Previous Contig 001108:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF014A16Sequence757001108 (18)sp|Q9LF30|R192_ARATH3e-6640S ribosomal protein S19-2.>pir|T51530|T51530 40S RIBOSOMAL PROTEIN S19-like -
JMFF021C08Sequence582001108 (18)sp|Q9LF30|R192_ARATH2e-6640S ribosomal protein S19-2.>pir|T51530|T51530 40S RIBOSOMAL PROTEIN S19-like - 652001108 (18)sp|Q9LF30|R192_ARATH3e-6640S ribosomal protein S19-2.>pir|T51530|T51530 40S RIBOSOMAL PROTEIN S19-like -
JMFF022D04Sequence554001108 (18)sp|Q9LF30|R192_ARATH2e-6640S ribosomal protein S19-2.>pir|T51530|T51530 40S RIBOSOMAL PROTEIN S19-like - 681001108 (18)sp|Q9LF30|R192_ARATH3e-6640S ribosomal protein S19-2.>pir|T51530|T51530 40S RIBOSOMAL PROTEIN S19-like -
JMFF029D23Sequence549001108 (18)sp|Q9LF30|R192_ARATH2e-6640S ribosomal protein S19-2.>pir|T51530|T51530 40S RIBOSOMAL PROTEIN S19-like - 677001108 (18)sp|Q9LF30|R192_ARATH3e-6640S ribosomal protein S19-2.>pir|T51530|T51530 40S RIBOSOMAL PROTEIN S19-like -
JMFN006N10Sequence587001108 (18)sp|Q9LF30|R192_ARATH1e-5840S ribosomal protein S19-2.>pir|T51530|T51530 40S RIBOSOMAL PROTEIN S19-like -
JMFN018N16Sequence614001108 (18)sp|Q9LF30|R192_ARATH2e-6640S ribosomal protein S19-2.>pir|T51530|T51530 40S RIBOSOMAL PROTEIN S19-like -
JMFN025N03Sequence611001108 (18)sp|Q9LF30|R192_ARATH6e-6440S ribosomal protein S19-2.>pir|T51530|T51530 40S RIBOSOMAL PROTEIN S19-like -
JMFN030H20Sequence648001108 (18)sp|Q9LF30|R192_ARATH3e-6640S ribosomal protein S19-2.>pir|T51530|T51530 40S RIBOSOMAL PROTEIN S19-like -
JMFN031L10Sequence577001108 (18)sp|Q9LF30|R192_ARATH2e-6640S ribosomal protein S19-2.>pir|T51530|T51530 40S RIBOSOMAL PROTEIN S19-like -
JMFN034A03Sequence573001108 (18)sp|Q9LF30|R192_ARATH2e-5640S ribosomal protein S19-2.>pir|T51530|T51530 40S RIBOSOMAL PROTEIN S19-like -
JMSF016J01Sequence448002269 (4)gb:AY085971_15710328e-27Arabidopsis thaliana clone 2031 mRNA, complete sequence.713001108 (18)sp|Q9LF30|R192_ARATH3e-6640S ribosomal protein S19-2.>pir|T51530|T51530 40S RIBOSOMAL PROTEIN S19-like -
JMSF043A05Sequence782001108 (18)sp|Q9LF30|R192_ARATH4e-6640S ribosomal protein S19-2.>pir|T51530|T51530 40S RIBOSOMAL PROTEIN S19-like - 678001108 (18)sp|Q9LF30|R192_ARATH3e-6640S ribosomal protein S19-2.>pir|T51530|T51530 40S RIBOSOMAL PROTEIN S19-like -
