAGCNANACCCNATTCNGCTTCCNCCTCCGGCGTCGTA
rJMFF029P01- TGAGCCAACAGGAAAGCCTCCATAGCCANACCCAATTCCGCTTCCACCTCCGGCGTCGTA
rJMFF003G21- TGAGCCAACAGGAAAGCCTCCATAGCCAGACCCAATTCCGCTTCCACCTCCGGCGTCGTA
rJMFF006I07- TGAGCCAACAGGAAAGCCTCCATAGCCAGACCCAATTCCGCTTCCACCTCCGGCGTCGTA
JMFN029K04- TGAGCCAACAGGAAAGCCTCCATAGCCAGACCCAATTCCGCTTCCACCTCCGGCGTCGTA
rJMFF035D12- TGAGCCAACAGGAAAGCCTCCATAGCCAGACCCAATTCCGCTTCCACCTCCGGCGTCGTA
JMFN039I20+ TGAGCCAACAGGAAAGCCTCCATAGCCAGACCCAATTCCGCTTCCACCTCCGGCGTCGTA
JMFN042K17+ TGAGCCAACAGGAAAGCCTCCATAGCCAGACCCAATTCCGCTTCCACCTCCGGCGTCGTA
JMFN025N15+ TGAGCCAACAGGAAAGCCTCCATAGCCAGACCCAATTCCGCTTCCACCTCCGGCGTCGTA
JMFN045G15+ TGAGCCAACAGGAAAGCCTCCATAGCCAGACCCAATTCCGCTTCCACCTCCGGCGTCGTA
JMFN040C13+ TGAGCCAACAGGAAAGCCTCCATAGCCAGACCCAATTCCGCTTCCACCTCCGGCGTCGTA
JMFN016G23+ TGAGCCAACAGGAAAGCCTCCATAGCCAGACCCAATTCCGCTTCCACCTCCGGCGTCGTA
JMFN045F07+ TGAGCCAACAGGAAAGCCTCCATAGCCAGACCCAATTCCGCTTCCACCTCCGGCGTCGTA
JMFN019I01+ TGAGCCAACAGGAAAGCCTCCATAGCCAGACCCAATTCCGCTTCCACCTCCGGCGTCGTA
JMFN010H19+ TGAGCCAACAGGAAAGCCTCCATAGCCAGACCCAATTCCGCTTCCACCTCCGGCGTCGTA
JMFN031A02+ TGAGCCAACAGGAAAGCCTCCATAGCCAGACCCAATTCCGCTTCCACCTCCGGCGTCGTA
JMFN020L19+ TGAGCCAACAGGAAAGCCTCCATAGCCAGACCCAATTCCGCTTCCACCTCCGGCGTCGTA
JMFN011M03+ TGAGCCAACAGGAAAGCCTCCATAGCCAGACCCAATTCCGCTTCCACCTCCGGCGTCGTA
JMFN008P02+ TGAGCCAACAGGAAAGCCTCCATAGCCAGACCCAATTCCGCTTCCACCTCCGGCGTCGTA
JMFF035D12+ TGAGCCAACAGGAAAGCCTCCATAGCCAGACCCAATTCCGCTTCCACCTCCGGCGTCGTA
JMFF006I07+ TGAGCCAACAGGAAAGCCTCCATAGCCAGACCCAATTCCGCTTCCACCTCCGGCGTCGTA
JMFF003G21+ TGAGCCAACAGGAAAGCCTCCATAGCCAGACCCAATTCCGCTTCCACCTCCGGCGTCGTA
                      ____________________________________________________________
consensus TGAGCCAACAGGAAAGCCTCCATAGCCAGACCCAATTCCGCTTCCACCTCCGGCGTCGTA
 
. : . : . : . : . : . :
rJMFF024F21- NCNNGATGCGCCACCGGGAANGCCAAACCNAGGNCCAGCACCGAAACCCGAGGAACCACC
rJMFF029P01- GCCAGATGCGCCACCGGGAAGGCCAAACCCAGGTCCAGCACCGAAACCCGAGGAACCACC
rJMFF003G21- GCCAGATGCGCCACCGGGAAGGCCAAACCCAGGNCCAGCACCGAAACCCGAGGAACCACC
