Previous Contig 001120:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF022K19Sequence462001120 (4)gb:AB009053_15106845e-08Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MQB2.603010930 (3)gb:AP003076_18246502e-07Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P048
JMFS118A12Sequence613001120 (4)gb:BT000720_16349939e-39Arabidopsis thaliana clone RAFL09-73-M24 (R19648) putative nitrate transporter (
JMFS126F09Sequence613001120 (4)gb:BT000720_16349932e-28Arabidopsis thaliana clone RAFL09-73-M24 (R19648) putative nitrate transporter (
JMFS135H06Sequence617001120 (4)gb:BT000720_16349932e-20Arabidopsis thaliana clone RAFL09-73-M24 (R19648) putative nitrate transporter (

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS118A12+ GTAATTTCAACTTTCGATTTTTATGGACACAACAATAACCT
                      ____________________________________________________________
consensus GTAATTTCAACTTTCGATTTTTATGGACACAACAATAACCT
 
. : . : . : . : . : . :
JMFS118A12+ GAATTATTCTTAAGATGGGGGTGTCGCCGGGCGATTGAAGGCGATAGAAAGGGCGGCCGG
                      ____________________________________________________________
consensus GAATTATTCTTAAGATGGGGGTGTCGCCGGGCGATTGAAGGCGATAGAAAGGGCGGCCGG
 
. : . : . : . : . : . :
JMFS118A12+ CGGCGAGGAAGACGAAGCCAAAGATGGTTCCGATTGTAGAGATGAGAAAACCCAACCACC
                      ____________________________________________________________
consensus CGGCGAGGAAGACGAAGCCAAAGATGGTTCCGATTGTAGAGATGAGAAAACCCAACCACC
 
. : . : . : . : . : . :
JMFS118A12+ AACCTTTATTAGTGCTGACCCAAACAACAAGGGTGACTCCAAAAGCTGCCCCAGTTGTGC
                      ____________________________________________________________
consensus AACCTTTATTAGTGCTGACCCAAACAACAAGGGTGACTCCAAAAGCTGCCCCAGTTGTGC
 
. : . : . : . : . : . :
JMFS118A12+ TGGTTAGCAACATGTAGTTGAAGTAGCTCCCAAGGGCTTTGGATTCCCTGGGATCCTTTT
JMFS126F09+ T
                      ____________________________________________________________
consensus TGGTTAGCAACATGTAGTTGAAGTAGCTCCCAAGGGCTTTGGATTCCCTGGGATCCTTTT
 
. : . : . : . : . : . :
JMFS118A12+ GATCAAACTGGTCAGCACCCAGAGCTGGTAGGGCACCCCTAACCCCACCGGTCCCCAGTG
JMFS126F09+ GATCAAACTGGTCAGCACCCAGAGCTGGTAGGGCACCCCTAACCCCACCGGTCCCCAGTG
                      ____________________________________________________________
consensus GATCAAACTGGTCAGCACCCAGAGCTGGTAGGGCACCCCTAACCCCACCGGTCCCCAGTG
 
. : . : . : . : . : . :
JMFS118A12+ CCAGCACACAAAGTGATACATAAAATAGTAGGGCTATGCCCCCCTCTACACAGCTTGACT
JMFS126F09+ CCAGCACACAAAGTGATACATAAAATAGTAGGGCTATGCCCCCCTCTACACAGCTTGACT
JMFS135H06+ AAAGTGATACATAAAATAGTAGGGCTATGCCCCCCTCTACACAGCTTGACT
                      ____________________________________________________________
consensus CCAGCACACAAAGTGATACATAAAATAGTAGGGCTATGCCCCCCTCTACACAGCTTGACT
 
. : . : . : . : . : . :
JMFS118A12+ TCCCACATGCCTCCGCTTGAAAACTCTTGAACCTTGCTTGAATTGTCATCAATATCAATC
JMFS126F09+ TCCCACATGCCTCCGCTTGCAAACTCTTGAACCTTGCTTGAATTGTCATCAATATCAATC
JMFS135H06+ TCCCACATGCCTCCGCTTGCAAACTCTTGAACCTTGCTTGAATTGTCATCAATATCAATC
                      ____________________________________________________________
consensus TCCCACATGCCTCCGCTTGCAAACTCTTGAACCTTGCTTGAATTGTCATCAATATCAATC
 
. : . : . : . : . : . :
JMFS118A12+ CCAGTATCTCAAGCATTCCAAAAATGAGACATGTGTGGAATCTGGTGAGCAAAGTGTCAG
JMFS126F09+ CCAGTATCTCAAGCATTCCAAAAATGAGACATGTGTGGAATCTGGTGAGCAAAGTGTCAG
JMFS135H06+ CCAGTATCTCAAGCATTCCAAAAATGAGACATGTGTGGAATCTGGTGAGCAAAGTGTCAG
                      ____________________________________________________________
consensus CCAGTATCTCAAGCATTCCAAAAATGAGACATGTGTGGAATCTGGTGAGCAAAGTGTCAG
 