JMSF053E05Sequence691001108 (18)sp|Q9LF30|R192_ARATH3e-6640S ribosomal protein S19-2.>pir|T51530|T51530 40S RIBOSOMAL PROTEIN S19-like - 702001108 (18)sp|Q9LF30|R192_ARATH3e-6640S ribosomal protein S19-2.>pir|T51530|T51530 40S RIBOSOMAL PROTEIN S19-like -

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF043A05+ TTTTTTT
                      ____________________________________________________________
consensus TTTTTTT
 
. : . : . : . : . : . :
rJMFF022D04- ATGATATAACAATGTCAATTCTC
rJMSF043A05- ATGATATAACAATGTCAATTCTC
JMFN034A03+ C
JMFN006N10- CTC
JMSF043A05+ TTTGGAAATGGATGGAATCAATCTGTAAAAGGCATAAATGATATAACAATGTCAATTCTC
JMFN025N03+ C
rJMFF014A16- ATCTGTAAAAGGCATAAATGATATAACAATGTCAATTCTC
                      ____________________________________________________________
consensus TTTGGAAATGGATGGAATCAATCTGTAAAAGGCATAAATGATATAACAATGTCAATTCTC
 
. : . : . : . : . : . :
rJMFF022D04- AGAACCTGATAAGATTAATATTCAAACTTCAACAACACAAACATTTTGGATGAAACACAA
rJMSF043A05- AGAACCTGATAAGATTAATATTCAAACTTCAACAACACAAACATTTTGGATGAAACACAA
rJMFF029D23- CTTCAACAACACAAACATTTTGGATGAAACACAA
rJMFF021C08- ACCTGATAAGATTAATATTCAAACTTCAACAACACAAACATTTTGGATGAAACACAA
JMFN034A03+ AGAACCTGATAAGATTAATATTCAAACTTCAACAACACAAACATTTTGGATGAAACACAA
JMFN006N10- AGAACCTGATAAGATTAATATTCAAACTTCAACAACACAAACATTTTGGATGAAACACAA
JMSF043A05+ AGAACCTGATAAGATTAATATTCAAACTTCAACAACACAAACATTTTGGATGAAACACAA
rJMSF016J01- AGATTAATATTCAAACTTCAACAACACAAACATTTTGGATGAAACACAA
JMFN030H20+ AA
JMFN025N03+ AGAACCTGATAAGATTAATATTCAAACTTCAACAACACAAACATTTTGGATGAAACACAA
rJMFF014A16- AGAACCTGATAAGATTAATATTCAAACTTCAACAACACAAACATTTTGGATGAAACACAA
rJMSF053E05- AATATTCAAACTTCAACAACACAAACATTTTGGATGAAACACAA
JMSF053E05+ TTCAACAACACAAACATTTTGGATGAAACACAA
                      ____________________________________________________________
consensus AGAACCTGATAAGATTAATATTCAAACTTCAACAACACAAACATTTTGGATGAAACACAA
 
. : . : . : . : . : . :
rJMFF022D04- GGAAGCTACCCAAGTATTTGAAAGTAAGAATTGTCTCAAAATTTTGGAAGTAACATCTCT
rJMSF043A05- GGAAGCTACCCAAGTATTTGAAAGTAAGAATTGTCTCAAAATTTTGGAAGTAACATCTCT
rJMFF029D23- GGAAGCTACCCAAGTATTTGAAAGTAAGAATTGTCTCAAAATTTTGGAAGTAACATCTCT
