Previous Contig 001150:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF023K03Sequence507001150 (17)sp|Q38737|FIL1_ANTMA2e-17Stamen-specific protein FIL1 precursor.>pir|S40012|S40012 fil1 protein - garden 124001150 (17)
JMFF031M17Sequence525001150 (17)sp|Q38737|FIL1_ANTMA2e-17Stamen-specific protein FIL1 precursor.>pir|S40012|S40012 fil1 protein - garden 474001150 (17)sp|O24356|MEN8_SILLA7e-06MEN-8 protein precursor.>gb:SLMEN8_1715354 S.latifolia mRNA for Men-8 protein.
JMFF045N19Sequence615001150 (17)sp|Q38737|FIL1_ANTMA7e-20Stamen-specific protein FIL1 precursor.>pir|S40012|S40012 fil1 protein - garden 456021742
JMFN003P16Sequence622001150 (17)sp|Q38737|FIL1_ANTMA3e-17Stamen-specific protein FIL1 precursor.>pir|S40012|S40012 fil1 protein - garden
JMFN006O19Sequence600001150 (17)sp|Q38737|FIL1_ANTMA2e-17Stamen-specific protein FIL1 precursor.>pir|S40012|S40012 fil1 protein - garden
JMFN008I11Sequence609001150 (17)sp|Q38737|FIL1_ANTMA3e-17Stamen-specific protein FIL1 precursor.>pir|S40012|S40012 fil1 protein - garden
JMFN009I09Sequence617001150 (17)sp|Q38737|FIL1_ANTMA3e-17Stamen-specific protein FIL1 precursor.>pir|S40012|S40012 fil1 protein - garden
JMFN014G09Sequence611001150 (17)sp|Q38737|FIL1_ANTMA3e-17Stamen-specific protein FIL1 precursor.>pir|S40012|S40012 fil1 protein - garden
JMFN018O23Sequence595001150 (17)sp|Q38737|FIL1_ANTMA2e-17Stamen-specific protein FIL1 precursor.>pir|S40012|S40012 fil1 protein - garden
JMFN028G19Sequence410001150 (17)sp|Q38737|FIL1_ANTMA1e-17Stamen-specific protein FIL1 precursor.>pir|S40012|S40012 fil1 protein - garden
JMFN029K01Sequence602001150 (17)sp|Q38737|FIL1_ANTMA4e-17Stamen-specific protein FIL1 precursor.>pir|S40012|S40012 fil1 protein - garden
JMFN036J16Sequence538001150 (17)sp|Q38737|FIL1_ANTMA2e-17Stamen-specific protein FIL1 precursor.>pir|S40012|S40012 fil1 protein - garden
JMFN038B17Sequence575001150 (17)sp|Q38737|FIL1_ANTMA2e-17Stamen-specific protein FIL1 precursor.>pir|S40012|S40012 fil1 protein - garden
JMFN038O22Sequence620001150 (17)sp|Q38737|FIL1_ANTMA3e-17Stamen-specific protein FIL1 precursor.>pir|S40012|S40012 fil1 protein - garden
JMFN041N01Sequence606001150 (17)sp|Q38737|FIL1_ANTMA3e-17Stamen-specific protein FIL1 precursor.>pir|S40012|S40012 fil1 protein - garden

