Previous Contig 001125:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF002N20Sequence380001125 (17)gb:AF082892_17667022e-32Solanum tuberosum cystathionine gamma-synthase isoform 2 (CgS2) mRNA, complete c780010810 (14)gb:AF082891_17667019e-99Solanum tuberosum cystathionine gamma-synthase isoform 1 (CgS) mRNA, complete cd
JMFF002N22Sequence537001125 (17)gb:AF082892_17667025e-40Solanum tuberosum cystathionine gamma-synthase isoform 2 (CgS2) mRNA, complete c708010810 (14)gb:AF082891_17667012e-83Solanum tuberosum cystathionine gamma-synthase isoform 1 (CgS) mRNA, complete cd
JMFF004B13Sequence253001125 (17)685010810 (14)gb:AY508112_16102327e-90Lycopersicon esculentum cystathionine gamma synthase mRNA, complete cds.
JMFF011J03Sequence510001125 (17)gb:AF082892_17667027e-32Solanum tuberosum cystathionine gamma-synthase isoform 2 (CgS2) mRNA, complete c713010810 (14)gb:AF082891_17667016e-99Solanum tuberosum cystathionine gamma-synthase isoform 1 (CgS) mRNA, complete cd
JMFF012C09Sequence412001125 (17)gb:AF082892_17667026e-25Solanum tuberosum cystathionine gamma-synthase isoform 2 (CgS2) mRNA, complete c729010810 (14)gb:AF082891_1766701e-102Solanum tuberosum cystathionine gamma-synthase isoform 1 (CgS) mRNA, complete cd
JMFF016O19Sequence406001125 (17)gb:AF082892_17667025e-32Solanum tuberosum cystathionine gamma-synthase isoform 2 (CgS2) mRNA, complete c
JMFF017G10Sequence541001125 (17)gb:AF082892_17667028e-32Solanum tuberosum cystathionine gamma-synthase isoform 2 (CgS2) mRNA, complete c808010810 (14)gb:AF082891_1766701e-117Solanum tuberosum cystathionine gamma-synthase isoform 1 (CgS) mRNA, complete cd
JMFF017P09Sequence544001125 (17)gb:AF082892_17667026e-25Solanum tuberosum cystathionine gamma-synthase isoform 2 (CgS2) mRNA, complete c838001125 (17)gb:AF097180_17678652e-59Nicotiana tabacum cystathionine gamma-synthase precursor (metB) mRNA, complete c
JMFF022N12Sequence409001125 (17)gb:AF082892_17667025e-32Solanum tuberosum cystathionine gamma-synthase isoform 2 (CgS2) mRNA, complete c750010810 (14)gb:AF082891_1766701e-105Solanum tuberosum cystathionine gamma-synthase isoform 1 (CgS) mRNA, complete cd
JMFF048F21Sequence292001125 (17)gb:AF082892_17667024e-11Solanum tuberosum cystathionine gamma-synthase isoform 2 (CgS2) mRNA, complete c221010810 (14)
JMFF051E11Sequence607001125 (17)gb:AF082892_17667022e-39Solanum tuberosum cystathionine gamma-synthase isoform 2 (CgS2) mRNA, complete c616010810 (14)gb:AF082891_17667015e-69Solanum tuberosum cystathionine gamma-synthase isoform 1 (CgS) mRNA, complete cd
JMFS073D11Sequence627001125 (17)gb:AF082892_17667022e-46Solanum tuberosum cystathionine gamma-synthase isoform 2 (CgS2) mRNA, complete c
JMFS085A09Sequence629001125 (17)gb:AF082892_17667027e-47Solanum tuberosum cystathionine gamma-synthase isoform 2 (CgS2) mRNA, complete c
JMSF016I02Sequence426001125 (17)gb:AF082892_17667022e-33Solanum tuberosum cystathionine gamma-synthase isoform 2 (CgS2) mRNA, complete c750010810 (14)gb:AF082891_17667014e-94Solanum tuberosum cystathionine gamma-synthase isoform 1 (CgS) mRNA, complete cd
JMSF030G07Sequence510001125 (17)gb:AF082892_17667027e-32Solanum tuberosum cystathionine gamma-synthase isoform 2 (CgS2) mRNA, complete c736010810 (14)gb:AF082891_1766701e-106Solanum tuberosum cystathionine gamma-synthase isoform 1 (CgS) mRNA, complete cd
JMSF039N17Sequence656001125 (17)gb:AF082892_17667021e-57Solanum tuberosum cystathionine gamma-synthase isoform 2 (CgS2) mRNA, complete c889010810 (14)gb:AF082891_1766701e-122Solanum tuberosum cystathionine gamma-synthase isoform 1 (CgS) mRNA, complete cd

