Previous Contig 001161:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF019O08Sequence456001161 (3)pir|G84823|G848238e-35probable anthocyanin 5-aromatic acyltransferase [imported] - Arabidopsis thalian714009332 (3)pir|G84823|G848235e-80probable anthocyanin 5-aromatic acyltransferase [imported] - Arabidopsis thalian
JMFF023P12Sequence437001161 (3)pir|G84823|G848231e-30probable anthocyanin 5-aromatic acyltransferase [imported] - Arabidopsis thalian657009332 (3)pir|G84823|G848232e-72probable anthocyanin 5-aromatic acyltransferase [imported] - Arabidopsis thalian
JMFS049D02Sequence589001161 (3)pir|G84823|G848238e-61probable anthocyanin 5-aromatic acyltransferase [imported] - Arabidopsis thalian

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS049D02+ GTGTTAAAGAAGTTCCAGAAAGAGGTTCCGTCAG
                      ____________________________________________________________
consensus GTGTTAAAGAAGTTCCAGAAAGAGGTTCCGTCAG
 
. : . : . : . : . : . :
JMFS049D02+ CCACGGCGTGATTAACGGCGCAGCCAATGAACACGCCGTCGGCAAGCTCCGTCACCTGAA
                      ____________________________________________________________
consensus CCACGGCGTGATTAACGGCGCAGCCAATGAACACGCCGTCGGCAAGCTCCGTCACCTGAA
 
. : . : . : . : . : . :
JMFS049D02+ CACCGAGAATCGGACGAAAATGCCCCTGAAAGCTCACCGTCCGGTCAAACGGAAAAAACT
                      ____________________________________________________________
consensus CACCGAGAATCGGACGAAAATGCCCCTGAAAGCTCACCGTCCGGTCAAACGGAAAAAACT
 
. : . : . : . : . : . :
JMFS049D02+ CCGTCACCTCCTCCGGAACGTCCACCCCACCAATGACGTCCCGGACATAAACGTCAGTCG
JMFF019O08+ GGAACGTCCACCCCACCAATGACGTCCCGGACATAAACGTCAGTCG
JMFF023P12+ CATAAACGTCAGTCG
                      ____________________________________________________________
consensus CCGTCACCTCCTCCGGAACGTCCACCCCACCAATGACGTCCCGGACATAAACGTCAGTCG
 
. : . : . : . : . : . :
JMFS049D02+ CGCTGGCGTGAACGAAATCAGCGCCGGCGTCATTACACGCAACGTAAACGTATCCCTCCG
JMFF019O08+ CGCTGGCGTGAACGAAATCAGCGCCGGCGTCATTACACGCAACGTAAACGTATCCCTCCG
JMFF023P12+ CGCTGGCGTGAACGAAATCAGCGCCGGCGTCATTACACGCAACGTAAACGTATCCCTCCG
                      ____________________________________________________________
consensus CGCTGGCGTGAACGAAATCAGCGCCGGCGTCATTACACGCAACGTAAACGTATCCCTCCG
 
. : . : . : . : . : . :
JMFS049D02+ AGTCGGTCACCAGCCGGCCGGCGAGCGGAGGGAAGCTGGTAAGCGTCTGAGAAAGGCTCC
JMFF019O08+ AGTCGGTCACCAGCCGGCCGGCGAGCGGAGGGAAGCTGGTAAGCGTCTGAGAAAGGCTCC
JMFF023P12+ AGTCGGTCACCAGCCGGCCGGCGAGCGGAGGGAAGCTGGTAAGCGTCTGAGAAAGGCTCC
                      ____________________________________________________________
consensus AGTCGGTCACCAGCCGGCCGGCGAGCGGAGGGAAGCTGGTAAGCGTCTGAGAAAGGCTCC
 
. : . : . : . : . : . :
JMFS049D02+ GTTTCAGCAAGGAGATTAGATGGGCGATCGAGAACGGCGGGCGAGTGAAAAGCCCGCCTT
JMFF019O08+ GTTTCAGCAAGGAGATTAGATGGGCGATCGAGAACGGCGGGCGAGTGAAAAGCCCGCCTT
JMFF023P12+ GTTTCAGCAAGGAGATTAGATGGGCGATCGAGAACGGCGGGCGAGTGAAAAGCCCGCCTT
                      ____________________________________________________________
consensus GTTTCAGCAAGGAGATTAGATGGGCGATCGAGAACGGCGGGCGAGTGAAAAGCCCGCCTT
 
. : . : . : . : . : . :
JMFS049D02+ TCTGAATGTAGTGAGTGGAGAGCATAGGCAGGTCGGAAACGGAAAGTTTGAGGTCCGGGA
JMFF019O08+ TCTGAATGTAGTGAGTGGAGAGCATAGGCAGGTCGGAAACGGAAAGTTTGAGGTCCGGGA
JMFF023P12+ TCTGAATGTAGTGAGTGGAGAGCATAGGCAGGTCGGAAACGGAAAGTTTGAGGTCCGGGA
                      ____________________________________________________________
consensus TCTGAATGTAGTGAGTGGAGAGCATAGGCAGGTCGGAAACGGAAAGTTTGAGGTCCGGGA
 
. : . : . : . : . : . :
JMFS049D02+ GGGTGGATTCCTCCGCCGGAAAAACAGTACATTTGGCGATCAGAGTGGTGGAGGATTTAA
JMFF019O08+ GGGTGGATTCCTCCGCCGGAAAAACAGTACATTTGGCGATCAGAGTGGTGGAGGATTTAA
JMFF023P12+ GGGTGGATTCCTCCGCCGGAAAAACAGTACATTTGGCGATCAGAGTGGTGGAGGATTTAA
                      ____________________________________________________________
consensus GGGTGGATTCCTCCGCCGGAAAAACAGTACATTTGGCGATCAGAGTGGTGGAGGATTTAA
 
. : . : . : . : . : . :
JMFS049D02+ GGCAAGGCATTTTTAAGGAAAATTAACCACGACAAGACAGTGAATTGAATTTGTTGTTTC
JMFF019O08+ GGCAAGGCATTTTTAAGGAAAATTAACCACGACAAGACAGTGAATTGAATTTGTTGTTTC
JMFF023P12+ GGCAAGGCATTTTTAAGGAAAATTAACCACGACAAGACAGTGAATTGAATTTGTTGTTTC
                      ____________________________________________________________
consensus GGCAAGGCATTTTTAAGGAAAATTAACCACGACAAGACAGTGAATTGAATTTGTTGTTTC
 
. : . : . : . : . : . :
JMFS049D02+ TTGGCCGGTTGTTTG
JMFF019O08+ TTGGCCGGTTGTTTGTCGGAGTATATGGAGAAATGGGTATACGTTAAAGT
JMFF023P12+ TTGGCCGGTTGTTTGTCGGAGTATATGGAGAAATGGGTATACGTTAAAGTGAAGTGTGAG
                      ____________________________________________________________
consensus TTGGCCGGTTGTTTGTCGGAGTATATGGAGAAATGGGTATACGTTAAAGTGAAGTGTGAG