rJMFF006I07- GCCAGATGCGCCACCGGGAAGGCCAAACCCAGGTCCAGCACCGAAACCCGAGGAACCACC
JMFN029K04- GCCAGATGCGCCACCGGGAAGGCCAAACCCAGGTCCAGCACCGAAACCCGAGGAACCACC
rJMFF035D12- GCCAGATGCGCCACCGGGAAGGCCAAACCCAGGTCCAGCACCGAAACCCGAGGAACCACC
JMFN039I20+ GCCAGATGCGCCACCGGGAAGGCCAAACCCAGGTCCAGCACCGAAACCCGAGGAACCACC
JMFN042K17+ GCCAGATGCGCCACCGGGAAGGCCAAACCCAGGTCCAGCACCGAAACCCGAGGAACCACC
JMFN025N15+ GCCAGATGCGCCACCGGGAAGGCCAAACCCAGGTCCAGCACCGAAACCCGAGGAACCACC
JMFN045G15+ GCCAGATGCGCCACCGGGAAGGCCAAACCCAGGTCCAGCACCGAAACCCGAGGAACCACC
JMFN040C13+ GCCAGATGCGCCACCGGGAAGGCCAAACCCAGGTCCAGCACCGAAACCCGAGGAACCACC
JMFN016G23+ GCCAGATGCGCCACCGGGAAGGCCAAACCCAGGTCCAGCACCGAAACCCGAGGAACCACC
JMFN045F07+ GCCAGATGCGCCACCGGGAAGGCCAAACCCAGGTCCAGCACCGAAACCCGAGGAACCACC
JMFN019I01+ GCCAGATGCGCCACCGGGAAGGCCAAACCCAGGTCCAGCACCGAAACCCGAGGAACCACC
JMFN010H19+ GCCAGATGCGCCACCGGGAAGGCCAAACCCAGGTCCAGCACCGAAACCCGAGGAACCACC
JMFN031A02+ GCCAGATGCGCCACCGGGAAGGCCAAACCCAGGTCCAGCACCGAAACCCGAGGAACCACC
JMFN020L19+ GCCAGATGCGCCACCGGGAAGGCCAAACCCAGGTCCAGCACCGAAACCCGAGGAACCACC
JMFN011M03+ GCCAGATGCGCCACCGGGAAGGCCAAACCCAGGTCCAGCACCGAAACCCGAGGAACCACC
JMFN008P02+ GCCAGATGCGCCACCGGGAAGGCCAAACCCAGGTCCAGCACCGAAACCCGAGGAACCACC
JMFF035D12+ GCCAGATGCGCCACCGGGAAGGCCAAACCCAGGTCCAGCACCGAAACCCGAGGAACCACC
JMFF006I07+ GCCAGATGCGCCACCGGGAAGGCCAAACCCAGGTCCAGCACCGAAACCCGAGGAACCACC
JMFF003G21+ GCCAGATGCGCCACCGGGAAGGCCAAACCCAGGTCCAGCACCGAAACCCGAGGAACCACC
                      ____________________________________________________________
consensus GCCAGATGCGCCACCGGGAAGGCCAAACCCAGGTCCAGCACCGAAACCCGAGGAACCACC
 
. : . : . : . : . : . :
rJMFF024F21- GCCANANCCTCCTCCGAANCTAGACCCGAACCCACCCCCGGATCCGGGNTGATCANAACC
rJMFF029P01- GCCAAACCCTCCTCCGAAGCTAGACCCGAACCCACCCCCGGATCCGGGTTGATCAAAACC
rJMFF003G21- GCCAAACCCTCCTCCGAAGCTAGACCCGAACCCACCCCCGGATCCGGGTTGATCAAAACC
rJMFF006I07- GCCAAACCCTCCTCCGAAGCTAGACCCGAACCCACCCCCGGATCCGGGTTGATCAAAACC
JMFN029K04- GCCAAACCCTCCTCCGAAGCTAGACCCGAACCCACCCCCGGATCCGGGTTGATCAAAACC
