Previous Contig 001133:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF023C07Sequence408001133 (2)gb:NTU85646_16919122e-08Nicotiana tabacum putative pectate lyase Nt59 (Nt59) gene, partial cds.665009286 (3)sp|P15722|PE59_LYCES5e-86Probable pectate lyase P59 precursor (EC 4.2.2.2).>pir|S27098|S27098 pectate lya
JMFN038P22Sequence624001133 (2)gb:NTU85646_16919124e-38Nicotiana tabacum putative pectate lyase Nt59 (Nt59) gene, partial cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN038P22+ AGGGTTCCGGGTTGGGGTTAGATGGATCATCGGCGT
                      ____________________________________________________________
consensus AGGGTTCCGGGTTGGGGTTAGATGGATCATCGGCGT
 
. : . : . : . : . : . :
JMFN038P22+ TGTCAGTAACGGTGTAGAAGTTGCCCAACTTGCCGCCTNTAGTTTTGTACCCAAACCCCA
                      ____________________________________________________________
consensus TGTCAGTAACGGTGTAGAAGTTGCCCAACTTGCCGCCTNTAGTTTTGTACCCAAACCCCA
 
. : . : . : . : . : . :
JMFN038P22+ AGGCGCAATCAGCCAACCTCTTCCGGTTGGTAGCCCAATCGGCGTGGCATCGCCAGCAAC
                      ____________________________________________________________
consensus AGGCGCAATCAGCCAACCTCTTCCGGTTGGTAGCCCAATCGGCGTGGCATCGCCAGCAAC
 
. : . : . : . : . : . :
JMFN038P22+ GATCGATCGGGTTTGTCGCATTACACGGCCCATGATACTTTTTTGAACCCAGAAGATGCC
                      ____________________________________________________________
consensus GATCGATCGGGTTTGTCGCATTACACGGCCCATGATACTTTTTTGAACCCAGAAGATGCC
 
. : . : . : . : . : . :
JMFN038P22+ GAGTTGTGTCGTTCCTCGTCACATCCTCAGCCTCAGCCTCAGCCTCAGCTACTGCTTCTG
JMFF023C07+ TCCTCGTCACATCCTCAGCCTCAGCCTCAGCCTCAGCTACTGCTTCTG
                      ____________________________________________________________
consensus GAGTTGTGTCGTTCCTCGTCACATCCTCAGCCTCAGCCTCAGCCTCAGCTACTGCTTCTG
 
. : . : . : . : . : . :
JMFN038P22+ ATAGTGTCCTTCGAACTTCGTGAATCAAGGATGCTGAAATGTTATGTGGATTGGGCTCAT
JMFF023C07+ ATAGTGTCCTTCGAACTTCGTGAATCAAGGATGCTGAAATGTTATGTGGATTGGGCTCAT
                      ____________________________________________________________
consensus ATAGTGTCCTTCGAACTTCGTGAATCAAGGATGCTGAAATGTTATGTGGATTGGGCTCAT
 
. : . : . : . : . : . :
JMFN038P22+ AAGCCTGTTGGGCATGTTCTATGGCTTCAGCTTCTCGCCTCCGCCACACCTCATCGTACT
JMFF023C07+ AAGCCTGTTGGGCATGTTCTATGGCTTCAGCTTCTCGCCTCCGCCACACCTCATCGTACT
                      ____________________________________________________________
consensus AAGCCTGTTGGGCATGTTCTATGGCTTCAGCTTCTCGCCTCCGCCACACCTCATCGTACT
 
. : . : . : . : . : . :
JMFN038P22+ CAGCAATGTGACCAACCGTTGCGGGGATTATAGCGCCAACACAAACCACCAACAACAACA
JMFF023C07+ CAGCAATGTGACCAACCGTTGCGGGGATTATAGCGCCAACACAAACCACCAACAACAACA
                      ____________________________________________________________
consensus CAGCAATGTGACCAACCGTTGCGGGGATTATAGCGCCAACACAAACCACCAACAACAACA
 
. : . : . : . : . : . :
JMFN038P22+ AACAATTATTTTTGTTAAATCCCTCCATTTTTTTTTCCTAAATATAAAAATAAATTATTA
JMFF023C07+ AACAATTATTTTTGTTAAATCCCTCCATTTTTTTTTCCTAAATATAAAAATAAATTATTA
                      ____________________________________________________________
consensus AACAATTATTTTTGTTAAATCCCTCCATTTTTTTTTCCTAAATATAAAAATAAATTATTA
 
. : . : . : . : . : . :
JMFN038P22+ TTTTGATAGGGGGTTGAACCGCTATTTTGGGTCCAACCCTTTTGAATTGAACCGACCAAA
JMFF023C07+ TTTTGATAGGGGGTTGAACCGCTATTTTGGGTCCAACCCTTTTGAATTGAACCGACCAAA
                      ____________________________________________________________
consensus TTTTGATAGGGGGTTGAACCGCTATTTTGGGTCCAACCCTTTTGAATTGAACCGACCAAA
 
. : . : . : . : . : . :
JMFN038P22+ CCTCAACTTTTCTTCTTATTCGGAGAGGTTTGATCGAACAACACTGTT
JMFF023C07+ CCTCAACTTTTCTTCTTATTCGGAGAGGTTTGATCGAACAACACTGTTTATTAAGTGATT
                      ____________________________________________________________
consensus CCTCAACTTTTCTTCTTATTCGGAGAGGTTTGATCGAACAACACTGTTTATTAAGTGATT