Previous Contig 001163:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF008E08Sequence541001163 (6)gb:AY084387_15694772e-36Arabidopsis thaliana clone 106539 mRNA, complete sequence.655008538 (3)gb:AF436834_17998862e-40Arabidopsis thaliana AT3g14240/MLN21_2 mRNA, complete cds.
JMFF017E03Sequence508001163 (6)gb:AY084387_15694778e-39Arabidopsis thaliana clone 106539 mRNA, complete sequence.635008538 (3)gb:AF436834_17998861e-49Arabidopsis thaliana AT3g14240/MLN21_2 mRNA, complete cds.
JMFF023P16Sequence490001163 (6)gb:AY084387_15694777e-25Arabidopsis thaliana clone 106539 mRNA, complete sequence.700008538 (3)gb:AF436834_17998862e-51Arabidopsis thaliana AT3g14240/MLN21_2 mRNA, complete cds.
JMFS143B11Sequence615001163 (6)gb:AY084387_15694773e-57Arabidopsis thaliana clone 106539 mRNA, complete sequence.
JMFS166F04Sequence438001163 (6)gb:AY084387_15694771e-43Arabidopsis thaliana clone 106539 mRNA, complete sequence.
JMFS169E05Sequence586001163 (6)gb:AY084387_15694774e-52Arabidopsis thaliana clone 106539 mRNA, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS169E05+ ACCTC
JMFS143B11+ GCTTCATACCCGCTAAAAAAATACCTC
                      ____________________________________________________________
consensus GCTTCATACCCGCTAAAAAAATACCTC
 
. : . : . : . : . : . :
JMFS169E05+ GCTCCAATCAGCTTCCGGTANCAAGAACTCGCCGGAAAACCCCTCCCGGCAACGCACTCA
JMFS143B11+ GCTCCAATCAGCTTCCGGTTACAAGAACTCGCCGGAAAACCCCTCCCGGCAACGCACTCA
                      ____________________________________________________________
consensus GCTCCAATCAGCTTCCGGTTACAAGAACTCGCCGGAAAACCCCTCCCGGCAACGCACTCA
 
. : . : . : . : . : . :
JMFS169E05+ CCCTTCCACTTCGCCGGCACCGGCCCGAGATCTTCATCGCTAAAACTCTTCCTCTCCGGC
JMFS166F04+ TTCCACTTCGCCGGCACCGGCCCGAGATCTTCATCGCTAAAACTCTTCCTCTCCGGC
JMFS143B11+ CCCTTCCACTTCGCCGGCACCGGCCCGAGATCTTCATCGCTAAAACTCTTCCTCTCCGGC
JMFF017E03+ TTCATCGCTAAAACTCTTCCTCTCCGGC
JMFF008E08+ CTCCGGC
                      ____________________________________________________________
consensus CCCTTCCACTTCGCCGGCACCGGCCCGAGATCTTCATCGCTAAAACTCTTCCTCTCCGGC
 
. : . : . : . : . : . :
JMFS169E05+ CAGATCCCAGTATCTATAACTCCAATAACCAGGTCCGACCCGAAGTCCGATTCCTTCAGC
JMFS166F04+ CAGATCCCAGTATCTATAACTCCAATAACCAGGTCCGACCCGAAGTCCGATTCCTTCAGC
JMFS143B11+ CAGATCCCAGTATCTATAACTCCAATAACCAGGTCCGACCCGAAGTCCGATTCCTTCAGC
JMFF017E03+ CAGATCCCAGTATCTATAACTCCAATAACCAGGTCCGACCCGAAGTCCGATTCCTTCAGC
JMFF008E08+ CAGATCCCAGTATCTATAACTCCAATAACCAGGTCCGACCCGAAGTCCGATTCCTTCAGC
JMFF023P16+ TTCCTTCAGC
                      ____________________________________________________________
consensus CAGATCCCAGTATCTATAACTCCAATAACCAGGTCCGACCCGAAGTCCGATTCCTTCAGC
 