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF017P09- TAGCTTTAAATTTTTATCATATATATATA
                      ____________________________________________________________
consensus TAGCTTTAAATTTTTATCATATATATATA
 
. : . : . : . : . : . :
rJMFF017P09- TATACAAGGTAAAATGTCATGTACAGGATCTTCTGTATACAAAATGCAAAAATCAGGCCT
                      ____________________________________________________________
consensus TATACAAGGTAAAATGTCATGTACAGGATCTTCTGTATACAAAATGCAAAAATCAGGCCT
 
. : . : . : . : . : . :
rJMFF017P09- AAATTTGGTTATCAAATGAATCCACTTCAATGGTACAAACAATTTGTTTGAGTCTCATCT
                      ____________________________________________________________
consensus AAATTTGGTTATCAAATGAATCCACTTCAATGGTACAAACAATTTGTTTGAGTCTCATCT
 
. : . : . : . : . : . :
rJMFF017P09- GGTGATGCAGCATCCTCAATCGAGTCCGTTCGACGAGCAGATGCAGACTGCAAAAGAATT
                      ____________________________________________________________
consensus GGTGATGCAGCATCCTCAATCGAGTCCGTTCGACGAGCAGATGCAGACTGCAAAAGAATT
 
. : . : . : . : . : . :
rJMFF017P09- TTGTTCTACCAATCGAATGATTCCCATCCTAGGATACTAGGATTGAACATGATTGTGTTC
                      ____________________________________________________________
consensus TTGTTCTACCAATCGAATGATTCCCATCCTAGGATACTAGGATTGAACATGATTGTGTTC
 
. : . : . : . : . : . :
rJMFF017P09- GAGGTTATACAAAGGCTGAAAACCGGAGGGGGGCTTTGTCACTTTGTGTGACGTTCCAGG
                      ____________________________________________________________
consensus GAGGTTATACAAAGGCTGAAAACCGGAGGGGGGCTTTGTCACTTTGTGTGACGTTCCAGG
 
. : . : . : . : . : . :
rJMFF017P09- GCTGCTTTTGTACTTGGTCGAGAAAGATTCACAGCCTGTCTAACCTGAGACGACCGAGAG
                      ____________________________________________________________
consensus GCTGCTTTTGTACTTGGTCGAGAAAGATTCACAGCCTGTCTAACCTGAGACGACCGAGAG
 
. : . : . : . : . : . :
rJMFF017P09- TCGTTCTTGAGCTCCCGCTTGACAAAGACAGCATAGAGGAGCTCGTTCCAGGAATCGGGG
                      ____________________________________________________________
consensus TCGTTCTTGAGCTCCCGCTTGACAAAGACAGCATAGAGGAGCTCGTTCCAGGAATCGGGG
 
. : . : . : . : . : . :
rJMFF017P09- ACCCCGGGGAGGCACCAGTGGCTGCAGTCTCTATGAATATCCTGGTTTTTCTATAGCAAT
                      ____________________________________________________________
consensus ACCCCGGGGAGGCACCAGTGGCTGCAGTCTCTATGAATATCCTGGTTTTTCTATAGCAAT
 
. : . : . : . : . : . :
rJMFF017P09- CAGTGGTTGTCACTATATGCCCACCAGCAGGGACCAATGCCAGCAACATTACAGTACTAG
                      ____________________________________________________________
consensus CAGTGGTTGTCACTATATGCCCACCAGCAGGGACCAATGCCAGCAACATTACAGTACTAG
 