rJMFF021C08- GGAAGCTACCCAAGTATTTGAAAGTAAGAATTGTCTCAAAATTTTGGAAGTAACATCTCT
JMFN034A03+ GGAAGCTACCCAAGTATTTGAAAGTAAGAATTGTCTCAAAATTTTGGAAGTAACATCTCT
JMFN006N10- GGAAGCTACCCAAGTATTTGAAAGTAAGAATTGTCTCAAAATTTTGGAAGTAACATCTCT
JMSF043A05+ GGAAGCTACCCAAGTATTTGAAAGTAAGAATTGTCTCAAAATTTTGGAAGTAACATCTCT
rJMSF016J01- GGAAGCTACCCAAGTATTTGAAAGTAAGAATTGTCTCAAAATTTTGGAAGTAACATCTCT
JMFN030H20+ GGAAGCTACCCAAGTATTTGAAAGTAAGAATTGTCTCAAAATTTTGGAAGTAACATCTCT
JMFN018N16+ AAGTAAGAATTGTCTCAAAATTTTGGAAGTAACATCTCT
JMFN025N03+ GGAAGCTACCCAAGTATTTGAAAGTAAGAATTGTCTCAAAATTTTGGAAGTAACATCTCT
rJMFF014A16- GGAAGCTACCCAAGTATTTGAAAGTAAGAATTGTCTCAAAATTTTGGAAGTAACATCTCT
rJMSF053E05- GGAAGCTACCCAAGTATTTGAAAGTAAGAATTGTCTCAAAATTTTGGAAGTAACATCTCT
JMSF053E05+ GGAAGCTACCCAAGTATTTGAAAGTAAGAATTGTCTCAAAATTTTGGAAGTAACATCTCT
                      ____________________________________________________________
consensus GGAAGCTACCCAAGTATTTGAAAGTAAGAATTGTCTCAAAATTTTGGAAGTAACATCTCT
 
. : . : . : . : . : . :
rJMFF022D04- GGAACAAGCTAATTATAACAGTAGTTCAAACATCACATATATCTTGCTTCTGCCGTGCAA
rJMSF043A05- GGAACAAGCTAATTATAACAGTAGTTCAAACATCACATATATCTTGCTTCTGCCGTGCAA
rJMFF029D23- GGAACAAGCTAATTATAACAGTAGTTCAAACATCACATATATCTTGCTTCTGCCGTGCAA
rJMFF021C08- GGAACAAGCTAATTATAACAGTAGTTCAAACATCACATATATCTTGCTTCTGCCGTGCAA
JMFN034A03+ GGAACAAGCTAATTATAACAGTAGTTCAAACATCACATATATCTTGCTTCTGCCGTGCAA
JMFN006N10- GGAACAAGCTAATTATAACAGTAGTTCAAACATCACATATATCTTGCTTCTGCCGTGCAA
JMSF043A05+ GGAACAAGCTAATTATAACAGTAGTTCAAACATCACATATATCTTGCTTCTGCCGTGCAA
rJMSF016J01- GGAACAAGCTAATTATAACAGTAGTTCAAACATCACATATATCTTGCTTCTGCCGTGCAA
JMFN030H20+ GGAACAAGCTAATTATAACAGTAGTTCAAACATCACATATATCTTGCTTCTGCCGTGCAA
JMFN018N16+ GGAACAAGCTAATTATAACAGTAGTTCAAACATCACATATATCTTGCTTCTGCCGTGCAA
JMFN025N03+ GGAACAAGCTAATTATAACAGTAGTTCAAACATCACATATATCTTGCTTCTGCCGTGCAA
JMFN031L10+ AATTATAACAGTAGTTCAAACATCACATATATCTTGCTTCTGCCGTGCAA
rJMFF014A16- GGAACAAGCTAATTATAACAGTAGTTCAAACATCACATATATCTTGCTTCTGCCGTGCAA
rJMSF053E05- GGAACAAGCTAATTATAACAGTAGTTCAAACATCACATATATCTTGCTTCTGCCGTGCAA
JMSF053E05+ GGAACAAGCTAATTATAACAGTAGTTCAAACATCACATATATCTTGCTTCTGCCGTGCAA
JMFF029D23+ TGCCGTGCAA
JMFF021C08+ ACAGTAGTTCAAACATCACATATATCTTGCTTCTGCCGTGCAA
JMFF022D04+ CTTCTGCCGTGCAA