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN018O23+ ATGAAAATCTTTCATGTATATGTATTATTGGCTGGACTGGAAT
JMFN038B17+ TATTATTGGCTGGACTGGAAT
rJMFF031M17- TGGACTGGNAT
JMFN006O19+ AATGAAAATCTTTCATGTATATGTATTATTGGCTGGACTGGAAT
JMFN008I11+ AATGAAAATCTTTCATGTATATGTATTATTGGCTGGACTGGAAT
JMFN029K01+ AATGAAAATCTTTCATGTATATGTATTATTGGCTGGACTGGAAT
rJMFF023K03- GTATATGTATTATTGGCTGGACTGGAAT
JMFN003P16+ TTTAATGAAAATCTCTCATGTATATGTATTATTGGCTGGACTGGAAT
JMFN014G09+ TCTTTCATGTATATGTATTATTGGCTGGACTGGAAT
JMFN041N01+ GAAAATCTTTCATGTATATGTATTATTGGCTGGACTGGAAT
JMFN009I09+ TGAAAATCTTTCATGTATATGTATTATTGGCTGGACTGGAAT
JMFN038O22+ GAAAATCTTTCATGTATATGTATTATTGGCTGGACTGGAAT
JMFF045N19+ ATATGTATTATTGGCTGGACTGGAAT
                      ____________________________________________________________
consensus TTTAATGAAAATCTTTCATGTATATGTATTATTGGCTGGACTGGAAT
 
. : . : . : . : . : . :
JMFN018O23+ ACATTATTACACTCAAATTAATCTGATCAACATTACAAAGTTGATGT-CCTGTTGCAGGT
JMFN038B17+ ACATTATTACACTCAAATTAATCTGATCAACATTACAAAGTTGATGT-CCTGTTGCAGGT
rJMFF031M17- ACATTATTACACTCAAATTAATCTGATCNACATTACAAAGTTGATGT-CCTGTTGCAGGT
JMFN006O19+ ACATTATTACACTCAAATTAATCTGATCAACATTACAAAGTTGATGT-CCTGTTGCAGGT
JMFN008I11+ ACATTATTACACTCAAATTAATCTGATCAACATTACAAAGTTGATGT-CCTGTTGCAGGT
JMFN029K01+ ACATTATTACACTCAAATTAATCTGATCAACATTACAAAG-TGATGTCCCTGTTGCAGGT
rJMFF023K03- ACATTATTACACTCAAATTAATCTGATCAACATTACNAAGTTGATGT-CCTGTTGCAGGT
JMFN003P16+ ACATTATTACACTCAAATTAATCTGATCAACATTACAAAGTTGATGT-CCTGTTGCAGGT
JMFN014G09+ ACATTATTACACTCAAATTAATCTGATCAACATTACAAAGTTGATGT-CCTGTTGCAGGT
JMFN041N01+ ACATTATTACACTCAAATTAATCTGATCAACATTACAAAGTTGATGT-CCTGTTGCAGGT
JMFN036J16+ CAAAGTTGATGT-CCTGTGGCAGGT
JMFN028G19+ CATTACAAAGTTGATGT-CCTGTGCNAGGT
JMFN009I09+ ACATTATTACACTCAAATTAATCTGATCAACATTACAAAGTTGATGT-CCTGTTGCAGGT
JMFN038O22+ ACATTATTACACTCAAATTAATCTGATCAACATTACAAAGTTGATGT-CCTGTTGCAGGT
JMFF045N19+ ACATTATTACACTCAAATTAATCTGATCAACATACAAACGTTGATGT-CCTGTTGCAGGT
                      ____________________________________________________________
consensus ACATTATTACACTCAAATTAATCTGATCAACATTACAAAGTTGATGT-CCTGTTGCAGGT
 
. : . : . : . : . : . :
JMFN018O23+ CACA-AAGACCTTCTTTCTTATT--TAAAAAAAAAAAAAAATCATCAAAAGGAAACCTTT
JMFN038B17+ CACA-AAGACCTTCTTTCTTATT--TAAAAAAAAAAAAAAATCATCAAAAGGAAACCTTT