. : . : . : . : . : . :
JMFS169E05+ AGCCCAGCACTGTCCGTCCTCGTCAACCCAAGAAACTCCGGCGACCTGGTTGTCTCCAAA
JMFS166F04+ AGCCCAGCACTGTCCGTCCTCGTCAACCCAAGAAACTCCGGCGACCTGGTTGTCTCCAAA
JMFS143B11+ AGCCCAGCACTGTCCGTCCTCGTCAACCCAAGAAACTCCGGCGACCTGGTTGTCTCCAAA
JMFF017E03+ AGCCCAGCACTGTCCGTCCTCGTCAACCCAAGAAACTCCGGCGACCTGGTTGTCTCCAAA
JMFF008E08+ AGCCCAGCACTGTCCGTCCTCGTCAACCCAAGAAACTCCGGCGACCTGGTTGTCTCCAAA
JMFF023P16+ AGCCCAGCACTGTCCGTCCTCGTCAACCCAAGAAACTCCGGCGACCTGGTTGTCTCCAAA
                      ____________________________________________________________
consensus AGCCCAGCACTGTCCGTCCTCGTCAACCCAAGAAACTCCGGCGACCTGGTTGTCTCCAAA
 
. : . : . : . : . : . :
JMFS169E05+ CGCCTAACTTGCTCCGGAATGACCGCAAGAATCCCCGGCAAAGACTCCAGCTTTTGAGCT
JMFS166F04+ CGCCTAACTTGCTCCGGAATGACCGCAAGAATCCCCGGCAAAGACTCCAGCTTTTGAGCT
JMFS143B11+ CGCCTAACTTGCTCCGGAATGACCGCAAGAATCCCCGGCAAAGACTCCAGCTTTTGAGCT
JMFF017E03+ CGCCTAACTTGCTCCGGAATGACCGCAAGAATCCCCGGCAAAGACTCCAGCTTTTGAGCT
JMFF008E08+ CGCCTAACTTGCTCCGGAATGACCGCAAGAATCCCCGGCAAAGACTCCAGCTTTTGAGCT
JMFF023P16+ CGCCTAACTTGCTCCGGAATGACCGCAAGAATCCCCGGCAAAGACTCCAGCTTTTGAGCT
                      ____________________________________________________________
consensus CGCCTAACTTGCTCCGGAATGACCGCAAGAATCCCCGGCAAAGACTCCAGCTTTTGAGCT
 
. : . : . : . : . : . :
JMFS169E05+ TCCCACGCAGACATCTTCGCAGAAAACCCATGAAAAACATTGCCGTACGAATATATCATC
JMFS166F04+ TCCCACGCAGACATCTTCGCAGAAAACCCATGAAAAACATTGCCGTACGAATATATCATC
JMFS143B11+ TCCCACGCAGACATCTTCGCAGAAAACCCATGAAAAACATTGCCGTACGAATATATCATC
JMFF017E03+ TCCCACGCAGACATCTTCGCAGAAAACCCATGAAAAACATTGCCGTACGAATATATCATC
JMFF008E08+ TCCCACGCAGACATCTTCGCAGAAAACCCATGAAAAACATTGCCGTACGAATATATCATC
JMFF023P16+ TCCCACGCAGACATCTTCGCAGAAAACCCATGAAAAACATTGCCGTACGAATATATCATC
                      ____________________________________________________________
consensus TCCCACGCAGACATCTTCGCAGAAAACCCATGAAAAACATTGCCGTACGAATATATCATC
 
. : . : . : . : . : . :
JMFS169E05+ CGATTGGCCCCACCCCCGTCGTCATCGGCGCCGGCGGAAAGAGTCTTGAGTGAAGACTCG
JMFS166F04+ CGATTGGCCCCACCCCCGTCGTCATCGGCGCCGGCGGAAAGAGTCTTGAGTGAAGACTCG
JMFS143B11+ CGATTGGCCCCACCCCCGTCGTCATCGGCGCCGGCGGAAAGAGTCTTGAGTGAAGACTCG
JMFF017E03+ CGATTGGCCCCACCCCCGTCGTCATCGGCGCCGGCGGAAAGAGTCTTGAGTGAAGACTCG
JMFF008E08+ CGATTGGCCCCACCCCCGTCGTCATCGGCGCCGGCGGAAAGAGTCTTGAGTGAAGACTCG
JMFF023P16+ CGATTGGCCCCACCCCCGTCGTCATCGGCGCCGGCGGAAAGAGTCTTGAGTGAAGACTCG
                      ____________________________________________________________
consensus CGATTGGCCCCACCCCCGTCGTCATCGGCGCCGGCGGAAAGAGTCTTGAGTGAAGACTCG
 