rJMFF035D12- GCCAAACCCTCCTCCGAAGCTAGACCCGAACCCACCCCCGGATCCGGGTTGATCAAAACC
JMFN039I20+ GCCAAACCCTCCTCCGAAGCTAGACCCGAACCCACCCCCGGATCCGGGTTGATCAAAACC
JMFN042K17+ GCCAAACCCTCCTCCGAAGCTAGACCCGAACCCACCCCCGGATCCGGGTTGATCAAAACC
JMFN025N15+ GCCAAACCCTCCTCCGAAGCTAGACCCGAACCCACCCCCGGATCCGGGTTGATCAAAACC
JMFN045G15+ GCCAAACCCTCCTCCGAAGCTAGACCCGAACCCACCCCCGGATCCGGGTTGATCAAAACC
JMFN040C13+ GCCAAACCCTCCTCCGAAGCTAGACCCGAACCCACCCCCGGATCCGGGTTGATCAAAACC
JMFN016G23+ GCCAAACCCTCCTCCGAAGCTAGACCCGAACCCACCCCCGGATCCGGGTTGATCAAAACC
JMFN045F07+ GCCAAACCCTCCTCCGAAGCTAGACCCGAACCCACCCCCGGATCCGGGTTGATCAAAACC
JMFN019I01+ GCCAAACCCTCCTCCGAAGCTAGACCCGAACCCACCCCCGGATCCGGGTTGATCAAAACC
JMFN010H19+ GCCAAACCCTCCTCCGAAGCTAGACCCGAACCCACCCCCGGATCCGGGTTGATCAAAACC
JMFN031A02+ GCCAAACCCTCCTCCGAAGCTAGACCCGAACCCACCCCCGGATCCGGGTTGATCAAAACC
JMFN020L19+ GCCAAACCCTCCTCCGAAGCTAGACCCGAACCCACCCCCGGATCCGGGTTGATCAAAACC
JMFN011M03+ GCCAAACCCTCCTCCGAAGCTAGACCCGAACCCACCCCCGGATCCGGGTTGATCAAAACC
JMFN008P02+ GCCAAACCCTCCTCCGAAGCTAGACCCGAACCCACCCCCGGATCCGGGTTGATCAAAACC
JMFF035D12+ GCCAAACCCTCCTCCGAAGCTAGACCCGAACCCACCCCCGGATCCGGGTTGATCAAAACC
JMFF006I07+ GCCAAACCCTCCTCCGAAGCTAGACCCGAACCCACCCCCGGATCCGGGTTGATCAAAACC
JMFF029P01+ GGATCCGGGTTGATCANAACC
JMFF003G21+ GCCAAACCCTCCTCCGAAGCTAGACCCGAACCCACCCCCGGATCCGGGTTGATCAAAACC
                      ____________________________________________________________
consensus GCCAAACCCTCCTCCGAAGCTAGACCCGAACCCACCCCCGGATCCGGGTTGATCAAAACC
 
. : . : . : . : . : . :
rJMFF024F21- CNATCCACCACCGNNGATGNCTGGGGNANGAAACCCGCCGCCGCCAANAAAACCCGGTCC
rJMFF029P01- CGATCCACCACCGCCGATGTCTGGGGTAGGAAACCCGCCGCCGCCAAGAAAACCCGGCCC
rJMFF003G21- CGATCCACCACCGCCGATGTCTGGGGTAGGAAACCCGCCGCCGNCAAGAAAACCCGGCCC
rJMFF006I07- CGACCCACCACCGCCGATGTCTGGGGTAGGAAACCCGCCGCCGCCAAGAAAACCCGGCCC
JMFN029K04- CGATCCACCACCGCCGATGTCTGGGGTAGGAAACCCGCCGCCGCCAAGAAAACCCGGCCC
rJMFF035D12- CGATCCACCACCGCCGATGTCTGGGGTAGGAAACCCGCCGCCGCCAAGAAAACCCGGCCC
JMFN039I20+ CGATCCACCACCGCCGATGTCTGGGGTAGGAAACCCGCCGCCGCCAAGAAAACCCGGCCC
