Previous Contig 001168:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF013K08Sequence598001168 (3)pir|S37212|S372123e-59beta-fructofuranosidase (EC 3.2.1.26) 1, 66.2K - Arabidopsis thaliana>gb:ATDNABF665008830 (2)gb:BVU508534_16432244e-52Beta vulgaris mRNA for fructan 6-exohydrolase (6-feh gene).
JMFF024D04Sequence468001168 (3)pir|S37212|S372122e-41beta-fructofuranosidase (EC 3.2.1.26) 1, 66.2K - Arabidopsis thaliana>gb:ATDNABF723008830 (2)gb:BVU422052_16432081e-60Beta vulgaris mRNA for exocellular acid invertase 1 (exinv1 gene).
JMFS095A11Sequence624001168 (3)gb:GMA563368_16803811e-65Glycine max mRNA for beta-fructofuranosidase (cwinv gene).

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS095A11+ TTCCCGTCAGGGCCTCGCCAGGCGGTGGTGGGGTCCCTAAA
JMFF013K08+ TAAA
                      ____________________________________________________________
consensus TTCCCGTCAGGGCCTCGCCAGGCGGTGGTGGGGTCCCTAAA
 
. : . : . : . : . : . :
JMFS095A11+ CGACGTAGCATTGATCTTGTTGTAATGGTTTGGCGCGATTAATGGATTCCGGGGCGATTT
JMFF013K08+ CGACGTAGCATTGATCTTGTTGTAATGGTTTGGCGCGATTAATGGATTCCGGGGCGATTT
                      ____________________________________________________________
consensus CGACGTAGCATTGATCTTGTTGTAATGGTTTGGCGCGATTAATGGATTCCGGGGCGATTT
 
. : . : . : . : . : . :
JMFS095A11+ TACCCATTCTTGGAGGTACGGGTCGGATGGGTTTCTGGGCACGGCCAAGTTCTGGACCTG
JMFF013K08+ TACCCATTCTTGGAGGTACGGGTCGGATGGGTTTCTGGGCACGGCCAAGTTCTGGACCTG
                      ____________________________________________________________
consensus TACCCATTCTTGGAGGTACGGGTCGGATGGGTTTCTGGGCACGGCCAAGTTCTGGACCTG
 
. : . : . : . : . : . :
JMFS095A11+ CCGGTTTCTTGAATCCACGCCGGTGTAGAGCAACGCCGGCATGTTGTTCGGAAGAATCGT
JMFF013K08+ CCGGTTTCTTGAATCCACGCCGGTGTAGAGCAACGCCGGCATGTTGTTCGGAAGAATCGT
JMFF024D04+ ATCCACGCCGGTGTAGAGCAACGCCGGCATGTTGTTCGGAAGAATCGT
                      ____________________________________________________________
consensus CCGGTTTCTTGAATCCACGCCGGTGTAGAGCAACGCCGGCATGTTGTTCGGAAGAATCGT
 
. : . : . : . : . : . :
JMFS095A11+ CGCCGAGCCGGACCATGCACCGTTGATATCGGCCGCCGGCTGGGATGGAGAGAGTGCAGG
JMFF013K08+ CGCCGAGCCGGACCATGCACCGTTGATATCGGCCGCCGGCTGGGATGGAGAGAGTGCAGG
JMFF024D04+ CGCCGAGCCGGACCATGCACCGTTGATATCGGCCGCCGGCTGGGATGGAGAGAGTGCAGG
                      ____________________________________________________________
consensus CGCCGAGCCGGACCATGCACCGTTGATATCGGCCGCCGGCTGGGATGGAGAGAGTGCAGG
 
. : . : . : . : . : . :
JMFS095A11+ GATATGAGCTCTCCAGTTAACTAGGTCTTTTGAAGTAGAGTGTCCCCATGATATCTTGCC
JMFF013K08+ GATATGAGCTCTCCAGTTAACTAGGTCTTTTGAAGTAGAGTGTCCCCATGATATCTTGCC
JMFF024D04+ GATATGAGCTCTCCAGTTAACTAGGTCTTTTGAAGTAGAGTGTCCCCATGATATCTTGCC
                      ____________________________________________________________
consensus GATATGAGCTCTCCAGTTAACTAGGTCTTTTGAAGTAGAGTGTCCCCATGATATCTTGCC
 
. : . : . : . : . : . :
JMFS095A11+ AAAACTTGCACCTTTTGGGTTGTATTGGTAGAAGAAATGGTACACTCCTTTATAAACCAT
JMFF013K08+ AAAACTTGCACCTTTTGGGTTGTATTGGTAGAAGAAATGGTACACTCCTTTATAAACCAT
JMFF024D04+ AAAACTTGCACCTTTTGGGTTGTATTGGTAGAAGAAATGGTACACTCCTTTATAAACCAT
                      ____________________________________________________________
consensus AAAACTTGCACCTTTTGGGTTGTATTGGTAGAAGAAATGGTACACTCCTTTATAAACCAT
 
. : . : . : . : . : . :
JMFS095A11+ AGGCCCATTTGGATCGTTCATCCAGTTCCTAGGAGGTTGGAAATGAAAAGAGGTTCTATA
JMFF013K08+ AGGCCCATTTGGATCGTTCATCCAGTTCCTAGGAGGTTGGAAATGAAAAGAGGTTCTATA
JMFF024D04+ AGGCCCATTTGGATCGTTCATCCAGTTCCTAGGAGGTTGGAAATGAAAAGAGGTTCTATA
                      ____________________________________________________________
consensus AGGCCCATTTGGATCGTTCATCCAGTTCCTAGGAGGTTGGAAATGAAAAGAGGTTCTATA
 
. : . : . : . : . : . :
JMFS095A11+ AGTATGGTTGGGGTAAGGTGGTTGGAGAGCTTCAAGGTTTTGTAGAACAATGTGTGAGGC
JMFF013K08+ AGTATGGTTGGGGTAAGGTGGTTGGAGAGCTTCAAGGTTTTGTAGAACAATGTGTGAGGC
JMFF024D04+ AGTATGGTTGGGGTAAGGTGGTTGGAGAGCTTCAAGGTTTTGTAGAACAATGTGTGAGGC
                      ____________________________________________________________
consensus AGTATGGTTGGGGTAAGGTGGTTGGAGAGCTTCAAGGTTTTGTAGAACAATGTGTGAGGC
 
. : . : . : . : . : . :
JMFS095A11+ TTGGGTTTCAACACCTCCATAGAGTACTAACAAGAGGAAAGAAATGGATAATAGCCAAAG
JMFF013K08+ TTGGGTTTCAACACCTCCATAGAGTACTAACAAGAGGAAAGAAATGGATAATAGCCAAAG
JMFF024D04+ TTGGGTTTCAACACCTCCATAGAGTACTAACAAGAGGAAAGAAATGGATAATAGCCAAAG
                      ____________________________________________________________
consensus TTGGGTTTCAACACCTCCATAGAGTACTAACAAGAGGAAAGAAATGGATAATAGCCAAAG
 
. : . : . : . : . : . :
JMFS095A11+ GCTATATGTATCACCCATGTTTATGTAGTTAGTATAATAGCTA
JMFF013K08+ GCTATATGTATCACCCATGTTTATGTAGTTAGTATAATAGCTATGTGAGGGGGT
JMFF024D04+ GCTATATGTATCACCCATGTTTATGTAGTTAGTATAATAGCTATGTGAGGGGGTGATGAC
                      ____________________________________________________________
consensus GCTATATGTATCACCCATGTTTATGTAGTTAGTATAATAGCTATGTGAGGGGGTGATGAC