                      ____________________________________________________________
consensus GGAACAAGCTAATTATAACAGTAGTTCAAACATCACATATATCTTGCTTCTGCCGTGCAA
 
. : . : . : . : . : . :
rJMFF022D04- TCACTACTGTCCTTCAAGGTGCAACAACAACAATTCGGCCAGCAACTTGATCAAGATCGC
rJMSF043A05- TCACTACTGTCCTTCAAGGTGCAACAACAACAATTCGGCCAGCAACTTGATCAAGATCGC
rJMFF029D23- TCACTACTGTCCTTCAAGGTGCAACAACAACAATTCGGCCAGCAACTTGATCAAGATCGC
rJMFF021C08- TCACTACTGTCCTTCAAGGTGCAACAACAACAATTCGGCCAGCAACTTGATCAAGATCGC
JMFN034A03+ TCACTACTGTCCTTCAAGGTGCAACAACAACAATTCGGCCAGCAACTTGATCAAGATCGC
JMFN006N10- TCACTACTGTCCTTCAAGGTGCAACAACAACAATTCGGCCAGCAACTTGATCAAGATCGC
JMSF043A05+ TCACTACTGTCCTTCAAGGTGCAACAACAACAATTCGGCCAGCAACTTGATCAAGATCGC
rJMSF016J01- TCACTACTGTCCTTCAAGGTGCAACAACAACAATTCGGCCAGCAACTTGATCAAGATCGC
JMFN030H20+ TCACTACTGTCCTTCAAGGTGCAACAACAACAATTCGGCCAGCAACTTGATCAAGATCGC
JMFN018N16+ TCACTACTGTCCTTCAAGGTGCAACAACAACAATTCGGCCAGCAACTTGATCAAGATCGC
JMFN025N03+ TCACTACTGTCCTTCAAGGTGCAACAACAACAATTCGGCCAGCAACTTGATCAAGATCGC
JMFN031L10+ TCACTACTGTCCTTCAAGGTGCAACAACAACAATTCGGCCAGCAACTTGATCAAGATCGC
rJMFF014A16- TCACTACTGTCCTTCAAGGTGCAACAACAACAATTCGGCCAGCAACTTGATCAAGATCGC
rJMSF053E05- TCACTACTGTCCTTCAAGGTGCAACAACAACAATTCGGCCAGCAACTTGATCAAGATCGC
JMSF053E05+ TCACTACTGTCCTTCAAGGTGCAACAACAACAATTCGGCCAGCAACTTGATCAAGATCGC
JMFF029D23+ TCACTACTGTCCTTCAAGGTGCAACAACAACAATTCGGCCAGCAACTTGATCAAGATCGC
JMFF021C08+ TCACTACTGTCCTTCAAGGTGCAACAACAACAATTCGGCCAGCAACTTGATCAAGATCGC
JMFF022D04+ TCACTACTGTCCTTCAAGGTGCAACAACAACAATTCGGCCAGCAACTTGATCAAGATCGC
                      ____________________________________________________________
consensus TCACTACTGTCCTTCAAGGTGCAACAACAACAATTCGGCCAGCAACTTGATCAAGATCGC
 
. : . : . : . : . : . :
rJMFF022D04- GTTGGCCACTGGATGTTATCCTCCTTCCACCTCTTGGATCAACTTCAATGATACTCATTG
rJMSF043A05- GTTGGCCACTGGATGTTATCCTCCTTCCACCTCTTGGATCAACTTCAATGATACTCATTG
rJMFF029D23- GTTGGCCACTGGATGTTATCCTCCTTCCACCTCTTGGATCAACTTCAATGATACTCATTG
rJMFF021C08- GTTGGCCACTGGATGTTATCCTCCTTCCACCTCTTGGATCAACTTCAATGATACTCATTG
JMFN034A03+ GTTGGCCACTGGATGTTATCCTCCTTCCACCTCTTGGATCAACTTCAATGATACTCATTG
JMFN006N10- GTTGGCCACTGGATGTTATCCTCCTTCCACCTCTTGGATCAACTTCAATGATACTCATTG
JMSF043A05+ GTTGGCCACTGGATGTTATCCTCCTTCCACCTCTTGGATCAACTTCAATGATACTCATTG