. : . : . : . : . : . :
rJMFF017P09- CACACATTCCAGATGCCATTAACAAGGTTGATTCAGCTCCCTCCAGCGCACTTATCTTCT
                      ____________________________________________________________
consensus CACACATTCCAGATGCCATTAACAAGGTTGATTCAGCTCCCTCCAGCGCACTTATCTTCT
 
. : . : . : . : . : . :
rJMFF017P09- CTTCTGCAACAATAGTAGTAGGGTTCCCATAGCGGCCATATTCAAAACTTACACGTCTTT
                      ____________________________________________________________
consensus CTTCTGCAACAATAGTAGTAGGGTTCCCATAGCGGCCATATTCAAAACTTACACGTCTTT
 
. : . : . : . : . : . :
rJMFF017P09- TCTCCTTGAAATCAATGAGCTCTGAAGTCTTGTTGAAGAAATAAGCAGACGTGTTAACAA
JMSF039N17+ ATCAATGAGCTCTGAAGTCTTGTTGAAGAAATAAGCAGACGTGTTAACAA
                      ____________________________________________________________
consensus TCTCCTTGAAATCAATGAGCTCTGAAGTCTTGTTGAAGAAATAAGCAGACGTGTTAACAA
 
. : . : . : . : . : . :
rJMFF017P09- CAGGAGTTGTTATTGCATCAGTAACAATACCTCGCCCCAATCTTTCACCGGCATGAACTG
JMSF039N17+ CAGGAGTTGTTATTGCATCAGTAACAATACCTCGCCCCAATCTTTCACCGGCATGAACTG
JMFS085A09+ ATTGCATCAGTAACAATACCTCGCCCCAATCTTTCACCGGCATGAACTG
JMFF002N22+ TTCACCGGCATGAACTG
JMFS073D11+ ATTGCATCAGTAACAATACCTCGCCCCAATCTTTCACCGGCATGAACTG
JMFF051E11+ CGGCATGAACTG
                      ____________________________________________________________
consensus CAGGAGTTGTTATTGCATCAGTAACAATACCTCGCCCCAATCTTTCACCGGCATGAACTG
 
. : . : . : . : . : . :
rJMFF017P09- CAACGCTCCCATCTGAACTCNAAAATGAA
JMSF039N17+ CAACGCTCCCATCTGAACTCAAAAATGAAGCGTAATTGGCATGGGCCAAATCCTGAATCT
JMFS085A09+ CAACGCTCCCATCTGAACTCAAAAATGAAGCGTAATTGGCATGGGCCAAATCCTGAATCT
JMFF002N22+ CAACGCTCCCATNTGAACTCAAAAATGAAGCGTAATTGGCATGGGCCAAATCCTGAATCT
JMFS073D11+ CAACGCTCCCATCTGAACTCAAAAATGAAGCGTAATTGGCATGGGCCAAATCCTGAATCT
JMFF051E11+ CAACGCTCCCATCTGAACTCAAAAATGAAGCGTAATTGGCATGGGCCAAATCCTGAATCT
JMFF017P09+ TGAATCT
JMFF017G10+ GAATCT
                      ____________________________________________________________
consensus CAACGCTCCCATCTGAACTCAAAAATGAAGCGTAATTGGCATGGGCCAAATCCTGAATCT
 
. : . : . : . : . : . :
JMSF039N17+ GTACATTTGGGTCACTACAACTACCATTATCCACCAACACCACCTCCTCCTCAGCCACAG
JMFS085A09+ GTACATTTGGGTCACTACAACTACCATTATCCACCAACACCACCTCCTCCTCAGCCACAG
JMFF002N22+ GTACATTTGGGTCACTACAACTACCATTATCCACCAACACCACCTCCTCCTCAGCCACAG
JMFS073D11+ GTACATTTGGGTCACTACAACTACCATTATCCACCAACACCACCTCCTCCTCAGCCACAG
JMFF051E11+ GTACATTTGGGTCACTACAACTACCATTATCCACCAACACCACCTCCTCCTCAGCCACAG
JMFF017P09+ GTACATTTGGGTCACTACAACTACCATTATCCACCAACACCACCTCNTCCTCAGCCACAG
JMFF017G10+ GTACATTTGGGTCACTACAACTACCATTATCCACCAACACCACCTCCTCCTCAGCCACAG
JMFF011J03+ ATTATCCACCAACACCACCTCCTCCTCAGCCACAG
JMSF030G07+ TTATCCACCAACACCACCTCCTCCTCAGCCACAG
                      ____________________________________________________________
consensus GTACATTTGGGTCACTACAACTACCATTATCCACCAACACCACCTCCTCCTCAGCCACAG
 