rJMFF031M17- CACATAAGACCTTCTTTCTTATT--TAAAAAAAAAAAAAAATCNTCAAAAGGAAACCTTT
JMFN006O19+ CACA-AAGACCTTCTTTCTTATT--TAAAAAAAAAAAAAAATCATCAAAAGGAAACCTTT
JMFN008I11+ CACA-AAGACCTTCTTTCTTATTTAAAAAAAAAAAAAAAAATCATCAAAAGGAAACCTTT
JMFN029K01+ CACA-AAGACCTTCTTTCTTATT---TAAAAAAAAAAAAAATCATCAAAAGGAAACCTTT
rJMFF023K03- CACA-AAGACCTTCTTTCTTATTT-AAAAAAAAANAAAA
JMFN003P16+ CACA-AAGACCTTCTTTCTTATTT-AAAAAAAAAAAAAAAATCATCAAAAGGAAACCTTT
JMFN014G09+ CACA-AAGACCTTCTTTCTTATT--TAAAAAAAAAAAAAAATCATCAAAAGGAAACCTTT
JMFN041N01+ CACA-AAGACCTTCTTTCTTATT--TAAAAAAAAAAAAAAATCATCAAAAGGAAACCTTT
JMFN036J16+ CACA-AAGACCTTCTTTCTTATT---TAAAAAAAAAAAAAATCATCAAAAGGAAACCTTT
JMFN028G19+ CACA-AAGACCTTCTTTCTTATT---TAAAAAAAAAAAAAATCATCAAAAGGAAACCTTT
JMFN009I09+ CACA-AAGACCTTCTTTCTTATT--TAAAAAAAAAAAAAAATCATCAAAAGGAAACCTTT
JMFN038O22+ CACA-AAGACCTTCTTTCTTATT--TAAAAAAAAAAAAAAATCATCAAAAGGAAACCTTT
JMFF045N19+ CACA-AAGACCTTCTTTCTTATTN-AAAAAAAAAAAAAAAATCATCAAAAGGAAACCTTT
JMFF031M17+ TTATT--TAAAAAAAAAAAAAAATCATCAAAAGGAAACCTTT
JMFF023K03+ AAAAAAAAAATCATCAAAAGGAAACCTTT
                      ____________________________________________________________
consensus CACA-AAGACCTTCTTTCTTATT--TAAAAAAAAAAAAAAATCATCAAAAGGAAACCTTT
 
. : . : . : . : . : . :
JMFN018O23+ AGGCTCACCAACAATATGATGAGCAGTAATAGATCTTTAACTTTATTCATCCACCACCTT
JMFN038B17+ AGGCTCACCAACAATATGATGAGCAGTAATAGATCTTTAACTTTATTCATCCACCACCTT
rJMFF031M17- AGGCTCCCCANCAATATGATGANCAGTAATAAATCTTTAACTTTATTCNTCCNCCNCCTT
JMFN006O19+ AGGCTCACCAACAATATGATGAGCAGTAATAGATCTTTAACTTTATTCATCCACCACCTT
JMFN008I11+ AGGCTCACCAACAATATGATGAGCAGTAATAGATCTTTAACTTTATTCATCCACCACCTT
JMFN029K01+ AGGCTCACCAACAATATGATGAGCAGTAATAGATCTTTAACTTTATTCATCCACCACCTT
JMFN003P16+ AGGCTCACCAACAATATGATGAGCAGTAATAGATCTTTAACTTTATTCATCCACCACCTT
JMFN014G09+ AGGCTCACCAACAATATGATGAGCAGTAATAGATCTTTAACTTTATTCATCCACCACCTT
JMFN041N01+ AGGCTCACCAACAATATGATGAGCAGTAATAGATCTTTAACTTTATTCATCCACCACCTT
JMFN036J16+ AGGCTCACCAACAATATGATGAGCAGTAATAGATCTTTAACTTTATTCATCCACCACCTT
JMFN028G19+ AGGCTCACCAACAATATGATGAGCAGTAATAGATCTTTAACTTTATTCATCCACCACCTT
JMFN009I09+ AGGCTCACCAACAATATGATGAGCAGTAATAGATCTTTAACTTTATTCATCCACCACCTT
JMFN038O22+ AGGCTCACCAACAATATGATGAGCAGTAATAGATCTTTAACTTTATTCATCCACCACCTT
JMFF045N19+ AGGCTCACCAACAATATGATGAGCAGTAATAGATCTTTAACTTTATTCATCCACCACCTT
JMFF031M17+ AGGCTCACCAACAATATGATGAGCAGTAATAGATCTTTAACTTTATTCATCCACCACCTT