JMFN042K17+ CGATCCACCACCGCCGATGTCTGGGGTAGGAAACCCGCCGCCGCCAAGAAAACCCGGCCC
JMFN025N15+ CGATCCACCACCGCCGATGTCTGGGGTAGGAAACCCGCCGCCGCCAAGAAAACCCGGCCC
JMFN045G15+ CGATCCACCACCGCCGATGTCTGGGGTAGGAAACCCGCCGCCGCCAAGAAAAACCGGCCC
JMFN040C13+ CGATCCACCACCGCCGATGTCTGGGGTAGGAAACCCGCCGCCGCCAAGAAAACCCGGCCC
JMFN016G23+ CGATCCACCACCGCCGATGTCTGGGGTAGGAAACCCGCCGCCGCCAAGAAAACCCGGCCC
JMFN045F07+ CGATCCACCACCGCCGATGTCTGGGGTAGGAAACCCGCCGCCGCCAAGAAAACCCGGCCC
JMFN019I01+ CGATCCACCACCGCCGATGTCTGGGGTAGGAAACCCGCCGCCGCCAAGAAAACCCGGCCC
JMFN010H19+ CGATCCACCACCACCGATGTCTGGGGTAGGAAACCCGCCGCCGCCAAGAAAACCCGGCCC
JMFN031A02+ CGATCCACCACCGCCGATGTCTGGGGTAGGAAACCCGCCGCCGCCAAGAAAACCCGGCCC
JMFN020L19+ CGATCCACCACCGCCGATGTCTGGGGTAGGAAACCCGCCGCCGCCAAGAAAACCCGGCCC
JMFN011M03+ CGATCCACCACCGCCGATGTCTGGGGTAGGAAACCCGCCGCCGCCAAGAAAACCCGGCCC
JMFN008P02+ CGATCCACCACCGCCGATGTCTGGGGTAGGAAACCCGCCGCCGCCAAGAAAACCCGGCCC
JMFF035D12+ CGATCCACCACCGCCGATGTCTGGGGTAGGAAACCCGCCGCCGCCAAGAAAACCCGGCCC
JMFF006I07+ CGACCCACCACCGCCGATGTCTGGGGTAGGAAACCCGCCGCCGCCAAGAAAACCCGGCCC
JMFF029P01+ CGATCCACCACCGCCGATGTCTGGGGTAGGAAACCCGCCGCCGCCAAGAAAACCCGGCCC
JMFN020I05+ AAAACCCGGCCC
JMFF003G21+ CGATCCACCACCGCCGATGTCTGGGGTAGGAAACCCGCCGCCGCCAAGAAAACCCGGCCC
                      ____________________________________________________________
consensus CGATCCACCACCGCCGATGTCTGGGGTAGGAAACCCGCCGCCGCCAAGAAAACCCGGCCC
 
. : . : . : . : . : . :
rJMFF024F21- TCCGNCGAACCNAGATCCTCCTCCTCCACCGCCGAAGNAAGGAGGAAACNCNTATTTGTN
rJMFF029P01- TCCGCCGAACCCAGATCCTCCTCCTCCACCGCCGAAGTAGGGAGGAAACCCATATTTGTA
rJMFF003G21- TCCGCCGAACCCAGATCCTCCTCCTCCACCGCCGAAGTAGGGAGGAAACCCATATTTGTA
rJMFF006I07- TCCGCCGAACCCAGATCCTCCTCCTCCACCGCCGAAGTAGGGAGGAAACCCATATTTGTA
JMFN029K04- TCCGCCGAACCCAGATCCTCCTCCTCCACCGCCGAAGTAGGGAGGAAACCCATATTTGTA
rJMFF035D12- TCCGCCGAACCCAGATCCTCCTCCTCCACCGCCGAAGTAGGGAGGAAACCCATATTTGTA
JMFN039I20+ TCCGCCGAACCCAGATCCTCCTCCTCCACCGCCGAAGTAGGGAGGAAACCCATATTTGTA
JMFN042K17+ TCCGCCGAACCCAGATCCTCCTCCTCCACCGCCGAAGTAGGGAGGAAACCCATATTTGTA
