Previous Contig 001122:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF018J13Sequence527001122 (7)gb:AY064036_15659741e-05Arabidopsis thaliana unknown protein (At5g13260) mRNA, complete cds.>gb:AY113850
JMFF019E03Sequence526001122 (7)gb:AY064036_15659745e-05Arabidopsis thaliana unknown protein (At5g13260) mRNA, complete cds.>gb:AY113850673011558 (10)gb:AP004330_18402682e-57Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:OSJN
JMFF022M14Sequence471001122 (7)gb:AY064036_15659740.002Arabidopsis thaliana unknown protein (At5g13260) mRNA, complete cds.>gb:AY113850786011558 (10)gb:AY064036_15659742e-77Arabidopsis thaliana unknown protein (At5g13260) mRNA, complete cds.>gb:AY113850
JMSF005C13Sequence314001122 (7)417011558 (10)gb:AP004330_18402685e-34Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:OSJN
JMSF007I23Sequence267001122 (7)732011558 (10)gb:AP004330_18402682e-60Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:OSJN
JMSF010E04Sequence347001122 (7)gb:AY064036_15659740.002Arabidopsis thaliana unknown protein (At5g13260) mRNA, complete cds.>gb:AY113850685011558 (10)gb:AP004330_18402684e-54Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:OSJN
JMSF030B17Sequence690001122 (7)gb:AY064036_15659748e-05Arabidopsis thaliana unknown protein (At5g13260) mRNA, complete cds.>gb:AY113850786011558 (10)gb:AY064036_15659742e-82Arabidopsis thaliana unknown protein (At5g13260) mRNA, complete cds.>gb:AY113850

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF030B17+ GGACGAGTTGACGTTAAAGACCTCCCAGCTGATGTTGACCGATGAGATGGAGTTTCT
                      ____________________________________________________________
consensus GGACGAGTTGACGTTAAAGACCTCCCAGCTGATGTTGACCGATGAGATGGAGTTTCT
 
. : . : . : . : . : . :
JMFF019E03+ TTCTGAGCTAGCGAAGGAGAAGAGGATCTGCTACTGATCTTACTGGACGAA
JMFF018J13+ GGACGAA
JMSF030B17+ TCCACCATATTCTGAGCTAGCGAAGGAGAAGAGGATCTGCTACTGATCTTACTGGACGAA
                      ____________________________________________________________
consensus TCCACCATATTCTGAGCTAGCGAAGGAGAAGAGGATCTGCTACTGATCTTACTGGACGAA
 
. : . : . : . : . : . :
JMSF005C13+ ACCGTTAATTTTATTGTTACTGGTGTTGGGTGGNCCGGAG
JMFF019E03+ GCAGATGCCTTGGCAGCATTACCGTTAATTTTATTGTTACTGGTGTTGGGTGGGCCGGAG
JMFF018J13+ GCAGATGCCTTGGCAGCATTACCGTTAATTTTATTGTTACTGGTGTTGGGTGGGCCGGAG
JMSF030B17+ GCAGATGCCTTGGCAGCATTACCGTTAATTTTATTGTTACTGGTGTTGGGTGGGCCGGAG
                      ____________________________________________________________
consensus GCAGATGCCTTGGCAGCATTACCGTTAATTTTATTGTTACTGGTGTTGGGTGGGCCGGAG
 
. : . : . : . : . : . :
JMSF005C13+ GCAGTTCTGGACAGAGGCAGAGGAGGAGGAGCGAATCGGAACCCGAGATCATCATTATCT
JMFF019E03+ GCAGTTCTGGACAGAGGCAGAGGAGGAGGAGCGAATCGGAACCCGAGATCATCATTATCT
JMFF018J13+ GCAGTTCTGGACAGAGACAGAGGAGGAGGAGCGAATCGGAACCCGAGATCATCATTATCT
JMSF030B17+ GCAGTTCTGGACAGAGGCAGAGGAGGAGGAGCGAATCGGAACCCGAGATCATCATTATCT
                      ____________________________________________________________
consensus GCAGTTCTGGACAGAGGCAGAGGAGGAGGAGCGAATCGGAACCCGAGATCATCATTATCT
 