JMFF023K03+ AGGCTCACCAACAATATGATGAGCAGTAATAGATCTTTAACTTTATTCATCCACCACCTT
                      ____________________________________________________________
consensus AGGCTCACCAACAATATGATGAGCAGTAATAGATCTTTAACTTTATTCATCCACCACCTT
 
. : . : . : . : . : . :
JMFN018O23+ AGCTTAGCTTGCTTCTCATCTCGATCAATTCGCGGGGCAAGAGAGAGGAGGGATGTTGCA
JMFN038B17+ AGCTTAGCTTGCTTCTCATCTCGATCAATTCGCGGGGCAAGAGAGAGGAGGGATGTTGCA
rJMFF031M17- ACCTTANCTNGCTTCNCATCNCNATCAATTCCCGGGGCAAAAAAAAGGAGGGATGTTGCN
JMFN006O19+ AGCTTAGCTTGCTTCTCATCTCGATCAATTCGCGGGGCAAGAGAGAGGAGGGATGTTGCA
JMFN008I11+ AGCTTAGCTTGCTTCTCATCTCGATCAATTCGCGGGGCAAGAGAGAGGAGGGATGTTGCA
JMFN029K01+ AGCTTAGCTTGCTTCTCATCTCGATCAATTCGCGGGGCAAGAGAGAGGAGGGATGTTGCA
JMFN003P16+ AGCTTAGCTTGCTTCTCATCTCGATCAATTCGCGGGGCAAGAGAGAGGAGGGATGTTGCA
JMFN014G09+ AGCTTAGCTTGCTTCTCATCTCGATCAATTCGCGGGGCAAGAGAGAGGAGGGATGTTGCA
JMFN041N01+ AGCTTAGCTTGCTTCTCATCTCGATCAATTCGCGGGGCAAGAGAGAGGAGGGATGTTGCA
JMFN036J16+ AGCTTAGCTTGCTTCTCATCTCGATCAATTCGCGGGGCAAGAGAGAGGAGGGATGTTGCA
JMFN028G19+ AGCTTAGCTTGCTTCTCATCTCGATCAATTCGCGGGGCAAGAGAGAGGAGGGATGTTGCA
JMFN009I09+ AGCTTAGCTTGCTTCTCATCTCGATCAATTCGCGGGGCAAGAGAGAGGAGGGATGTTGCA
JMFN038O22+ AGCTTAGCTTGCTTCTCATCTCGATCAATTCGCGGGGCAAGAGAGAGGAGGGATGTTGCA
JMFF045N19+ AGCTTAGCTTGCTTCTCATCTCGATCAATTCGCGGGGCAAGAGAGAGGAGGGATGTTGCA
JMFF031M17+ AGCTTAGCTTGCTTCTCATCTCGATCAATTCGCGGGGCAAGAGAGAGGAGGGATGTTGCA
JMFF023K03+ AGCTTAGCTTGCTTCTCATCTCGATCAATTCGCGGGGCAAGAGAGAGGAGGGATGTTGCA
                      ____________________________________________________________
consensus AGCTTAGCTTGCTTCTCATCTCGATCAATTCGCGGGGCAAGAGAGAGGAGGGATGTTGCA
 
. : . : . : . : . : . :
JMFN018O23+ CTGAGAGGGAAGGCGGGCGGAGACGCGGAGCGTGTTGCAAATGCAGTCGCGGTCGACGGA
JMFN038B17+ CTGAGAGGGAAGGCGGGCGGAGACGCGGAGCGTGTTGCAAATGCAGTCGCGGTCGACGGA
rJMFF031M17- CTGAAAGGGAAGGNGGGCGGAAACCCGGANCGNGTTGCAAATGCAGNCNCGGNCNACGGA
JMFN006O19+ CTGAGAGGGAAGGCGGGCGGAGACGCGGAGCGTGTTGCAAATGCAGTCGCGGTCGACGGA
JMFN008I11+ CTGAGAGGGAAGGCGGGCGGAGACGCGGAGCGTGTTGCAAATGCAGTCGCGGTCGACGGA
JMFN029K01+ CTGAGAGGGAAGGCGGGCGGAGACGCGGAGCGTGTTGCAAATGCAGTCGCGGTCGACGGA
JMFN003P16+ CTGAGAGGGAAGGCGGGCGGAGACGCGGAGCGTGTTGCAAATGCAGTCGCGGTCGACGGA
JMFN014G09+ CTGAGAGGGAAGGCGGGCGGAGACGCGGAGCGTGTTGCAAATGCAGTCGCGGTCGACGGA
JMFN041N01+ CTGAGAGGGAAGGCGGGCGGAGACGCGGAGCGTGTTGCAAATGCAGTCGCGGTCGACGGA