. : . : . : . : . : . :
JMSF039N17+ GGCTTGAAACCTCAGGAGGGGAAATGGCGGCGGCGGCGGCATCTAGTGCCTTAGCCG-CC
JMFS085A09+ GGCTTGAAACCTCAGGAGGGGAAATGGCGGCGGCGGCGGCATCTAGTGCCTTAGCCG-CC
JMFF002N22+ GGCTTGAAACCTCAGGAGGGGAAATGGCGGCGGCGGCGGCATCTAGTGCCTTAGCCG-CC
JMFF002N20+ GAAATGGCGGCGGCGGCGGCATCTAGTGCCTTAGCCG-CC
JMFS073D11+ GGCTTGAAACCTCAGGAGGGGAAATGGCGGCGGCGGCGGCATCTAGTGCCTTAGCCG-CC
JMFF051E11+ GGCTTGAAACCTCAGGAGGGGAAATGGCGGCGGCGGCGGCATCTAGTGCCTTAGCCG-CC
JMFF017P09+ GGCTTGAAACCTCAGGAGGGGAAATGGCGGCGGCGGCGGCATCTAGTGCCTTAGCCGCCC
JMFF017G10+ GGCTTGAAACCTCAGGAGGGGAAATGGCGGCGGCGGCGGCATCTAGTGCCTTAGCCG-CC
JMFF011J03+ GGCTTGAAACCTCAGGAGGGGAAATGGCGGCGGCGGCGGCATCTAGTGCCTTAGCCG-CC
JMSF030G07+ GGCTTGAAACCTCAGGAGGGGAAATGGCGGCGGCGGCGGCATCTAGTGCCTTAGCCG-CC
JMSF016I02+ TTAGCCG-CC
                      ____________________________________________________________
consensus GGCTTGAAACCTCAGGAGGGGAAATGGCGGCGGCGGCGGCATCTAGTGCCTTAGCCG-CC
 
. : . : . : . : . : . :
JMSF039N17+ GGGGGGATGCCAGAGGCGGCCTTGTTGTTGGACCACGAAGCCGCCACGATTTGCGCCACG
JMFS085A09+ GGGGGGATGCCAGAGGCGGCCTTGTTGTTGGACCACGAAGCCGCCACGATTTGCGCCACG
JMFF002N22+ GGGGGGATGCCAGAGGCGGCCTTGTTGTTGGACCACGAAGCCGCCACGATTTGCGCCACG
JMFF002N20+ GGGGGGATGCCAGAGGCGGCCTTGTTGTTGGACCACGAAGCCGCCACGATTTGCGCCACG
JMFS073D11+ GGGGGGATGCCAGAGGCGGCCTTGTTGTTGGACCACGAAGCCGCCACGATTTGCGCCACG
JMFF051E11+ GGGGGGATGCCAGAGGCGGCCTTGTTGTTGGACCACGAAGCCGCCACGATTTGCGCCACG
JMFF017P09+ GGGGGGGATCCAGAGGCGGCCTTGTTGTTGGACCACGAAGCCGCCACGATTTGCGCCACG
JMFF017G10+ GGGGGGATGCCAGAGGCGGCCTTGTTGTTGGACCACGAAGCCGCCACGATTTGCGCCACG
JMFF012C09+ GATGCCAGAGGCGGCCTTGTTGTTGGACCACGAAGCCGCCACGATTTGCGCCACG
JMFF011J03+ GGGGGGATGCCAGAGGCGGCCTTGTTGTTGGACCACGAAGCCGCCACGATTTGCGCCACG
JMSF030G07+ GGGGGGATGCCAGAGGCGGCCTTGTTGTTGGACCACGAAGCCGCCACGATTTGCGCCACG
JMFF016O19+ CCAGAGGCGGCCTTGTTGTTGGACCACGAAGCCGCCACGATTTGCGCCACG
JMSF016I02+ GGGGGGATGCCAGAGGCGGCCTTGTTGTTGGACCACGAAGCCGCCACGATTTGCGCCACG
JMFF022N12+ CCAGAGGCGGCCTTGTTGTTGGACCACGAAGCCGCCACGATTTGCGCCACG
                      ____________________________________________________________
consensus GGGGGGATGCCAGAGGCGGCCTTGTTGTTGGACCACGAAGCCGCCACGATTTGCGCCACG
 