. : . : . : . : . : . :
JMSF005C13+ TCGTCCTCGTCTTCGTCATTGCCGGCGGCGGCTTGGGAGGCCATGACCTGAGCAAGCCGC
JMFF019E03+ TCGTCCTCGTCTTCGTCATTGCCGGCGGCGGCTTGGGAGGCCATGACCTGAGCAAGCCGC
JMFF018J13+ TCGTCCTCGTCTTCGTCATTGCCGGCGGCGGCTTGGGAGGCCATGACCTGAGCAAGCCGC
JMSF030B17+ TCGTCCTCGTCTTCGTCATTGCCGGCGGCGGCTTGGGAGGCCATGACCTGAGCAAGCCGC
JMSF010E04+ TCTTCGTCATTGCCGGCGGCGGCTTGGGAGGCCATGACCTGAGCAAGCCGC
JMFF022M14+ TCTTCGTCATTGCCGGCGGCGGCTTGGGAGGCCATGACCTGAGCAAGCCGC
                      ____________________________________________________________
consensus TCGTCCTCGTCTTCGTCATTGCCGGCGGCGGCTTGGGAGGCCATGACCTGAGCAAGCCGC
 
. : . : . : . : . : . :
JMSF005C13+ TGAGCAGCAGCTTTGGCGGCGACATTCTGAGTGCGCTTAATGCTGGACATACCGGAAACG
JMSF007I23+ TGAGTGCGCTTAATGCTGGACATACCGGAAACG
JMFF019E03+ TGAGCAGCAGCTTTGGCGGCGACATTCTGAGTGCGCTTAATGCTGGACATACCGGAAACG
JMFF018J13+ TGAGCAGCAGCTTTGGCGGCGACATTCTGAGTGCGCTTAATGCTGGACATACCGGAAACG
JMSF030B17+ TGAGCAGCAGCTTTGGCGGCGACATTCTGAGTGCGCTTAATGCTGGACATACCGGAAACG
JMSF010E04+ TGAGCAGCAGCTTTGGCGGCGACATTCTGAGTGCGCTTAATGCTGGACATACCGGAAACG
JMFF022M14+ TGAGCAGCAGCTTTGGCGGCGACATTCTGAGTGCGCTTAATGCTGGACATACCGGAAACG
                      ____________________________________________________________
consensus TGAGCAGCAGCTTTGGCGGCGACATTCTGAGTGCGCTTAATGCTGGACATACCGGAAACG
 
. : . : . : . : . : . :
JMSF005C13+ GAGGAGGAGCGACCATGGTGCGGACGCGGCGCGGAGGACGCGGCGGCCGGTGGATTGAGA
JMSF007I23+ GAGGAGGAGCGACCATGGTGCGGACGCGGCGCGGAGGACGCGGCGGCCGGTGGATTGAGA
JMFF019E03+ GAGGAGGAGCGACCATGGTGCGGACGCGGCGCGGAGGACGCGGCGGCCGGTGGATTGAGA
JMFF018J13+ GAGGAGGAGCGACCATGGTGCGGACGCGGCGCGGAGGACGCGGCGGCCGGTGGATTGAGA
JMSF030B17+ GAGGAGGAGCGACCATGGTGCGGACGCGGCGCGGAGGACGCGGCGGCCGGTGGATTGAGA
JMSF010E04+ GAGGAGGAGCGACCATGGTGCGGACGCGGCGCGGAGGACGCGGCGGCCGGTGGATTGAGA
JMFF022M14+ GAGGAGGAGCGACCATGGTGCGGACGCGGCGCGGAGGACGCGGCGGCCGGTGGATTGAGA
                      ____________________________________________________________
consensus GAGGAGGAGCGACCATGGTGCGGACGCGGCGCGGAGGACGCGGCGGCCGGTGGATTGAGA
 
