Previous Contig 001137:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF023D18Sequence442001137 (3)pir|T00809|T008093e-55probable esterase D [imported] - Arabidopsis thaliana>gb:AC002510_1530777 Arabid732001137 (3)gb:AY087636_15726667e-95Arabidopsis thaliana clone 37276 mRNA, complete sequence.
JMSF045B05Sequence774001137 (3)pir|T00809|T00809e-112probable esterase D [imported] - Arabidopsis thaliana>gb:AC002510_1530777 Arabid678001484 (5)gb:AB154414_15283672e-45Glycyrrhiza echinata HIDM mRNA for 2-Hydroxyisoflavanone dehydratase, complete c

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF023D18- AATTCACACAACCACAAATGGCTTTATTAC
                      ____________________________________________________________
consensus AATTCACACAACCACAAATGGCTTTATTAC
 
. : . : . : . : . : . :
rJMFF023D18- GAGAACTACTCTCGCGACATTTCTGTCTTACTTTCTCCCAGTAGGACACAGATTCTATAT
                      ____________________________________________________________
consensus GAGAACTACTCTCGCGACATTTCTGTCTTACTTTCTCCCAGTAGGACACAGATTCTATAT
 
. : . : . : . : . : . :
rJMFF023D18- GAACACCACTCCTGAAGCATCTCTGAGATTAAGTAAATGCTTTGCCCAGTTACAGCTGAA
                      ____________________________________________________________
consensus GAACACCACTCCTGAAGCATCTCTGAGATTAAGTAAATGCTTTGCCCAGTTACAGCTGAA
 
. : . : . : . : . : . :
rJMFF023D18- GGGCTTGGGAGTGATGGCGGATGTGATCATCGACGAAGGTGGAAATGAAAAAGTAGGAGT
                      ____________________________________________________________
consensus GGGCTTGGGAGTGATGGCGGATGTGATCATCGACGAAGGTGGAAATGAAAAAGTAGGAGT
 
. : . : . : . : . : . :
rJMFF023D18- GATCATATCCAGGCTGCAATCGCAGGAGGAGAGGAACGCTGGCTTTTCTACATGCCTCTT
JMSF045B05+ CTT
                      ____________________________________________________________
consensus GATCATATCCAGGCTGCAATCGCAGGAGGAGAGGAACGCTGGCTTTTCTACATGCCTCTT
 
. : . : . : . : . : . :
rJMFF023D18- CGAATTTATGTGGCAAAAGTTGATCCTTCAAGAATTTGTCATCTTCTCCCTGATCAATTA
JMSF045B05+ CGAATTTATGTGGCAAAAGTTGATCCTTCAAGAATTTGTCATCTTCTCCCTGATCAATTA
                      ____________________________________________________________
consensus CGAATTTATGTGGCAAAAGTTGATCCTTCAAGAATTTGTCATCTTCTCCCTGATCAATTA
 
. : . : . : . : . : . :
rJMFF023D18- AAATGGTGGCGGAGAGATTGGCACCGCTTGATATAAGGCAGGTAGCATCGTATTGCTCCC
JMSF045B05+ AAATGGTGGCGGAGAGATTGGCACCGCTTGATATAAGGCAGGTAGCATCGTATTGCTCCC
                      ____________________________________________________________
consensus AAATGGTGGCGGAGAGATTGGCACCGCTTGATATAAGGCAGGTAGCATCGTATTGCTCCC
 
. : . : . : . : . : . :
rJMFF023D18- AATCAGCTTTATTTTCACCCAAGTAGTTTGTGAAAGCCTTCTGGCCCCAAGGACAGTTCA
JMSF045B05+ AATCAGCTTTATTTTCACCCAAGTAGTTTGTGAAAGCCTTCTGGCCCCAAGGACAGTTCA
                      ____________________________________________________________
consensus AATCAGCTTTATTTTCACCCAAGTAGTTTGTGAAAGCCTTCTGGCCCCAAGGACAGTTCA
 
. : . : . : . : . : . :
rJMFF023D18- CAGGATTCACAATTGGAGCAAATGCTGACACTGACTTGTACTTGTCCAAGTTTTTGAGGT
JMSF045B05+ CAGGATTCACAATTGGAGCAAATGCTGACACTGACTTGTACTTGTCCAAGTTTTTGAGGT
                      ____________________________________________________________
consensus CAGGATTCACAATTGGAGCAAATGCTGACACTGACTTGTACTTGTCCAAGTTTTTGAGGT
 
. : . : . : . : . : . :
rJMFF023D18- AGATTGTTAGTGCTCCATGTCCACCCATTGAGTGACCAAAGATGGATGCCCTTGATGTAT
JMSF045B05+ AGATTGTTAGTGCTCCATGTCCACCCATTGAGTGACCAAAGATGGATGCCCTTGATGTAT
                      ____________________________________________________________
consensus AGATTGTTAGTGCTCCATGTCCACCCATTGAGTGACCAAAGATGGATGCCCTTGATGTAT
 