JMFN036J16+ CTGAGAGGGAAGGCGGGCGGAGACGCGGAGCGTGTTGCAAATGCAGTCGCGGTCGACGGA
JMFN028G19+ CTGAGAGGGAAGGCGGGCGGAGACGCGGAGCGTGTTGCAAATGCAGTCGCGGTCGACGGA
JMFN009I09+ CTGAGAGGGAAGGCGGGCGGAGACGCGGAGCGTGTTGCAAATGCAGTCGCGGTCGACGGA
JMFN038O22+ CTGAGAGGGAAGGCGGGCGGAGACGCGGAGCGTGTTGCAAATGCAGTCGCGGTCGACGGA
JMFF045N19+ CTGAGAGGGAAGGCGGGCGGAGACGCGGAGCGTGTTGCAAATGCAGTCGCGGTCGACGGA
JMFF031M17+ CTGAGAGGGAAGGCGGGCGGAGACGCGGAGCGTGTTGCAAATGCAGTCGCGGTCGACGGA
JMFF023K03+ CTGAGAGGGAAGGCGGGCGGAGACGCGGAGCGTGTTGCAAATGCAGTCGCGGTCGACGGA
                      ____________________________________________________________
consensus CTGAGAGGGAAGGCGGGCGGAGACGCGGAGCGTGTTGCAAATGCAGTCGCGGTCGACGGA
 
. : . : . : . : . : . :
JMFN018O23+ TTGGAGGGCGACGCAGCAGTCGGCGCTGGGGTTCGAGGCGGTCATGCCGGGCATCACGAA
JMFN038B17+ TTGGAGGGCGACGCAGCAGTCGGCGCTGGGGTTCGAGGCGGTCATGCCGGGCATCACGAA
rJMFF031M17- TTGGAGGGCNACCCACCANNCGGCNCTGGGGTTCNAGGNGGNCNTGCCGGGCATCNCAAA
JMFN006O19+ TTGGAGGGCGACGCAGCAGTCGGCGCTGGGGTTCGAGGCGGTCATGCCGGGCATCACGAA
JMFN008I11+ TTGGAGGGCGACGCAGCAGTCGGCGCTGGGGTTCGAGGCGGTCATGCCGGGCATCACGAA
JMFN029K01+ TTGGAGGGCGACGCAGCAGTCGGCGCTGGGGTTCAAGGCGGTCATGCCGGGCATCACGAA
JMFN003P16+ TTGGAGGGCGACGCAGCAGTCGGCGCTGGGGTTCGAGGCGGTCATGCCGGGCATCACGAA
JMFN014G09+ TTGGAGGGCGACGCAGCAGTCGGCGCTGGGGTTCGAGGCGGTCATGCCGGGCATCACGAA
JMFN041N01+ TTGGAGGGCGACGCAGCAGTCGGCGCTGGGGTTCGAGGCGGTCATGCCGGGCATCACGAA
JMFN036J16+ TTGGAGGGCGACGCAGCAGTCGGCGCTGGGGTTCGAGGCGGTCATGCCGGGCATCACGAA
JMFN028G19+ TTGGAGGGCGACGCAGCAGTCGGCGCTGGGGTTCGAGGCGGTCATGCCGGGCATCACGAA
JMFN009I09+ TTGGAGGGCGACGCAGCAGTCGGCGCTGGGGTTCGAGGCGGTCATGCCGGGCATCACGAA
JMFN038O22+ TTGGAGGGCGACGCAGCAGTCGGCGCTGGGGTTCGAGGCGGTCATGCCGGGCATCACGAA
JMFF045N19+ TTGGAGGGCGACGCAGCAGTCGGCGCTGGGGTTCGAGGCGGTCATGCCGGGCACCACGAA
JMFF031M17+ TTGGAGGGCGACGCAGCAGTCGGCGCTGGGGTTCGAGGCGGTCATGCCGGGCATCACGAA
JMFF023K03+ TTGGAGGGCGACGCAGCAGTCGGCGCTGGGGTTCGAGGCGGTCATGCCGGGCATCACGAA
                      ____________________________________________________________
consensus TTGGAGGGCGACGCAGCAGTCGGCGCTGGGGTTCGAGGCGGTCATGCCGGGCATCACGAA
 
. : . : . : . : . : . :
JMFN018O23+ GGGAGCGCAGACGTTGATGTTCCCCAGTTG-CGCGGCGCAGGTGTCGGCCGCCGTCTGAG
JMFN038B17+ GGGAGCGCAGACGTTGATGTTCCCCAGTTG-CGCGGCGCAGGTGTCGGCCGCCGTCTGAG