JMFN025N15+ TCCGCCGAACCCAGATCCTCCTCCTCCACCGCCGAAGTAGGGAGGAAACCCATATTTGTA
JMFN045G15+ TCCGCCGAACCCAGATCCTCCTCCTCCACCGCCGAAGTAGGGAGGAAACCCATATTTGTA
JMFN040C13+ TCCGCCGAACCCAGATCCTCCTCCTCCACCGCCGAAGTAGGGAGGAAACCCATATTTGTA
JMFN016G23+ TCCGCCGAACCCAGATCCTCCTCCTCCACCGCCGAAGTAGGGAGGAAACCCATATTTGTA
JMFN045F07+ TCCGCCGAACCCAGATCCTCCTCCTCCACCGCCGAAGTAGGGAGGAAACCCATATTTGTA
JMFN019I01+ TCCGCCGAACCCAGATCCTCCTCCTCCACCGCCGAAGTAGGGAGGAAACCCATATTTGTA
JMFN010H19+ TCCGCCGAACCCAGATCCTCCTCCTCCACCGCCGAAGTAGGGAGGAAACCCATATTTGTA
JMFN031A02+ TCCGCCGAACCCAGATCCTCCTCCTCCACCGCCGAAGTAGGGAGGAAACCCATATTTGTA
JMFN020L19+ TCCGCCGAACCCAGATCCTCCTCCTCCACCGCCGAAGTAGGGAGGAAACCCATATTTGTA
JMFN011M03+ TCCGCCGAACCCAGATCCTCCTCCTCCACCGCCGAAGTAGGGAGGAAACCCATATTTGTA
JMFN008P02+ TCCGCCGAACCCAGATCCTCCTCCTCCACCGCCGAAGTAGGGAGGAAACCCATATTTGTA
JMFF035D12+ TCCGCCGAACCCAGATCCTCCTCCTCCACCGCCGAAGTAGGGAGGAAACCCATATTTGTA
JMFF006I07+ TCCGCCGAACCCAGATCCTCCTCCTCCACCGCCGAAGTAGGGAGGAAACCCATATTTGTA
JMFF029P01+ TCCGCCGAACCCAGATCCTCCTCCTCCACCGCCGAAGTAGGGAGGAAACCCATATTTGTA
JMFN020I05+ TCCGCCGAACCCAGATCCTCCTCCTCCACCGCNGAAGTAGGGAGGAAACCCATATTTGTA
JMFF003G21+ TCCGCCGAACCCAGATCCTCCTCCTCCACCGCCGAAGTAGGGAGGAAACCCATATTTGTA
                      ____________________________________________________________
consensus TCCGCCGAACCCAGATCCTCCTCCTCCACCGCCGAAGTAGGGAGGAAACCCATATTTGTA
 
. : . : . : . : . : . :
rJMFF024F21- GTGGAAGAAAGTTTTCTGATCATCATCAACACCTTTCTTCTCCAAT
rJMFF029P01- GTGGAAGAAAGTTTTCTGATCATCATCAACACCTTTCTTCTCCAATCCTTCAC
rJMFF003G21- G
rJMFF006I07- GTGGAAGAAAGTTTTCTGATCATCATCAACACCTTTCTTCTCCAATCCTTCACTGCCGGC
JMFN029K04- GTGGAAGAAAGTTTTCTGATCATCATCAACACCTTTCTTCNTCCATCCTTCACTGC
rJMFF035D12- GTGGAAGAAAGTTTTCTGATCATCATCAACACCTTTCTTCTCCAATCCTTCACTGCCGGC
JMFN039I20+ GTGGAAGAAAGTTTTCTGATCATCATCAACACCTTTCTTCTCCAATCCTTCACTGCCGGC
JMFN042K17+ GTGGAAGAAAGTTTTCTGATCATCATCAACACCTTTCTTCTCCAATCCTTCACTGCCGGC
JMFN025N15+ GTGGAAGAAAGTTTTCTGATCATCATCAACACCTTTCTTCTCCAATCCTTCACTGCCGGC
JMFN045G15+ GTGGAAGAAAGTTTTCTGATCATCATCAACACCTTTCTTCTCCAATCCTTCACTGCCGGC