rJMSF016J01- GTTGGCCACTGGATGTTATCCTCCTTCCACCTCTTGGATCAACTTCAATGATACTCATTG
JMFN030H20+ GTTGGCCACTGGATGTTATCCTCCTTCCACCTCTTGGATCAACTTCAATGATACTCATTG
JMFN018N16+ GTTGGCCACTGGATGTTATCCTCCTTCCACCTCTTGGATCAACTTCAATGATACTCATTG
JMFN025N03+ GTTGGCCACTGGATGTTATCCTCCTTCCACCTCTTGGATCAACTTCAATGATACTCATTG
JMFN031L10+ GTTGGCCACTGGATGTTATCCTCCTTCCACCTCTTGGATCAACTTCAATGATACTCATTG
rJMFF014A16- GTTGGCCACTGGATGTTATCCTCCTTCCACCTCTTGGATCAACTTCAATGATACTCATTG
rJMSF053E05- GTTGGCCACTGGATGTTATCCTCCTTCCACCTCTTGGATCAACTTCAATGATACTCATTG
JMSF053E05+ GTTGGCCACTGGATGTTATCCTCCTTCCACCTCTTGGATCAACTTCAATGATACTCATTG
JMFF029D23+ GTTGGCCACTGGATGTTATCCTCCTTCCACCTCTTGGATCAACTTCAATGATACTCATTG
JMFF021C08+ GTTGGCCACTGGATGTTATCCTCCTTCCACCTCTTGGATCAACTTCAATGATACTCATTG
JMFF022D04+ GTTGGCCACTGGATGTTATCCTCCTTCCACCTCTTGGATCAACTTCAATGATACTCATTG
                      ____________________________________________________________
consensus GTTGGCCACTGGATGTTATCCTCCTTCCACCTCTTGGATCAACTTCAATGATACTCATTG
 
. : . : . : . : . : . :
rJMFF022D04- TCTGCAATTGTTGCAAAATGTGGCGGGCAATAGCACCACTGCTCTTGCAAAAGTGGCGTG
rJMSF043A05- TCTGCAATTGTTGCAAAATGTGGCGGGCAATAGCACCACTGCTCTTGCAAAAGTGGCGTG
rJMFF029D23- TCTGCAATTGTTGCAAAATGTGGCGGGCAATAGCACCACTGCTCTTGCAAAAGTGGCGTG
rJMFF021C08- TCTGCAATTGTTGCAAAATGTGGCGGGCAATAGCACCACTGCTCTTGCAAAAGTGGCGTG
JMFN034A03+ TCTGCAATTGTTGCAAAATGTGGCGGGCAATAGCACCACTGCTCTTGCAAAAGTGGCGTG
JMFN006N10- TCTGCAATTGTTGCAAAATGTGGCGGGCAATAGCACCACTGCTCTTGCAAAAGTGGCGTG
JMSF043A05+ TCTGCAATTGTTGCAAAATGTGGCGGGCAATAGCACCACTGCTCTTGCAAAAGTGGCGTG
rJMSF016J01- TCTGCAATTGTTGCAAAATGTGGCGGGCAATAGCACCACTGCTCTTGCAAAAGTGGCGTG
JMFN030H20+ TCTGCAATTGTTGCAAAATGTGGCGGGCAATAGCACCACTGCTCTTGCAAAAGTGGCGTG
JMFN018N16+ TCTGCAATTGTTGCAAAATGTGGCGGGCAATAGCACCACTGCTCTTGCAAAAGTGGCGTG
JMFN025N03+ TCTGCAATTGTTGCAAAATGTGGCGGGCAATAGCACCACTGCTCTTGCAAAAGTGGCGTG
JMFN031L10+ TCTGCAATTGTTGCAAAATGTGGCGGGCAATAGCACCACTGCTCTTGCAAAAGTGGCGTG
rJMFF014A16- TCTGCAATTGTTGCAAAATGTGGCGGGCAATAGCACCACTGCTCTTGCAAAAGTGGCGTG
rJMSF053E05- TCTGCAATTGTTGCAAAATGTGGCGGGCAATAGCACCACTGCTCTTGCAAAAGTGGCGTG
JMSF053E05+ TCTGCAATTGTTGCAAAATGTGGCGGGCAATAGCACCACTGCTCTTGCAAAAGTGGCGTG
JMFF029D23+ TCTGCAATTGTTGCAAAATGTGGCGGGCAATAGCACCACTGCTCTTGCAAAAGTGGCGTG