. : . : . : . : . : . :
JMSF039N17+ CCGATGTTGCTGCAGTTCCTCCGAGCCTTGATGCTGAGCTGGCGCACGAAGTTGGGCGGG
JMFS085A09+ CCGATGTTGCTGCAGTTCCTCCGAGCCTTGATGCTGAGCTGGCGCACGAAGTTGGGCGGG
JMFF002N22+ CCGATGTTGCTGCAGTTCCTCCGAGCCTTGATGCTGAGCTGGCGCACGAAGTTGGGCGGG
JMFF002N20+ CCGATGTTGCTGCAGTTCCTCCGAGCCTTGATGCTGAGCTGGCGCACGAAGTTGGGCGGG
JMFS073D11+ CCGATGTTGCTGCAGTTCCTCCGAGCCTTGATGCTGAGCTGGCGCACGAAGTTGGGCGGG
JMFF051E11+ CCGATGTTGCTGCAGTTCCTCCGAGCCTTGATGCTGAGCTGGCGCACGAAGTTGGGCGGG
JMFF017P09+ CCGATGTTGCTGCAGTTCCTCCGAGCCTTGATGCTGAGCTGGCGCACGAAGTTGGGCGGG
JMFF017G10+ CCGATGTTGCTGCAGTTCCTCCGAGCCTTGATGCTGAGCTGGCGCACGAAGTTGGGCGGG
JMFF012C09+ CCGATGTTGCTGCAGTTCCTCCGAGCCTTGATGCTGAGCTGGCGCACGAAGTTGGGCGGG
JMFF011J03+ CCGATGTTGCTGCAGTTCCTCCGAGCCTTGATGCTGAGCTGGCGCACGAAGTTGGGCGGG
JMSF030G07+ CCGATGTTGCTGCAGTTCCTCCGAGCCTTGATGCTGAGCTGGCGCACGAAGTTGGGCGGG
JMFF016O19+ CCGATGTTGCTGCAGTTCCTCCGAGCCTTGATGCTGAGCTGGCGCACGAAGTTGGGCGGG
JMSF016I02+ CCGATGTTGCTGCAGTTCCTCCGAGCCTTGATGCTGAGCTGGCGCACGAAGTTGGGCGGG
JMFF022N12+ CCGATGTTGCTGCAGTTCCTCCGAGCCTTGATGCTGAGCTGGCGCACGAAGTTGGGCGGG
                      ____________________________________________________________
consensus CCGATGTTGCTGCAGTTCCTCCGAGCCTTGATGCTGAGCTGGCGCACGAAGTTGGGCGGG
 
