Previous Contig 001146:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF023H22Sequence283001146 (3)735006691 (3)gb:NTA344534_16913504e-81Nicotiana tabacum mRNA for cullin 1B (cul1B gene).
JMFS065H02Sequence617001146 (3)gb:NTA344533_16913493e-60Nicotiana tabacum mRNA for cullin 1A (cul1A gene).
JMFS159C10Sequence445001146 (3)gb:NTA344533_16913492e-49Nicotiana tabacum mRNA for cullin 1A (cul1A gene).

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS065H02+ AAGTACCGGTCAAGATAGTGGAAAAATCTAGAAAGCCACCTGACCATA
                      ____________________________________________________________
consensus AAGTACCGGTCAAGATAGTGGAAAAATCTAGAAAGCCACCTGACCATA
 
. : . : . : . : . : . :
JMFS159C10+ CCTTGTGATTTGCCCACCTTTTAACAAGCTCCCTTAGCATGAACTCATCATGCTTCTCT
JMFS065H02+ ACCTTGTGATTTGCCCACCTTTTAACAAGCTCCCTTAGCATGAACTCATCATGCTTCTCT
                      ____________________________________________________________
consensus ACCTTGTGATTTGCCCACCTTTTAACAAGCTCCCTTAGCATGAACTCATCATGCTTCTCT
 
. : . : . : . : . : . :
JMFS159C10+ CTCAAAGAGGGCAAAACCACTGAGTTGATGTATTCATCAAATGATTCCCTATACTTTTCA
JMFS065H02+ CTCAAAGAGGGCAAAACCACTGAGTTGATGTATTCATCAAATGATTCCCTATACTTTTCA
                      ____________________________________________________________
consensus CTCAAAGAGGGCAAAACCACTGAGTTGATGTATTCATCAAATGATTCCCTATACTTTTCA
 
. : . : . : . : . : . :
JMFS159C10+ TATAGCTGCTGAGAATAGTCATGGGGTGGTTTCTGCGTGCACATATTATAGATAGTAGTG
JMFS065H02+ TATAGCTGCTGAGAATAGTCATGGGGTGGTTTCTGCGTGCACATATTATAGATAGTAGTG
                      ____________________________________________________________
consensus TATAGCTGCTGAGAATAGTCATGGGGTGGTTTCTGCGTGCACATATTATAGATAGTAGTG
 
. : . : . : . : . : . :
JMFS159C10+ TAAAGCATCATGTACTCTTCAGAACTAAATGACTCGGGCTGGGCTTCCAATATCCTCTTT
JMFS065H02+ TAAAGCATCATGTACTCTTCAGAACTAAATGACTCGGGCTGGGCTTCCAATATCCTCTTT
                      ____________________________________________________________
consensus TAAAGCATCATGTACTCTTCAGAACTAAATGACTCGGGCTGGGCTTCCAATATCCTCTTT
 
. : . : . : . : . : . :
JMFS159C10+ AGCTTTGTGATTCCCTTCTGCATACAATCCCATCCTTCTTCCAGTTCTATTGTCTTCATT
JMFS065H02+ AGCTTTGTGATTCCCTTCTGCATAAAATCCCATCCTTCTTCCAGTTCTATTGTCTTCATT
                      ____________________________________________________________
consensus AGCTTTGTGATTCCCTTCTGCATACAATCCCATCCTTCTTCCAGTTCTATTGTCTTCATT
 
. : . : . : . : . : . :
JMFS159C10+ TGGCTCATTGTCATCTGAACTCAGTTCACTTGTATTTTCTCAAGTACACGGAAGATGGAT
JMFS065H02+ TGGCTCATTGTCATCTGAACTCAGTTCACTTGTATTTTCTCAAGTACACGGAAGATGGAT
JMFF023H22+ AACTCAGTTCACTTGTATTTTCTCAAGTACACGGAAGATGGAT
                      ____________________________________________________________
consensus TGGCTCATTGTCATCTGAACTCAGTTCACTTGTATTTTCTCAAGTACACGGAAGATGGAT
 
. : . : . : . : . : . :
JMFS159C10+ TGCGGAACTGCGAAGCGATTCCTAAACAAATGTAGTCTAAAGGGGAAAATCCGGGTCGGG
JMFS065H02+ TGCGGAACTGCGAAGCGATTCCTAAACAAATGTAGTCTAAAGGGGAAAATCCGGGTCGGG
JMFF023H22+ TGCGGAACTGCGAAGCGATTCCTAAACAAATGTAGTCTAAAGGGGAAAATCCGGGTCGGG
                      ____________________________________________________________
consensus TGCGGAACTGCGAAGCGATTCCTAAACAAATGTAGTCTAAAGGGGAAAATCCGGGTCGGG
 
. : . : . : . : . : . :
JMFS159C10+ TGAAAGAAGCAGAAACCCGAACCCTA
JMFS065H02+ TGAAAGAAGCAGAAACCCGAACCCTATGAATTGCTAGGTCGAGAGTGCCTGTAAAAGTTT
JMFF023H22+ TGAAAGAAGCAGAAACCCGAACCCTATGAATTGCTAGGTCGAGAGTGCCTGTAAAAGTTT
                      ____________________________________________________________
consensus TGAAAGAAGCAGAAACCCGAACCCTATGAATTGCTAGGTCGAGAGTGCCTGTAAAAGTTT
 
. : . : . : . : . : . :
JMFS065H02+ GTTGGTATTGGTAATATAGGAATTGAAGGGAGAACGAAAGGGCTCGGAGACCGGAGAGAG
JMFF023H22+ GTTGGTATTGGTAATATAGGAATTGAAGGGAGAACGAAAGGGCTCGGAGACCGGAGAGAG
                      ____________________________________________________________
consensus GTTGGTATTGGTAATATAGGAATTGAAGGGAGAACGAAAGGGCTCGGAGACCGGAGAGAG
 
. : . : . : . : . : . :
JMFS065H02+ TGCTGAAAGCGACAGGCGGTTCAATCAGA
JMFF023H22+ TGCTGAAAGCGACAGGCGGTTCAATCAGAGTCGTCGTCTGACTGGTCTGGAACGAGTGGC
                      ____________________________________________________________
consensus TGCTGAAAGCGACAGGCGGTTCAATCAGAGTCGTCGTCTGACTGGTCTGGAACGAGTGGC