JMFF021C08+ TCTGCAATTGTTGCAAAATGTGGCGGGCAATAGCACCACTGCTCTTGCAAAAGTGGCGTG
JMFF022D04+ TCTGCAATTGTTGCAAAATGTGGCGGGCAATAGCACCACTGCTCTTGCAAAAGTGGCGTG
                      ____________________________________________________________
consensus TCTGCAATTGTTGCAAAATGTGGCGGGCAATAGCACCACTGCTCTTGCAAAAGTGGCGTG
 
. : . : . : . : . : . :
rJMFF022D04- GGCAGCTTCCATTTCTCTTGTTTGATCCATAGATCCTTTGGAAGGCTCCAACTCCAAGGC
rJMSF043A05- GGCAGCTTCCATTTCTCTTGTTTGATCCATAGATCCTTTGGAAGGCTCCAACTCCAAGGC
rJMFF029D23- GGCAGCTTCCATTTCTCTTGTTTGATCCATAGATCCTTTGGAAGGCTCCAACTCCAAGGC
rJMFF021C08- GGCAGCTTCCATTTCTCTTGTTTGATCCATAGATCCTTTGGAAGGCTCCAACTCCAAGGC
JMFN034A03+ GGCAGCTTCCATTTCTCTTGTTTGATCCATAGATCCTTTGGAAGGCTCCAACTCCAAGGC
JMFN006N10- GGCAGCTTCCATTTCTCTTGTTTGATCCATAGATCCTTTGGAAGGCTCCAACTCCAAGGC
JMSF043A05+ GGCAGCTTCCATTTCTCTTGTTTGATCCATAGATCCTTTGGAAGGCTCCAACTCCAAGGC
rJMSF016J01- GGCAGCTTCCATTTCTCTTGTTTGATCCATAGATCCTTTGGAAGGCTCCAACTCCAAGGC
JMFN030H20+ GGCAGCTTCCATTTCTCTTGTTTGATCCATAGATCCTTTGGAAGGCTCCAACTCCAAGGC
JMFN018N16+ GGCAGCTTCCATTTCTCTTGTTTGATCCATAGATCCTTTGGAAGGCTCCAACTCCAAGGC
JMFN025N03+ GGCAGCTTCCATTTCTCTTGTTTGATCCATAGATCCTTTGGAAGGCTCCAACTCCAAGGC
JMFN031L10+ GGCAGCTTCCATTTCTCTTGTTTGATCCATAGATCCTTTGGAAGGCTCCAACTCCAAGGC
rJMFF014A16- GGCAGCTTCCATTTCTCTTGTTTGATCCATAGATCCTTTGGAAGGCTCCAACTCCAAGGC
rJMSF053E05- GGCAGCTTCCATTTCTCTTGTTTGATCCATAGATCCTTTGGAAGGCTCCAACTCCAAGGC
JMSF053E05+ GGCAGCTTCCATTTCTCTTGTTTGATCCATAGATCCTTTGGAAGGCTCCAACTCCAAGGC
JMFF029D23+ GGCAGCTTCCATTTCTCTTGTTTGATCCATAGATCCTTTGGAAGGCTCCAACTCCAAGGC
JMFF021C08+ GGCAGCTTCCATTTCTCTTGTTTGATCCATAGATCCTTTGGAAGGCTCCAACTCCAAGGC
JMFF022D04+ GGCAGCTTCCATTTCTCTTGTTTGATCCATAGATCCTTTGGAAGGCTCCAACTCCAAGGC
                      ____________________________________________________________
consensus GGCAGCTTCCATTTCTCTTGTTTGATCCATAGATCCTTTGGAAGGCTCCAACTCCAAGGC
 
. : . : . : . : . : . :
rJMFF022D04- CACCCCTCAAGTAAATCTTCCTAGCCATGGAAGCTGCTCTGATGTAATACCAATCAGGGT
rJMSF043A05- CACCCCTCAAGTAAATCTTCCTAGCCATGGAAGCTGCTCTGATGTAATACCAATCAGGGT
rJMFF029D23- CACCCCTCAAGTAAATCTTCCTAGCCATGGAAGCTGCTCTGATGTAATACCAATCAGGGT
rJMFF021C08- CACCCCTCAAGTAAATCTTCCTAGCCATGGAAGCTGCTCTGATGTAATACCAATCAGGGT
JMFN034A03+ CACCCCTCAAGTAAATCTTCCTAGCCATGGAAGCTGCTCTGATGTAATACCAATCAGGGT