. : . : . : . : . : . :
JMSF039N17+ AACCTGAGGATCAGAGAAGACAGACCGTAGCCTCTAGATCCCTGACTCAGTGAGTTAGGG
JMFS085A09+ AACCTGAGGATCAGAGAAGACAGACCGTAGCCTCTAGATCCCTGACTCAGTGAGTTAGGG
JMFF002N22+ AACCTGAGGATCAGAGAAGACAGACCGTAGCCTCTAGATCCCTGACTCAGTGAGTTAGGG
JMFF002N20+ AACCTGAGGATCAGAGAAGACAGACCGTAGCCTCTAGATCCCTGACTCAGTGAGTTAGGG
JMFS073D11+ AACCTGAGGATCAGAGAAGACAGACCGTAGCCTCTAGATCCCTGACTCAGTGAGTTAGGG
JMFF051E11+ AACCTGAGGATCAGAGAAGACAGACCGTAGCCTCTAGATCCCTGACTCAGTGAGTTAGGG
JMFF017P09+ AACCTGAGGATCAGAGAAGACAGACCGTAGCCTCTAGATCCCTGACTCAGTGAGTTAGGG
JMFF017G10+ AACCTGAGGATCAGAGAAGACAGACCGTAGCCTCTAGATCCCTGACTCAGTGAGTTAGGG
JMFF004B13+ ACTCAGTGAGTTAGGG
JMFF012C09+ AACCTGAGGATCAGAGAAGACAGACCGTAGCCTCTAGATCCCTGACTCAGTGAGTTAGGG
JMFF048F21+ TGAGGATCAGAGAAGACAGACCGTAGCCTCTAGATCCCTGACTCAGTGAGTTAGGG
JMFF011J03+ AACCTGAGGATCAGAGAAGACAGACCGTAGCCTCTAGATCCCTGACTCAGTGAGTTAGGG
JMSF030G07+ AACCTGAGGATCAGAGAAGACAGACCGTAGCCTCTAGATCCCTGACTCAGTGAGTTAGGG
JMFF016O19+ AACCTGAGGATCAGAGAAGACAGACCGTAGCCTCTAGATCCCTGACTCAGTGAGTTAGGG
JMSF016I02+ AACCTGAGGATCAGAGAAGACAGACCGTAGCCTCTAGATCCCTGACTCAGTGAGTTAGGG
JMFF022N12+ AACCTGAGGATCAGAGAAGACAGACCGTAGCCTCTAGATCCCTGACTCAGTGAGTTAGGG
                      ____________________________________________________________
consensus AACCTGAGGATCAGAGAAGACAGACCGTAGCCTCTAGATCCCTGACTCAGTGAGTTAGGG
 
. : . : . : . : . : . :
JMSF039N17+ CGCAGGCCGGCGCCGGGGCACTCGTGACGCGGAACCCGGCCCGAAAAGT-CCGGATCCGA
JMFS085A09+ CGCAGGCCGGCGCCGGGGCACTCGTGACGCGGAACCCGGCCCGAAAAGT-CCGGATCCGA
JMFF002N22+ CGCAGGCCGGCGCCGGGGCACTCGTGACGCGGAACCCGGCCCGAAAAGT-CCGGATCCGA
JMFF002N20+ CGCAGGCCGGCGCCGGGGCACTCGTGACGCGGAACCCGGCCCGAAAAGT-CCGGATCCGA
JMFS073D11+ CGCAGGCCGGCGCCGGGGCACTCGTGACGCGGAACCCGGCCCGAAAAGT-CCGGATCCGA
JMFF051E11+ CGCAGGCCGGCGCCGGGGCACTCGTGACGCGGAACCCGGCCCGAAAAGT-CCGGATCCGA
JMFF017P09+ CGCAGGCCGGCGCCGGGGCACTCGTGACGCGGAACCCGGCCCGAAAAGTCCCGGATCCGA
JMFF017G10+ CGCAGGCCGGCGCCGGGGCACTCGTGACGCGGAACCCGGCCCGAAAAGT-CCGGATCCGA
JMFF004B13+ CGCAGGCCGGCGCCGGGGCACTCGTGACGCGGAACCCGGCCCGAAAAGTCCCGGATCCGA
JMFF012C09+ CGCAGGCCGGCGCCGGGGCACTCGTGACGCGGAACCCGGCCCGAAAAGTCCCGGATCCGA
JMFF048F21+ CGCAGGCCGGCGCCGGGGCACTCGTGACGCGGAACCCGGCCCGAAAAGT-CCGGATCCGA
JMFF011J03+ CGCAGGCCGGCGCCGGGGCACTCGTGACGCGGAACCCGGCCCGAAAAGT-CCGGATCCGA
JMSF030G07+ CGCAGGCCGGCGCCGGGGCACTCGTGACGCGGAACCCGGCCCGAAAAGT-CCGGATCCGA
JMFF016O19+ CGCAGGCCGGCGCCGGGGCACTCGTGACGCGGAACCCGGCCCGAAAAGT-CCGGATCCGA
JMSF016I02+ CGCAGGCCGGCGCCGGGGCACTCGTGACGCGGAACCCGGCCCGAAAAGT-CCGGATCCGA
JMFF022N12+ CGCAGGCCGGCGCCGGGGCACTCGTGACGCGGAACCCGGCCCGAAAAGT-CCGGATCCGA
                      ____________________________________________________________
consensus CGCAGGCCGGCGCCGGGGCACTCGTGACGCGGAACCCGGCCCGAAAAGT-CCGGATCCGA
 
