Previous Contig 001136:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF023D15Sequence471001136 (5)gb:AK175905_18178931e-17Arabidopsis thaliana mRNA, complete cds, clone: RAFL22-55-K09.543001136 (5)pir|T02422|T024224e-10hypothetical protein At2g23690 [imported] - Arabidopsis thaliana>gb:AC004482_153
JMFF024H09Sequence471001136 (5)gb:AK175905_18178931e-17Arabidopsis thaliana mRNA, complete cds, clone: RAFL22-55-K09.556001136 (5)pir|T02422|T024223e-13hypothetical protein At2g23690 [imported] - Arabidopsis thaliana>gb:AC004482_153
JMFN008D13Sequence546001136 (5)pir|T02422|T024225e-11hypothetical protein At2g23690 [imported] - Arabidopsis thaliana>gb:AC004482_153

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF023D15- ATTTTATAGAAATCTGATTTATTTATTTATTATTATCTTTTCACTACATCTTC
                      ____________________________________________________________
consensus ATTTTATAGAAATCTGATTTATTTATTTATTATTATCTTTTCACTACATCTTC
 
. : . : . : . : . : . :
rJMFF023D15- TTCTTAATGAAAAAAAAAAATAGTTGAAAATTAAAATTAAAATTAATTCATTTATAATTT
JMFN008D13+ AAAATTAAAATTAACTCATTTATAATTT
rJMFF024H09- ATTAATTCATTTATAATTT
                      ____________________________________________________________
consensus TTCTTAATGAAAAAAAAAAATAGTTGAAAATTAAAATTAAAATTAATTCATTTATAATTT
 
. : . : . : . : . : . :
rJMFF023D15- ATCAATATTAAAGCTCAACTCTTTTGTTACAGTAAAAGTCCACTCGGTTAATGTTACCAC
JMFN008D13+ ATCAATATTAAAGCTCAACTCTTTTGTTACAGTAAAAGTCCACTCGGTTAATGTTACCTC
rJMFF024H09- ATCAATATTAAAGCTCAACTCTTTTGTTACAGTAAAAGTCCACTCGGTTAATGTTACCAC
                      ____________________________________________________________
consensus ATCAATATTAAAGCTCAACTCTTTTGTTACAGTAAAAGTCCACTCGGTTAATGTTACCAC
 
. : . : . : . : . : . :
rJMFF023D15- AGCCACCGGAAANTCTCTCATCGAAANAACGTCGCCGGANAATCGCTCCGGCCGCCGGAN
JMFN008D13+ AGCCTCCGGAAACTCTCTCATCGAAAGAACGTCGCCGGAGAATCGCTCCGGCCGCCGGAG
rJMFF024H09- AGCCACCGGAAACTCTCTCATCGAAAGAACGTCGCCGGAGAATCGCTCCGGCCGCCGGAG
JMFF024H09+ CCGGAAACTCTCTCATCGAAAGAACGTCGCCGGAGAATCGCTCCGGCCGCCGGAG
JMFF023D15+ CCGGAAACTCTCTCATCGAAAGAACGTCGCCGGAGAATCGCTCCGGCCGCCGGAG
                      ____________________________________________________________
consensus AGCCACCGGAAACTCTCTCATCGAAAGAACGTCGCCGGAGAATCGCTCCGGCCGCCGGAG
 
. : . : . : . : . : . :
rJMFF023D15- AGTAGTAATCATTGAGGGCGGCGCTAGCTTTGATGGCCAGCGCACACATATCCTGAAGTG
JMFN008D13+ AGTAGTAATCATTGAGGGCGGCGCTAGCTTTGATGGCCAGCGCACACATATCTTGAAGTG
rJMFF024H09- AGTAGTAATCATTGAGGGCGGCGCTAGCTTTGATGGCCAGCGCACACATATCCTGAAGTG
JMFF024H09+ AGTAGTAATCATTGAGGGCGGCGCTAGCTTTGATGGCCAGCGCACACATATCCTGAAGTG
JMFF023D15+ AGTAGTAATCATTGAGGGCGGCGCTAGCTTTGATGGCCAGCGCACACATATCCTGAAGTG
                      ____________________________________________________________
consensus AGTAGTAATCATTGAGGGCGGCGCTAGCTTTGATGGCCAGCGCACACATATCCTGAAGTG
 
. : . : . : . : . : . :
rJMFF023D15- AAAGCGGCGCGTGCGACATAAAAACCGGGAGGANAAAGTAAAGCTGTCCNAGCTGCAAGT
JMFN008D13+ AAAACGGCGCGTGCGACATAGAAACCGGGAGTAGAAAGTAAAGCTGTCCCATCTGCAAGT
rJMFF024H09- AAAGCGGCGCGTGCGACATAGAAACCGGGAGGAGAAAGTAAAGCTGTCCGAGCTGCAAGT
JMFF024H09+ AAAGCGGCGCGTGCGACATAGAAACCGGGAGGAGAAAGTAAAGCTGTCCGAGCTGCAAGT
JMFF023D15+ AAAGCGGCGCGTGCGACATAGAAACCGGGAGGAGAAAGTAAAGCTGTCCGAGCTGCAAGT
                      ____________________________________________________________
consensus AAAGCGGCGCGTGCGACATAGAAACCGGGAGGAGAAAGTAAAGCTGTCCGAGCTGCAAGT
 