. : . : . : . : . : . :
JMFS118A12+ AAATGAGGCCACCAACAATAGAGAGCAAGAAACTTGAGCCCATGAAGTTTGTGAGTGTGT
JMFS126F09+ AAATGAGGCCACCAACAATAGAGAGCAAGAAACTTGAGCCCATGAAGTTTGTGAGTGTGT
JMFS135H06+ AAATGAGGCCACCAACAATAGAGAGCAAGAAACTTGAGCCCATGAAGTTTGTGAGTGTGT
JMFF022K19+ TAGAGAGCAAGAAACTTGAGCCCATGAAGTTTGTGAGTGTGT
                      ____________________________________________________________
consensus AAATGAGGCCACCAACAATAGAGAGCAAGAAACTTGAGCCCATGAAGTTTGTGAGTGTGT
 
. : . : . : . : . : . :
JMFS118A12+ TGGCTGAGCCAGAGATGTCAAAATGCATCTTC
JMFS126F09+ TGGCTGAGCCAGAGATGTCAAAATGCATCTTCAGCATGAAGTACAGCACCATGCTAACCA
JMFS135H06+ TGGCTGAGCCAGAGATGTCAAAATGCATCTTCAGCATGAAGTACAGCACCATGCTAACCA
JMFF022K19+ TGGCTGAGCCAGAGATGTCAAAATGCATCTTCAGCATGAAGTACAGCACCATGCTAACCA
                      ____________________________________________________________
consensus TGGCTGAGCCAGAGATGTCAAAATGCATCTTCAGCATGAAGTACAGCACCATGCTAACCA
 
. : . : . : . : . : . :
JMFS126F09+ TGTTTGCTACAAACCCCATGTTGTCCATTGCCCCCAAAGCATATATGAAACAAGAAGCTC
JMFS135H06+ TGTTTGCTACAAACCCCATGTTGTCCATTGCCCCCAAAGCATATATGAAACAAGAAGCTC
JMFF022K19+ TGTTTGCTACAAACCCCATGTTGTCCATTGCCCCCAAAGCATATATGAAACAAGAAGCTC
                      ____________________________________________________________
consensus TGTTTGCTACAAACCCCATGTTGTCCATTGCCCCCAAAGCATATATGAAACAAGAAGCTC
 
. : . : . : . : . : . :
JMFS126F09+ TAAAACCACCTTTCCCTTTTACTTTCCATCCACTGATGGAATTATAGTCTGGCTTAGTAT
JMFS135H06+ TAAAACCACCTTTCCCTTTTACTTTCCATCCACTGATGGAATTATAGTCTGGCTTAGTAT
JMFF022K19+ TAAAACCACCTTTCCCTTTTACTTTCCATCCACTGATGGAATTATAGTCTGACTTAGTAT
                      ____________________________________________________________
consensus TAAAACCACCTTTCCCTTTTACTTTCCATCCACTGATGGAATTATAGTCTGGCTTAGTAT
 
. : . : . : . : . : . :
JMFS126F09+ TTTCCTCCATGGCAGCAGCTAAAGGGTGGCAGTTAGATCAAGAGAGAAACTAACTGCCAC
JMFS135H06+ TTTCCTCCATGGCAGCAGCTAAAGGGTGGCAGTTAGATCAAGAGAGAAACTAACTGCCAC
JMFF022K19+ TTTCCTCCATGGCAGCAGCTAAAGGGTGGCAGTTAGATCAAGAGAGAAACTAACTGCCAC
                      ____________________________________________________________
consensus TTTCCTCCATGGCAGCAGCTAAAGGGTGGCAGTTAGATCAAGAGAGAAACTAACTGCCAC
 
. : . : . : . : . : . :
JMFS126F09+ TATATATATATGCTTTCTGGATCTGTGTATGAAGTCTGATGGGTAGCTAGGGAAATGGCA
JMFS135H06+ TATATATATATGCTTTCTGGATCTGTGTATGAAGTCTGATGGGTAGCTAGGGAAATGGCA
JMFF022K19+ TATATATATATGCTTTCTGGATCTGTGTATGAAGTCTGATGGGTAGCTAGGGAAATGGCA
                      ____________________________________________________________
consensus TATATATATATGCTTTCTGGATCTGTGTATGAAGTCTGATGGGTAGCTAGGGAAATGGCA
 
. : . : . : . : . : . :
JMFS126F09+ GAACTGAAGAAA
JMFS135H06+ GAACTGAAGAAATTTGGGTGGAATGAAGTGGAAAATGGAAGGACAAGAATTTAAT-AAGA
JMFF022K19+ GAACTGAAGAAATTTGGGTGGAATGAAGTGGAAAATGGAAGGACAAGAATTTAATGAAGA
                      ____________________________________________________________
consensus GAACTGAAGAAATTTGGGTGGAATGAAGTGGAAAATGGAAGGACAAGAATTTAATGAAGA
 
. : . : . : . : . : . :
JMFS135H06+ GATGAGAATAATGAGTATAATTGTGTG
JMFF022K19+ GATGAGAATAATGAGTATAATTGTGTGTAGTGATGGAATGACTTGGGTTGTTGGTTTAAT
                      ____________________________________________________________
consensus GATGAGAATAATGAGTATAATTGTGTGTAGTGATGGAATGACTTGGGTTGTTGGTTTAAT