. : . : . : . : . : . :
JMSF039N17+ GCGGCACTCGAACGAGGGAAACACCGTGGAGCAGCTAGAGATAGCCATGGTTGAATTGGA
JMFS085A09+ GCGGCACTCGAACGAGGGAAACACCGTGGAGCAGCTAGAGATAGCCATGGTTGAATTGGA
JMFF002N22+ GCGGCACTCGAACGAGGGAAACACCGTGGAGCAGCTAGAGATAGCCATGGTTGAATTGGA
JMFF002N20+ GCGGCACTCGAACGAGGGAAACACCGTGGAGCAGCTAGAGATAGCCATGGTTGAATTGGA
JMFS073D11+ GCGGCACTCGAACGAGGGAAACACCGTGGAGCAGCTAGAGATAGCCATGGTTGAATTGGA
JMFF051E11+ GCGGCACTCGAACGAGGGAAACACCGTGGAGCAGCTAGAGATAGCCATGGTTGAATTGGA
JMFF017P09+ GCGGCACTCGAACGAGGGAAACACCGTGGAGCAGCTAGAGATAGCCATGGTTGAATTGGA
JMFF017G10+ GCGGCACTCGAACGAGGGAAACACCGTGGAGCAGCTAGAGATAGCCATGGTTGAATTGGA
JMFF004B13+ GCGGCACTCGAACGAGGGAAACACCGTGGAGCAGCTAGAGATAGCCATGGTTGAATTGGA
JMFF012C09+ GCGGCACTCGAACGAGGGAAACACCGTGGAGCAGCTAGAGATAGCCATGGTTGAATTGGA
JMFF048F21+ GCGGCACTCGAACGAGGGAAACACCGTGGAGCAGCTAGAGATAGTCATGGTTGAATTGGA
JMFF011J03+ GCGGCACTCGAACGAGGGAAACACCGTGGAGCAGCTAGAGATAGCCATGGTTGAATTGGA
JMSF030G07+ GCGGCACTCGAACGAGGGAAACACCGTGGAGCAGCTAGAGATAGCCATGGTTGAATTGGA
JMFF016O19+ GCGGCACTCGAACGAGGGAAACACCGTGGAGCAGCTAGAGATAGCCATGGTTGAATTGGA
JMSF016I02+ GCGGCACTCGAACGAGGGAAACACCGTGGAGCAGCTAGAGATAGCCATGGTTGAATTGGA
JMFF022N12+ GCGGCACTCGAACGAGGGAAACACCGTGGAGCAGCTAGAGATAGCCATGGTTGAATTGGA
                      ____________________________________________________________
consensus GCGGCACTCGAACGAGGGAAACACCGTGGAGCAGCTAGAGATAGCCATGGTTGAATTGGA
 