. : . : . : . : . : . :
rJMFF023D15- CTTCGTCTTC-GGCAACCTGCGGCATTGCAAAGTC-NACGTTCATCGCTTCGGAGTTGGA
JMFN008D13+ CTTCGTCTTCAGGCAACATACGGCATTGCAGAGTCAGACGTTCATCGCTTCGGAGTTGGA
rJMFF024H09- CTTCGTCTTC-GGCAACCTGCGGCATTGCAGAGTC-GACGTTCATCGCTTCGGAGTTGGA
JMFF024H09+ CTTCGTCTTC-GGCAACCTGCGGCATTGCAGAGTC-GACGTTCATCGCTTCGGAGTTGGA
JMFF023D15+ CTTCGTCTTC-GGCAACCTGCGGCATTGCAGAGTC-GACGTTCATCGCTTCGGAGTTGGA
                      ____________________________________________________________
consensus CTTCGTCTTC-GGCAACCTGCGGCATTGCAGAGTC-GACGTTCATCGCTTCGGAGTTGGA
 
. : . : . : . : . : . :
rJMFF023D15- AAGGAAGCAGTCCGGGTTGTCGGANANAAACGTCGGNGGCCTTCACCGGCCGCCGGAANT
JMFN008D13+ AAGGAAGCAGTCCGGGTTGTCGGAGAC-AACGTCGCCGGCCTTCACCGGCCGCCGGAACT
rJMFF024H09- AAGGAAGCAGTCCGGGTTGTCGGAGAGAAACGTCGGCGGCCTTCACCGGCCGCCGGAACT
JMFF024H09+ AAGGAAGCAGTCCGGGTTGTCGGAGAG-AACGTCGGCGGCCTTCACCGGCCGCCGGAACT
JMFF023D15+ AAGGAAGCAGTCCGGGTTGTCGGAGAG-AACGTCGGCGGCCTTCACCGGCCGCCGGAACT
                      ____________________________________________________________
consensus AAGGAAGCAGTCCGGGTTGTCGGAGAG-AACGTCGGCGGCCTTCACCGGCCGCCGGAACT
 
. : . : . : . : . : . :
rJMFF023D15- CCTGCAGCGCACCGTCGTTCATATTCNCCACCATGGCCGCCGCCGGCGNGCTCATTATTA
JMFN008D13+ CATGCAGCGCACCGTCGTTCATATTCCCCTCCATGGCCGCCGCCGGCGTGCTCATTATTA
rJMFF024H09- CCTGCAGCGCACCGTCGTTCATATTCACCACCATGGCCGCCGCCGGCGTGCTCATTATTA
JMFF024H09+ CCTGCAGCGCACCGTCGTTCATATTCACCACCATGGCCGCCGCCGGCGTGCTCATTATTA
JMFF023D15+ CCTGCAGCGCACCGTCGTTCATATTCACCACCATGGCCGCCGCCGGCGTGCTCATTATTA
                      ____________________________________________________________
consensus CCTGCAGCGCACCGTCGTTCATATTCACCACCATGGCCGCCGCCGGCGTGCTCATTATTA
 
. : . : . : . : . : . :
rJMFF023D15- ATNTCCCGCCTC
JMFN008D13+ ATCTTCCGCCTCGCCGGCTCTCCGTGGCGTGAGCGGATGCGCAAATGCCCATTCTCCGAT
rJMFF024H09- ATCTCCCGCCTCGCCGGCTCTCCGTCGCGTGAGCGGATGCGCAAATGCCCATTTTCCGAT
JMFF024H09+ ATCTCCCGCCTCGCCGGCTCTCCGTCGCGTGAGCGGATGCGCAAATGCCCATTTTCCGAT
JMFF023D15+ ATCTCCCGCCTCGCCGGCTCTCCGTCGCGTGAGCGGATGCGCAAATGCCCATTTTCCGAT
                      ____________________________________________________________
consensus ATCTCCCGCCTCGCCGGCTCTCCGTCGCGTGAGCGGATGCGCAAATGCCCATTTTCCGAT
 
. : . : . : . : . : . :
JMFN008D13+ TCTCGGAGGGGGGATAGACATATTGTGTATTGTTTGAGT
rJMFF024H09- TCTCGGAGGGGGGATAGAGA-ATTGTGTATTGTTTGAGTGAATTGAATGCAAGTGATGAT
JMFF024H09+ TCTCGGAGGGGGGATAGAGA-ATTGTGTATTGTTTGAGTGAATTGAATGCAAGTGATGAT
JMFF023D15+ TCTCGGAGGGGGGATAGAGA-ATTGTGTATTGTTTGAGTGAATTGAATGCAAGTGATGAT
                      ____________________________________________________________
consensus TCTCGGAGGGGGGATAGAGA-ATTGTGTATTGTTTGAGTGAATTGAATGCAAGTGATGAT