JMFN006N10- CACCCCTCAAGTAAATCTTCCTAGCCATGGAAGCTGCTCTGATGTAATACCAATCAGGGT
JMSF043A05+ CACCCCTCAAGTAAATCTTCCTAGCCATGGAAGCTGCTCTGATGTAATACCAATCAGGGT
rJMSF016J01- CACCCCTCAAGTAAATCTTCCTAGCCATGGAAGCTGCTCTGATGTAATACCAATCAGGGT
JMFN030H20+ CACCCCTCAAGTAAATCTTCCTAGCCATGGAAGCTGCTCTGATGTAATACCAATCAGGGT
JMFN018N16+ CACCCCTCAAGTAAATCTTCCTAGCCATGGAAGCTGCTCTGATGTAATACCAATCAGGGT
JMFN025N03+ CACCCCTCAAGTAAATCTTCCTAGCCATGGAAGCTGCTCTGATGTAATACCAATCAGGGT
JMFN031L10+ CACCCCTCAAGTAAATCTTCCTAGCCATGGAAGCTGCTCTGATGTAATACCAATCAGGGT
rJMFF014A16- CACCCCTCAAGTAAATCTTCCTAGCCATGGAAGCTGCTCTGATGTAATACCAATCAGGGT
rJMSF053E05- CACCCCTCAAGTAAATCTTCCTAGCCATGGAAGCTGCTCTGATGTAATACCAATCAGGGT
JMSF053E05+ CACCCCTCAAGTAAATCTTCCTAGCCATGGAAGCTGCTCTGATGTAATACCAATCAGGGT
JMFF029D23+ CACCCCTCAAGTAAATCTTCCTAGCCATGGAAGCTGCTCTGATGTAATACCAATCAGGGT
JMFF021C08+ CACCCCTCAAGTAAATCTTCCTAGCCATGGAAGCTGCTCTGATGTAATACCAATCAGGGT
JMFF022D04+ CACCCCTCAAGTAAATCTTCCTAGCCATGGAAGCTGCTCTGATGTAATACCAATCAGGGT
                      ____________________________________________________________
consensus CACCCCTCAAGTAAATCTTCCTAGCCATGGAAGCTGCTCTGATGTAATACCAATCAGGGT
 
. : . : . : . : . : . :
rJMFF022D04- CATATGGAGCAAGTTCTTTCAACCTACCAGTCTTCACAATATCAGTCCACTCGGGAAGTT
rJMSF043A05- CATATGGAGCAAGTTCTTTCAACCTACCAGTCTTCACAATATCAGTCCACTCGGGAAGTT
rJMFF029D23- CATATGGAGCAAGTTCTTTCAACCTACCAGTCTTCACAATATCAGTCCACTCGGGAAGTT
rJMFF021C08- CATATGGAGCAAGTTCTTTCAACCTACCAGTCTTCACAATATCAGTCCACTCGGGAAGTT
JMFN034A03+ CATATGGAGCAAGTTCTTTCAACCTACCAGTCTTCACAATATCAGTCCACTCGGGAAGTT
JMFN006N10- CATATGGAGCAAGTTCTTTCAACCTACCAGTCTTCACAATATCAGTCCACTCGGGAAGTT
JMSF043A05+ CATATGGAGCAAGTTCTTTCAACCTACCAGTCTTCACAATATCAGTCCACTCGGGAAGTT
rJMSF016J01- CATATGGAGCAAGTTCTTTCAACCTACCAGTCTTCACAATATCAGTCCACTCGGGAAGTT
JMFN030H20+ CATATGGAGCAAGTTCTTTCAACCTACCAGTCTTCACAATATCAGTCCACTCGGGAAGTT
JMFN018N16+ CATATGGAGCAAGTTCTTTCAACCTACCAGTCTTCACAATATCAGTCCACTCGGGAAGTT
JMFN025N03+ CATATGGAGCAAGTTCTTTCAACCTACCAGTCTTCACAATATCAGTCCACTCGGGAAGTT
JMFN031L10+ CATATGGAGCAAGTTCTTTCAACCTACCAGTCTTCACAATATCAGTCCACTCGGGAAGTT
rJMFF014A16- CATATGGAGCAAGTTCTTTCAACCTACCAGTCTTCACAATATCAGTCCACTCGGGAAGTT
rJMSF053E05- CATATGGAGCAAGTTCTTTCAACCTACCAGTCTTCACAATATCAGTCCACTCGGGAAGTT
JMSF053E05+ CATATGGAGCAAGTTCTTTCAACCTACCAGTCTTCACAATATCAGTCCACTCGGGAAGTT