. : . : . : . : . : . :
JMSF039N17+ GAGGTAAAAATCCGATTTTGGTTATGCTTTTGGCTTCCCTCTCCCTGAGATTAAAAATAG
JMFS085A09+ GAGGTAAAAATCCGATTTTGGTTATGCTTTTGGCTTCCCTCTCCCTGAGATTAAAAATAG
JMFF002N22+ GAGGTAAAAATCCGATTTTGGTTATGCTTTTGGCTTCCCTCT
JMFF002N20+ GAGGTAAAAATCCGATTTTGGTTATGCTTTTGGCTTCCCTCT
JMFS073D11+ GAGGTAAAAATCCGATTTTGGTTATGCTTTTGGCTTCCCTCTCCCTGAGATTAAAAATAG
JMFF051E11+ GAGGTAAAAATCCGATTTTGGTTATGCTTTTGGCTTCCCTCTCCCTGAGATTAAAAATAG
JMFF017P09+ GAGGTAAAAATCCGATTTTGGTTATGCTTTTGGCTTCCCTCTCCCTGAGATTAAAAATAG
JMFF017G10+ GAGGTAAAAATCCGATTTTGGTTATGCTTTTGGCTTCCCTCTCCCTGAGATTAAAAATAG
JMFF004B13+ GAGGTAAAAATCCGATTTTGGTTATGCTTTTGGCTTCCCTCTCCCTGAGATTAAAAATAG
JMFF012C09+ GAGGTAAAAATCCGATTTTGGTTATGCTTTTGGCTTCCCTCTCCCTGAGATTAAAAATAG
JMFF048F21+ GAGGTAAAAATCCGATTTTGGTTATGCTTTTGGCTTCCCTCTCCCTGAGATTAAAAATAG
JMFF011J03+ GAGGTAAAAATCCGATTTTGGTTATGCTTTTGGCTTCCCTCTCCCTGAGATTAAAAATAG
JMSF030G07+ GAGGTAAAAATCCGATTTTGGTTATGCTTTTGGCTTCCCTCTCCCTGAGATTAAAAATAG
JMFF016O19+ GAGGTAAAAATCCGATTTTGGTTATGCTTTTGGCTTCCCTCTCCCTGAGATTAAAAATAG
JMSF016I02+ GAGGTAAAAATCCGATTTTGGTTATGCTTTTGGCTTCCCTCTCCCTGAGATTAAAAATAG
JMFF022N12+ GAGGTAAAAATCCGATTTTGGTTATGCTTTTGGCTTCCCTCTCCCTGAGATTAAAAATAG
                      ____________________________________________________________
consensus GAGGTAAAAATCCGATTTTGGTTATGCTTTTGGCTTCCCTCTCCCTGAGATTAAAAATAG
 
. : . : . : . : . : . :
JMSF039N17+ AAAGG-CT
JMFS085A09+ AAAGG-CTAGTAAAAGAGAAGAAAAAAATAAAAAATCTAAA
JMFS073D11+ AAAGG-CTAGTAAAAGAGAAGAAAAAAATAAAAAATCTAAA
JMFF051E11+ AAAGG-CTAGTAAAAGAGAAGAAAAAAATAAAAAATCTAAAGGGGGAAGAAGAGAATC
JMFF017P09+ AAAGG-CTAGTAAAAGAGAAGAAAAAAATAAAAAATCTAAAGGGGGAAGAAGAGAATC
JMFF017G10+ AAAGG-CTAGTAAAAGAGAAGAAAAAAATAAAAAATCTAAAGGGGGAAGAAGAGAATC
JMFF004B13+ AAAGGNCTAGTAAAAGAGAAGAAAAAAATAAAAAATCTAAAGGGGGAAGAAGAGAAT
JMFF012C09+ AAAGG-CTAGTAAAAGAGAAGAAAAAAATAAAAAATCTAAAGGGGGAAGAAGAGAATC
JMFF048F21+ AAAGG-CTAGTAAAAGAGAAGAAAAAAATAAAAAATCTAAAGGGGGAAGAAGAGAATC
JMFF011J03+ AAAGG-CTAGTAAAAGAGAAGAAAAAAATAAAAAATCTAAAGGGGGAAGAAGAGAATC
JMSF030G07+ AAAGG-CTAGTAAAAGAGAAGAAAAAAATAAAAAATCTAAAGGGGGAAGAAGAGAATC
JMFF016O19+ AAAGG-CTAGTAAAAGAGAAGAAAAAAATAAAAAATCTAAAGGGGGAAGAAGAGAAT
JMSF016I02+ AAAGG-CTAGTAAAAGAGAAGAAAAAAATAAAAAATCTAAAGGGGGAAGAAGAGAATC
JMFF022N12+ AAAGG-CTAGTAAAAGAGAAGAAAAAAATAAAAAATCTAAAGGGGGAAGAAGAGAATCGT
                      ____________________________________________________________
consensus AAAGG-CTAGTAAAAGAGAAGAAAAAAATAAAAAATCTAAAGGGGGAAGAAGAGAATCGT