. : . : . : . : . : . :
rJMFF023D18- CAAGCTGTGGAAAGTGTTCAGAAAGAAGTCCTGGCAACTCCTTAACAACATAGTCATACA
JMSF045B05+ CAAGCTGTGGAAAGTGTTCAGAAAGAAGTCCTGGCAACTCCTTAACAACATAGTCATACA
JMFF023D18+ TCCTTAACAACATAGTCATACA
                      ____________________________________________________________
consensus CAAGCTGTGGAAAGTGTTCAGAAAGAAGTCCTGGCAACTCCTTAACAACATAGTCATACA
 
. : . : . : . : . : . :
rJMFF023D18- TACGCCAGTTCTTCCACTTCTCTTGGGTTGCATTCAGATAAAATCCAGCACCAACACCAA
JMSF045B05+ TACGCCAGTTCTTCCACTTCTCTTGGGTTGCATTCAGATAAAATCCAGCACCAACACCAA
JMFF023D18+ TACGCCAGTTCTTCCACTTCTCTTGGGTTGCATTCAGATAAAATCCAGCACCAACACCAA
                      ____________________________________________________________
consensus TACGCCAGTTCTTCCACTTCTCTTGGGTTGCATTCAGATAAAATCCAGCACCAACACCAA
 
. : . : . : . : . : . :
rJMFF023D18- AATCCCAGCTATCAGACTCTCCTTCAACATTCAGCCCTCTTG
JMSF045B05+ AATCCCAGCTATCAGACTCTCCTTCAACATTCAGCCCTCTTGGAGATGTATCTGGTGCAA
JMFF023D18+ AATCCCAGCTATCAGACTCTCCTTCAACATTCAGCCCTCTTGGAGATGTATCTGGTGCAA
                      ____________________________________________________________
consensus AATCCCAGCTATCAGACTCTCCTTCAACATTCAGCCCTCTTGGAGATGTATCTGGTGCAA
 
. : . : . : . : . : . :
JMSF045B05+ TCAGTGCAACGCCCTCACTTGAAGCAACACGTTGGGCACCAGATTTAGCGATAAAGTTCT
JMFF023D18+ TCAGTGCAACGCCCTCACTTGAAGCAACACGTTGGGCACCAGATTTAGCGATAAAGTTCT
                      ____________________________________________________________
consensus TCAGTGCAACGCCCTCACTTGAAGCAACACGTTGGGCACCAGATTTAGCGATAAAGTTCT
 
. : . : . : . : . : . :
JMSF045B05+ CATCTGTGCATGTTAGGCCGGAGAGCCAGTAGAGTACAGGGAATTTGTTGGAAGGTGAAG
JMFF023D18+ CATCTGTGCATGTTAGGCCGGAGAGCCAGTAGAGTACAGGGAATTTGTTGGAAGGTGAAG
                      ____________________________________________________________
consensus CATCTGTGCATGTTAGGCCGGAGAGCCAGTAGAGTACAGGGAATTTGTTGGAAGGTGAAG
 
. : . : . : . : . : . :
JMSF045B05+ GAGAAGGAGGGAAGTAGATGTGGAATGTCATGGAGCATCCAAGAGTTGGGCTGTAGTGCT
JMFF023D18+ GAGAAGGAGGGAAGTAGATGTGGAATGTCATGGAGCATCCAAGAGTTGGGCTGTAGTGCT
                      ____________________________________________________________
consensus GAGAAGGAGGGAAGTAGATGTGGAATGTCATGGAGCATCCAAGAGTTGGGCTGTAGTGCT
 
. : . : . : . : . : . :
JMSF045B05+ TGTATCTCTTGTTGAACCCTCCAAACATCTTCGAGCTGCTGATTTCTGAAGGCTTCGTCT
JMFF023D18+ TGTATCTCTTGTTGAACCCTCCAAACATCTTCGAGCTGCTGATTTCTGAAGGCTTCGTCT
                      ____________________________________________________________
consensus TGTATCTCTTGTTGAACCCTCCAAACATCTTCGAGCTGCTGATTTCTGAAGGCTTCGTCT
 
. : . : . : . : . : . :
JMSF045B05+ CCATCTCCACCGTATCGCCGACACACTTCACAGTACAGAGTGAAAGGTTT
JMFF023D18+ CCATCTCCACCGTATCGCCGACACACTTCACAGTACAGAGTGAAAGGTTTGGGGTGAGAC
                      ____________________________________________________________
consensus CCATCTCCACCGTATCGCCGACACACTTCACAGTACAGAGTGAAAGGTTTGGGGTGAGAC