. : . : . : . : . : . :
JMFS169E05+ TACCAGTGCTCGTGGGTCTGAAACACCGAAGGTTTAGCATCCCGCTGAACGTGAACGATG
JMFS166F04+ TACCAGTGCTCGTGGGTCTGAAACACCGAAGGTTTAGCATCCCGCTGAACGTGAACGATG
JMFS143B11+ TACCAGTGCTCGTGGGTCTGAAACACCGAAGGTTTAGCATCCCGCTGAACGTGAACGATG
JMFF017E03+ TACCAGTGCTCGTGGGTCTGAAACACCGAAGGTTTAGCATCCCGCTGAACGTGAACGATG
JMFF008E08+ TACCAGTGCTCGTGGGTCTGAAACACCGAAGGTTTAGCATCCCGCTGAACGTGAACGATG
JMFF023P16+ TACCAGTGCTCGTGGGTCTGAAACACCGAAGGTTTAGCATCCCGCTGAACGTGAACGATG
                      ____________________________________________________________
consensus TACCAGTGCTCGTGGGTCTGAAACACCGAAGGTTTAGCATCCCGCTGAACGTGAACGATG
 
. : . : . : . : . : . :
JMFS169E05+ AACGTTTTCCTTCCATCTCCGGTGGCTAAAACCGACGAGAGAAGTAATAAGGAAAGAAAA
JMFS166F04+ AACGTTTTCCTTCCATCTCCG
JMFS143B11+ AACGTTTTCCTTCCATCTCCGGTGGCTAAAACCGACGAGAGAAGTAATAAGGAAAGAAAA
JMFF017E03+ AACGTTTTCCTTCCATCTCCGGTGGCTAAAACCGACGAGAGAAGTAATAAGGAAAGAAAA
JMFF008E08+ AACGTTTTCCTTCCATCTCCGGTGGCTAAAACCGACGAGAGAAGTAATAAGGAAAGAAAA
JMFF023P16+ AACGTTTTCCTTCCATCTCCGGTGGCTAAAACCGACGAGAGAAGTAATAAGGAAAGAAAA
                      ____________________________________________________________
consensus AACGTTTTCCTTCCATCTCCGGTGGCTAAAACCGACGAGAGAAGTAATAAGGAAAGAAAA
 
. : . : . : . : . : . :
JMFS169E05+ CAAGAAAGCAGAAGAAC-AGTGTACTAACTGGAGAAAGAGAA
JMFS143B11+ CAAGAAAGCAGAAGAACAAGTGTACTAACTGGAGAAAGAGAAGAAATC
JMFF017E03+ CAAGAAAGCAGAAGAACAAGTGTACTAACTGGAGAAAGAGAAGAAATCGCCATTAGAGAG
JMFF008E08+ CAAGAAAGCAGAAGAACAAGTGTACTAACTGGAGAAAGAGAAGAAATCGCCATTAGAGAG
JMFF023P16+ CAAGAAAGCAGAAGAACAAGTGTACTAACTGGAGAAAGAGAAGAAATCGCCATTAGAGAG
                      ____________________________________________________________
consensus CAAGAAAGCAGAAGAACAAGTGTACTAACTGGAGAAAGAGAAGAAATCGCCATTAGAGAG
 
. : . : . : . : . : . :
JMFF008E08+ CATAGAAATGAGTGAAATGGGCAGCAATAATAATAAAAACAATGATAATAGTGC
JMFF023P16+ CATAGAAATGAGTGAAATGGGCAGCAATAATAATAAAAACAATGATAATAGTGCGCTACT
                      ____________________________________________________________
consensus CATAGAAATGAGTGAAATGGGCAGCAATAATAATAAAAACAATGATAATAGTGCGCTACT