. : . : . : . : . : . :
JMSF005C13+ ACTCCGGATTCGCTGCTCCAATGGCGCGCGTAC
JMSF007I23+ ACTCCGGATTCGCTGCTCCAATGGCGCGCGTACACCGGACTGTCGGTTCTCCTGGCCTCC
JMFF019E03+ ACTCCGGATTCGCTGCTCCAATGGCGCGCGTACACCGGACTGTCGGTTCTCCTGGCCTCC
JMFF018J13+ ACTCCAGATTCGCTGCTCCAATGGCGCGCGTACACCGGACTGTCGGTTCTCCTGGCCTCC
JMSF030B17+ ACTCCGGATTCGCTGCTCCAATGGCGCGCGTACACCGGACTGTCGGTTCTCCTGGCCTCC
JMSF010E04+ ACTCCGGATTCGCTGCTCCAATGGCGCGCGTACACCGGACTGTCGGTTCTCCTGGCCTCC
JMFF022M14+ ACTCCGGATTCGCTGCTCCAATGGCGCGCGTACACCGGACTGTCGGTTCTCCTGGCCTCC
                      ____________________________________________________________
consensus ACTCCGGATTCGCTGCTCCAATGGCGCGCGTACACCGGACTGTCGGTTCTCCTGGCCTCC
 
. : . : . : . : . : . :
JMSF007I23+ ATTGTTAAACCAGTAATGTTACTGCAAAAAAAATTACTGAAAACAGAGAAATGCGTGCTG
JMFF019E03+ ATTGTTAAACCAGTAATGTTACTGCAAAAAAAATTACTGAAAACAGAGAAATGCGTGCTG
JMFF018J13+ ATTGTTAAACCAGTAATGTTACTGCAAAAAAAATTACTGAAAACAGAGAAATGCGTGCTG
JMSF030B17+ ATTGTTAAACCAGTAATGTTACTGCAAAAAAAATTACTGAAAACAGAGAAATGCGTGCTG
JMSF010E04+ ATTGTTAAACCAGTAATGTTACTGCAAAAAAAATTACTGAAAACAGAGAAATGCGTGCTG
JMFF022M14+ ATTGTTAAACCAGTAATGTTACTGCAAAAAAAATTACTGAAAACAGAGAAATGCGTGCTG
                      ____________________________________________________________
consensus ATTGTTAAACCAGTAATGTTACTGCAAAAAAAATTACTGAAAACAGAGAAATGCGTGCTG
 
. : . : . : . : . : . :
JMSF007I23+ AAATTCAGACGAAATTTTCGGGGAGACGCCTAGATTTGAGAGAGTTGCTCTCC
JMFF019E03+ AAATTCAGACGAAATTTTCGGGGAGACGCCTAGATTTGAGAGAGTTGCTCTCC
JMFF018J13+ AAATTCAGACGAAATTTTCGGGGAGACGCCTAGATTTGAGAGAGTTGCTCTCCCTGAGAG
JMSF030B17+ AAATTCAGACGAAATTTTCGGGGAGACGCCTAGATTTGAGAGAGTTGCTCTCCCTGAGAG
JMSF010E04+ AAATTCAGACGAAATTTTCGGGGAGACGCCTAGATTTGAGAGAGTTGCTCTCCC
JMFF022M14+ AAATTCAGACGAAATTTTCGGGGAGACGCCTAGATTTGAGAGAGTTGCTCTCCCTGAGAG
                      ____________________________________________________________
consensus AAATTCAGACGAAATTTTCGGGGAGACGCCTAGATTTGAGAGAGTTGCTCTCCCTGAGAG
 
. : . : . : . : . : . :
JMFF018J13+ ATTTACGGAGAAGGATATTTGTGTGTTTGTAGTTGGTGCC
JMSF030B17+ ATTTACGGAGAAGGATATTTGTGTGTTTGTAGTTGGTGCCGGAGAAGCGGCGGAGCCTCA
JMFF022M14+ ATTTACGGAGAAGGATATTTGTGTGTTTGTAGTTGGTGCCGGAGAAGCGGCGGAGCCTCA
                      ____________________________________________________________
consensus ATTTACGGAGAAGGATATTTGTGTGTTTGTAGTTGGTGCCGGAGAAGCGGCGGAGCCTCA
 
. : . : . : . : . : . :
JMSF030B17+ CGCTCCCGGAATAGCGCTTGGTGTTTCTCGTT
JMFF022M14+ CGCTCCCGGAATAGCGCTTGGTGTTTCTCGTTGCGGTGCGGCCGTGACCCGTGTGGATGC
                      ____________________________________________________________
consensus CGCTCCCGGAATAGCGCTTGGTGTTTCTCGTTGCGGTGCGGCCGTGACCCGTGTGGATGC