Previous Contig 001169:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF024D13Sequence450001169 (2)781021215gb:AP005804_18581371e-56Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OSJN
JMFS047B05Sequence628001169 (2)

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS047B05+ CAAGTCGGACGATATGGCCATGGAGAAGTTTGCCGGCGTTGCGGGCTTTATT
                      ____________________________________________________________
consensus CAAGTCGGACGATATGGCCATGGAGAAGTTTGCCGGCGTTGCGGGCTTTATT
 
. : . : . : . : . : . :
JMFS047B05+ ATCTATGCAGGTTTGCAAAAGGTCCGCTATATACGAAGCGTTCGCCTTGGCTTGCATTAT
                      ____________________________________________________________
consensus ATCTATGCAGGTTTGCAAAAGGTCCGCTATATACGAAGCGTTCGCCTTGGCTTGCATTAT
 
. : . : . : . : . : . :
JMFS047B05+ TCAGAATTTCAGATTTTGAGATGCATAGCCATCTCTGTCTGCTTACTTCTGTCACATCGA
                      ____________________________________________________________
consensus TCAGAATTTCAGATTTTGAGATGCATAGCCATCTCTGTCTGCTTACTTCTGTCACATCGA
 
. : . : . : . : . : . :
JMFS047B05+ TAACAAAAAGTAGAGATTCTTCTTCTTGAACCAGATAATGTTGCAATCATCCTTGCTTCA
JMFF024D13+ CCAGATAATGTTGCAATCATCCTTGCTTCA
                      ____________________________________________________________
consensus TAACAAAAAGTAGAGATTCTTCTTCTTGAACCAGATAATGTTGCAATCATCCTTGCTTCA
 
. : . : . : . : . : . :
JMFS047B05+ ACTCAATCAGCTGCTGGTTTCAAATGCCACTGAGTTGAAAATTTAATATTCCTTAGATAC
JMFF024D13+ ACTCAATCAGCTGCTGGTTTCAAATGCCACTGAGTTGAAAATTTAATATTCCTTAGATAC
                      ____________________________________________________________
consensus ACTCAATCAGCTGCTGGTTTCAAATGCCACTGAGTTGAAAATTTAATATTCCTTAGATAC
 
. : . : . : . : . : . :
JMFS047B05+ GATTTTCTCCATTGATTTGTAGCTCCAAATTAGGGGTGTAAACGAGCTCGATCCTGGCTT
JMFF024D13+ GATTTTCTCCATTGATTTGTAGCTCCAAATTAGGGGTGTAAACGAGCTCGATCCTGGCTT
                      ____________________________________________________________
consensus GATTTTCTCCATTGATTTGTAGCTCCAAATTAGGGGTGTAAACGAGCTCGATCCTGGCTT
 
. : . : . : . : . : . :
JMFS047B05+ GGCTTGAGCTCGAGCTCGGCAATTTTCGAGCTCGGCTCGACCACCTCAATTGTTCGATTA
JMFF024D13+ GGCTTGAGCTCGAGCTCGGCAATTTTCGAGCTCGGCTCGACCACCTCAATTGTTCGATTA
                      ____________________________________________________________
consensus GGCTTGAGCTCGAGCTCGGCAATTTTCGAGCTCGGCTCGACCACCTCAATTGTTCGATTA
 
. : . : . : . : . : . :
JMFS047B05+ TTATTACCTGACCGGAGGTGGTGTGCTACGAACTTACGAAGGGGAAGGCGTTACTGCAGG
JMFF024D13+ TTATTACCTGACCGGAGGTGGTGTGCTACGAACTTACGAAGGGGAAGGCGTTACTGCAGG
                      ____________________________________________________________
consensus TTATTACCTGACCGGAGGTGGTGTGCTACGAACTTACGAAGGGGAAGGCGTTACTGCAGG
 
. : . : . : . : . : . :
JMFS047B05+ TTGGACTAGTGCTCATCGGCAGGGGTCTGGAGTTGGCGATGGCGGTTTGGAGGTGTCGAC
JMFF024D13+ TTGGACTAGTGCTCATCGGCAGGGGTCTGGAGTTGGCGATGGCGGTTTGGAGGTGTCGAC
                      ____________________________________________________________
consensus TTGGACTAGTGCTCATCGGCAGGGGTCTGGAGTTGGCGATGGCGGTTTGGAGGTGTCGAC
 
. : . : . : . : . : . :
JMFS047B05+ TCGTGACGGCGGCAGTTCGCGAAGTCTCTCAGAATTCGCGACTCGCGAAGACTACCTGCC
JMFF024D13+ TCGTGACGGCGGCAGTTCGCGAAGTCTCTCAGAATTCGCGACTCGCGAAGACTACCTGCC
                      ____________________________________________________________
consensus TCGTGACGGCGGCAGTTCGCGAAGTCTCTCAGAATTCGCGACTCGCGAAGACTACCTGCC
 
. : . : . : . : . : . :
JMFS047B05+ GTCTGCGTCTGCCTTTGGCAGATTAGATATGTTTTT
JMFF024D13+ GTCTGCGTCTGCCTTTGGCAGATTAGATATGTTTTTTACTGTTTTAAGGATTTAGATTAT
                      ____________________________________________________________
consensus GTCTGCGTCTGCCTTTGGCAGATTAGATATGTTTTTTACTGTTTTAAGGATTTAGATTAT