rJMFF031M17- GGGAGCNCAAACGTTGATGTTCCCCANTTGNCNCGGCNCAGGNGTCGGCCNCCGTCTNAN
JMFN006O19+ GGGAGCGCAGACGTTGATGTTCCCCAGTTG-CGCGGCGCAGGTGTCGGCCGCCGTCTGAG
JMFN008I11+ GGGAGCGCAGACGTTGATGTTCCCCAGTTG-CGCGGCGCAGGTGTCGGCCGCCGTCTGAG
JMFN029K01+ GGGAGCGCAGACGTTGATGTTCCCCAGTTG-CGCGGCGCAGGTGTCGGCCGCCGTCTGAG
JMFN003P16+ GGGAGCGCAGACGTTGATGTTCCCCAGTTG-CGCGGCGCAGGTGTCGGCCGCCGTCTGAG
JMFN014G09+ GGGAGCGCAGACGTTGATGTTCCCCAGTTG-CGCGGCGCAGGTGTCGGCCGCCGTCTGAG
JMFN041N01+ GGGAGCGCAGACGTTGATGTTCCCCAGTTG-CGCGGCGCAGGTGTCGGCCGCCGTCTGAG
JMFN036J16+ GGGAGCGCAGACGTTGATGTTCCCCAGTTG-CGCGGCGCAGGTGTCGGCCGCCGTCTGAG
JMFN028G19+ GGGAGCGCAGACGTTGATGTTCCCCAGTTG-CGCGGCGCAGGTGTCGGCCGCCGTCTGAG
JMFN009I09+ GGGAGCGCAGACGTTGATGTTCCCCAGTTG-CGCGGCGCAGGTGTCGGCCGCCGTCTGAG
JMFN038O22+ GGGAGCGCAGACGTTGATGTTCCCCAGTTG-CGCGGCGCAGGTGTCGGCCGCCGTCTGAG
JMFF045N19+ GGGAGCGCAGACGTTGATGTTCCCCAGTTG-CGCGGCGCAGGTGTCGG--GCCGTCTGAG
JMFF031M17+ GGGAGCGCAGACGTTGATGTTCCCCAGTTG-CGCGGCGCAGGTGTCGGCCGCCGTCTGAG
JMFF023K03+ GGGAGCGCAGACGTTGATGTTCCCCAGTTG-CGCGGCGCAGGTGTCGGCCGCCGTCTGAG
                      ____________________________________________________________
consensus GGGAGCGCAGACGTTGATGTTCCCCAGTTG-CGCGGCGCAGGTGTCGGCCGCCGTCTGAG
 
. : . : . : . : . : . :
JMFN018O23+ CTTCCGCTTCGCGGATCTGCAGCGCCGTCGCCA-CCACCAGAACCACCACCACCAGGGAT
JMFN038B17+ CTTCCGCTTCGCGGATCTGCAGCGCCGTCGCCA-CCACCAGAACCACCACCACCAGGGAT
rJMFF031M17- CTTCCNCTTCNCGGATCTGCAGCNCCGTC
JMFN006O19+ CTTCCGCTTCGCGGATCTGCAGCGCCGTCGCCA-CCACCAGAACCACCACCACCAGGGAT
JMFN008I11+ CTTCCGCTTCGCGGATCTGCAGCGCCGTCGCCA-CCACCAGAACCACCACCACCAGGGAT
JMFN029K01+ CTTCCGCTTCGCGGATCTGCAGCGCCGTCGCCA-CCACCAGAACCACCACCACCAGGGAT
JMFN003P16+ CTTCCGCTTCGCGGATCTGCAGCGCCGTCGCCA-CCACCAGAACCACCACCACCAGGGAT
JMFN014G09+ CTTCCGCTTCGCGGATCTGCAGCGCCGTCGCCA-CCACCAGAACCACCACCACCAGGGAT
JMFN041N01+ CTTCCGCTTCGCGGATCTGCAGCGCCGTCGCCA-CCACCAGAACCACCACCACCAGGGAT
JMFN036J16+ CTTCCGCTTCGCGGATCTGCAGCGCCGTCGCCA-CCACCAGAACCACCACCACCCCGCAT
JMFN028G19+ CTTCCGCTTCGCGGATCTGCAGCGCC
JMFN009I09+ CTTCCGCTTCGCGGATCTGCAGCGCCGTCGCCA-CCACCAGAACCACCACCACCAGGGAT
JMFN038O22+ CTTCCGCTTCGCGGATCTGCAGCGCCGTCGCCA-CCACCAGAACCACCACCACCAGGGAT
JMFF045N19+ CTTCCGCTTCGCGGATCTGCAGCGCCGTCGCCA-CCACCAGAACCACCACCACCAGGGAT
JMFF031M17+ CTTCCGCTTCGCGGATCTGCAGCGCCGTCGCCACCCACCAGAACCACCACCACCAGGGAT
JMFF023K03+ CTTCCGCTTCGCGGATCTGCAGCGCCGTCGCCA-CCACCAGAACCACCACCACCAGGGAT