JMFN040C13+ GTGGAAGAAAGTTTTCTGATCATCATCAACACCTTTCTTCTCCAATCCTTCACTGCCGGC
JMFN016G23+ GTGGAAGAAAGTTTTCTGATCATCATCAACACCTTTCTTCTCCAATCCTTCACTGCCGGC
JMFN045F07+ GTGGAAGAAAGTTTTCTGATCATCATCAACACCTTTCTTCTCCAATCCTTCACTGCCGGC
JMFN019I01+ GTGGAAGAAAGTTTTCTGATCATCATCAACACCTTTCTTCTCCAATCCTTCACTGCCGGC
JMFN010H19+ GTGGAAGAAAGTTTTCTGATCATCATCAACACCTTTCTTCTCCAATCCTTCACTGCCGGC
JMFN031A02+ GTGGAAGAAAGTTTTCTGATCATCATCAACACCTTTCTTCTCCAATCCTTCACTGCCGGC
JMFN020L19+ GTGGAAGAAAGTTTTCTGATCATCATCAACACCTTTCTTCTCCAATCCTTCACTGCCGGC
JMFN011M03+ GTGGAAGAAAGTTTTCTGATCATCATCAACACCTTTCTTCTCCAATCCTTCACTGCCGGC
JMFN008P02+ GTGGAAGAAAGTTTTCTGATCATCATCAACACCTTTCTTCTCCAATCCTTCACTGCCGGC
JMFF035D12+ GTGGAAGAAAGTTTTCTGATCATCATCAACACCTTTCTTCTCCAATCCTTCACTGCCGGC
JMFF006I07+ GTGGAAGAAAGTTTTCTGATCATCATCAACACCTTTCTTCTCCAATCCTTCACTGCCGGC
JMFF029P01+ GTGGAAGAAAGTTTTNTGATCATCATCAACACCTTTCTTCTCCAATCCTTCACTGCCGGC
JMFN020I05+ GTGGAAGAAAGTTTTCTGATCATCATCAACACCTTTCTTCTCCAATCCTTCACTGCCGGC
JMFF003G21+ GTGGAAGAAAGTTTTCTGATCATCATCAACACCTTTCTTCTCCAATCCTTCACTGCCGGC
                      ____________________________________________________________
consensus GTGGAAGAAAGTTTTCTGATCATCATCAACACCTTTCTTCTCCAATCCTTCACTGCCGGC
 
. : . : . : . : . : . :
rJMFF006I07- GGCC-GG
rJMFF035D12- GGCCGGGACTAGCATTTGCGGC
JMFN039I20+ GGCC-GGACTAGCATTTGCGGCACAAACAAGGGCTCCGGCAAGGATTAACAGGAGAACTT
JMFN042K17+ GGCC-GGACTAGCATTTGCGGCACAAACAAGGGCTCCGGCAAGGATTAACAGGAGAACTT
JMFN025N15+ GGCC-GGACTAGCATTTGCGGCACAAACAAGGGCTCCGGCAAGGATTAACAGGAGAACTT
JMFN045G15+ GGCC-GGACTAGCATTTGCGGCACAAACAAGGGCTCCGGCAAGGATTAACAGGAGAACTT
JMFN040C13+ GGCC-GGACTAGCATTTGCGGCACAAACAAGGGCTCCGGCAAGGATTAACAGGAGAACTT
JMFN016G23+ GGCC-GGACTAGCATTTGCGGCACAAACAAGGGCTCCGGCAAGGATTAACAGGAGAACTT
JMFN045F07+ GGCC-GGACTAGCATTTGCGGCACAAACAAGGGCTCCGGCAAGGATTAACAGGAGAACTT
JMFN019I01+ GGCC-GGACTAGCATTTGCGGCACAAACAAGGGCTCCGGCAAGGATTAACAGGAGAACTT
JMFN010H19+ GGCC-GGACTAGCATTTGCGGCACAAACAAGGGCTCCGGCAAGGATTAACAGGAGAACTT