                      ____________________________________________________________
consensus CTTCCGCTTCGCGGATCTGCAGCGCCGTCGCCA-CCACCAGAACCACCACCACCAGGGAT
 
. : . : . : . : . : . :
JMFN018O23+ AGGATGCTCGTCACCTTCATGCCTGCCATTGCTGATCTTGTGGTCTGATGTAATAATAAT
JMFN038B17+ AGGATGCTCGTCACCTTCATGCCTGCCATTGCTGATCTTGTGGTCTGATGTAATAATAAT
JMFN006O19+ AGGATGCTCGTCACCTTCATGCCTGCCATTGCTGATCTTGTGGTCTGATGTAATAATAAT
JMFN008I11+ AGGATGCTCGTCACCTTCATGCCTGCCATTGCTGATCTTGTGGTCTGATGTAATAATAAT
JMFN029K01+ AGGATGCTCGTCACCTTCATGCCTGCCATTGCTGATCTTGTGGTCTGATGTAATAATAAT
JMFN003P16+ AGGATGCTCGTCACCTTCATGCCTGCCATTGCTGATCTTGTGGTCTGATGTAATAATAAT
JMFN014G09+ AGGATGCTCGTCACCTTCATGCCTGCCATTGCTGATCTTGTGGTCTGATGTAATAATAAT
JMFN041N01+ AGGATGCTCGTCACCTTCATGCCTGCCATTGCTGATCTTGTGGTCTGATGTAATAATAAT
JMFN036J16+ AGGATGCTCGTCACCTTCATGCCTGCCATTGCTGATCTTGTGGTCTGATGTAATAATAAT
JMFN009I09+ AGGATGCTCGTCACCTTCATGCCTGCCATTGCTGATCTTGTGGTCTGATGTAATAATAAT
JMFN038O22+ AGGATGCTCGTCACCTTCATGCCTGCCATTGCTGATCTTGTGGTCTGATGTAATAATAAT
JMFF045N19+ AGGATGCTCGTCACCTTCATGCCTGCCATTGCTGATCTTGTGGTCTGATGTAATAATAAT
JMFF031M17+ AGGATGCTCGTCACCTTCATGCCTGCCATTGCTGATCTTGTGGTCTGATGTAATAATAAT
JMFF023K03+ AGGATGCTCGTCACCTTCATGCCTGCCATTGCTGATCTTGTGGTCTGATGTAATAATAAT
                      ____________________________________________________________
consensus AGGATGCTCGTCACCTTCATGCCTGCCATTGCTGATCTTGTGGTCTGATGTAATAATAAT
 
. : . : . : . : . : . :
JMFN018O23+ GCTTCAGTTTTTTTTAAT
JMFN038B17+ GCTTCAGTTTTTTTTAATTT
JMFN006O19+ GCTTCAGTTTTTTTTAATTTTC
JMFN008I11+ GCTTCAGTTTTTTTTAATTTTCTGATCTG
JMFN029K01+ GCTTCAGTTTTTTTTAATTTTC
JMFN003P16+ GCTTCAGTTTTTTTTAATTTTCTGATCTGGATGGGCCGAA
JMFN014G09+ GCTTCAGTTTTTTTTAATTTTCTGATCTGGATGGGCCGAAT
JMFN041N01+ GCTTCAGTTTTTTTTAATTTTCTGATCTGGA
JMFN036J16+ GCTTCAGTTTTTTTTAATTTTCTGATCTGGATGGGCCGAA
JMFN009I09+ GCTTCAGTTTTTTTTAATTTTCTGATCTGGATGGGCCGAAT
JMFN038O22+ GCTTCAGTTTTTTTTAATTTTCTGATCTGGATGGGCCGAATGGAA
JMFF045N19+ GCTTCAGTTTTTTTTAATTTTCTGATCTGGATGGGCCGAATGGAATTATAGGAGGG
JMFF031M17+ GCTTCAGTTTTTTTTAATTTTCTGATCTGGATGGGCCGAATGGAATTATAGGAGGG
JMFF023K03+ GCTTCAGTTTTTTTTAATTTTCTGATCTGGATGGGCCGAATGGAATTATAGGAGGGATGT
                      ____________________________________________________________
consensus GCTTCAGTTTTTTTTAATTTTCTGATCTGGATGGGCCGAATGGAATTATAGGAGGGATGT