JMFN031A02+ GGCC-GGACTAGCATTTGCGGCACAAACAAGGGCTCCGGCAAGGATTAACAGGAGAACTT
JMFN020L19+ GGCC-GGACTAGCATTTGCGGCACAAACAAGGGCTCCGGCAAGGATTAACAGGAGAACTT
JMFN011M03+ GGCC-GGACTAGCATTTGCGGCACAAACAAGGGCTCCGGCAAGGATTAACAGGAGAACTT
JMFN008P02+ GGCC-GGACTAGCATTTGCGGCACAAACAAGGGCTCCGGCAAGGATTAACAGGAGAACTT
JMFF035D12+ GGCC-GGACTAGCATTTGCGGCACAAACAAGGGCTCCGGCAAGGATTAACAGGAGAACTT
JMFF006I07+ GGCC-GGACTAGCATTTGCGGCACAAACAAGGGCTCCGGCAAGGATTAACAGGAGAACTT
JMFF029P01+ GGCC-GGACTAGCATTTGCGGCACAAACAAGGGCTCCGGCAAGGATTAACAGGAGAACTT
JMFN020I05+ GGCC-GGACTAGCATTTGCGGCACAAACAAGGGCTCCGGCAAGGATTAACAGGAGAACTT
JMFF003G21+ GGCC-GGACTAGCATTTGCGGCACAAACAAGGGCTCCGGCAAGGATTAACAGGAGAACTT
JMFF024F21+ CGGCACAAACAAGGGCTCCGGCAAGGATTAACAGGAGAACTT
                      ____________________________________________________________
consensus GGCC-GGACTAGCATTTGCGGCACAAACAAGGGCTCCGGCAAGGATTAACAGGAGAACTT
 
. : . : . : . : . : . :
JMFN039I20+ TAGTCGCCATTTCCAGTGA
JMFN042K17+ TAGTCGCCATTTCCAGTGACGACTTG
JMFN025N15+ TAGTCGCCATTTCCAGTGACGACTTGTTGAAATTG
JMFN045G15+ TAGTCGCCATTTCCAGTGACGACTTGTTGAAATT
JMFN040C13+ TAGTCGCCATTTCCAGTGACGACTTGTTGAAATTGA
JMFN016G23+ TAGTCGCCATTTCCAGTGACGACTTG
JMFN045F07+ TAGTCGCCATTTCCAGTGACGACTTG
JMFN019I01+ TAGTCGCCATTTCCAGTGACGACTTGTTGAAA
JMFN010H19+ TAGTCGCCATTTCCAGTGACGACTTGT
JMFN031A02+ TAGTCGCCATTTCCAGTGACGACTTGT
JMFN020L19+ TAGTCGCCATTTCCAGTGACGA
JMFN011M03+ TAGTCGCCATTTCCAGTGA
JMFN008P02+ TAGTCGCCATTTCCAGTGACGACTTGTTGAAATTGAAA
JMFF035D12+ TAGTCGCCATTTCCAGTGACGACTTGTTGAAATTGAAATGATTTGGGATGAGAAT
JMFF006I07+ TAGTCGCCATTTCCAGTGACGACTTGTTGAAATTGAAATGATTTGGGATGAGAAT
JMFF029P01+ TAGTCGCCATTTCCAGTGACGACTTGTTGAAATTGAAATGATTTGGGATGAGAAT
JMFN020I05+ TAGTCGCCATTTCCAGTGACGACTTGTTGAAATT
JMFF003G21+ TAGTCGCCATTTCCAGTGACGACTTGTTGAAATTGAAATGATTTGGGATGAGAAT
JMFF024F21+ TAGTCGCCATTTCCAGTGACGACTTGTTGAAATTGAAATGATTTGGGATGAGAATATTGC
                      ____________________________________________________________
consensus TAGTCGCCATTTCCAGTGACGACTTGTTGAAATTGAAATGATTTGGGATGAGAATATTGC