JMFF029D23+ CATATGGAGCAAGTTCTTTCAACCTACCAGTCTTCACAATATCAGTCCACTCGGGAAGTT
JMFF021C08+ CATATGGAGCAAGTTCTTTCAACCTACCAGTCTTCACAATATCAGTCCACTCGGGAAGTT
JMFF022D04+ CATATGGAGCAAGTTCTTTCAACCTACCAGTCTTCACAATATCAGTCCACTCGGGAAGTT
                      ____________________________________________________________
consensus CATATGGAGCAAGTTCTTTCAACCTACCAGTCTTCACAATATCAGTCCACTCGGGAAGTT
 
. : . : . : . : . : . :
rJMFF022D04- CCATCTTTCCAGAACGCTTAAGGTGAGCAGAGTAAGCCTTCACGAACTCGTGAGGAGAAA
rJMSF043A05- CCATCTTTCCAGAACGCTTAAGGTGAGCAGAGTAAGCCTTCACGAACTCGTGAGGAGAAA
rJMFF029D23- CCATCTTTCCAGAACGCTTAAGGTGAGCAGAGTAAGCCTTCACGAACTCGTGAGGAGAAA
rJMFF021C08- CCATCTTTCCAGAACGCTTAAGGTGAGCAGAGTAAGCCTTCACGAACTCGTGAGGAGAAA
JMFN034A03+ CCATCTTTCCAGAACGCTTAAGGTGAGCAGAG
JMFN006N10- CCATCTTTCCAGAACGCTTAAGGTGAGCAGAGTAAGCCTTCACG
JMSF043A05+ CCATCTTTCCAGAACGCTTAAGGTGAGCAGAGTAAGCCTTCACGAACTCGTGAGGAGAAA
rJMSF016J01- CCATCTTTCCAGAACGCTTAAGGTGAGCAGAGTAAGCCTTCACGAACTCGTGAGGAGAAA
JMFN030H20+ CCATCTTTCCAGAACGCTTAAGGTGAGCAGAGTAAGCCTTCACGAACTCGTGAGGAGAAA
JMFN018N16+ CCATCTTTCCAGAACGCTTAAGGTGAGCAGAGTAAGCCTTCACGAACTCGTGAGGAGAAA
JMFN025N03+ CCATCTTTCCAGAACGCTTAAGGTGAGCAGAGTAAGCCTTCACGAACTCGTGAGGAGAAA
JMFN031L10+ CCATCTTTCCAGAACGCTTAAGGTGAGCAGAGTAAGCCTTCACGAACTCGTGAGGAGAAA
rJMFF014A16- CCATCTTTCCAGAACGCTTAAGGTGAGCAGAGTAAGCCTTCACGAACTCGTGAGGAGAAA
rJMSF053E05- CCATCTTTCCAGAACGCTTAAGGTGAGCAGAGTAAGCCTTCACGAACTCGTGAGGAGAAA
JMSF053E05+ CCATCTTTCCAGAACGCTTAAGGTGAGCAGAGTAAGCCTTCACGAACTCGTGAGGAGAAA
JMFF029D23+ CCATCTTTCCAGAACGCTTAAGGTGAGCAGAGTAAGCCTTCACGAACTCGTGAGGAGAAA
JMFF021C08+ CCATCTTTCCAGAACGCTTAAGGTGAGCAGAGTAAGCCTTCACGAACTCGTGAGGAGAAA
JMFF022D04+ CCATCTTTCCAGAACGCTTAAGGTGAGCAGAGTAAGCCTTCACGAACTCGTGAGGAGAAA
                      ____________________________________________________________
consensus CCATCTTTCCAGAACGCTTAAGGTGAGCAGAGTAAGCCTTCACGAACTCGTGAGGAGAAA
 
. : . : . : . : . : . :
rJMFF022D04- CGTCTTTCACAGTTCTCGCCGTCGCCATTGCTGCAATTGCTGGCACCTCTGCAGGGAG
rJMSF043A05- CGTCTTTCACAGTTCTCGCCGTCGCCATTGCTGCAATTGCTGGCACCTCTGCAG
rJMFF029D23- CGTCTTTCACAGTTCTCGCCGTCGCCATTGCTGCAATTGCTGGCACCTCTGCAGGGAGAA
rJMFF021C08- CGTCTTTCACAGTTCTCGCCGTCGCCATTGCTGCAATTGCTGGCACCTCTGCA
JMSF043A05+ CGTCTTTCACAGTTCTCGCCGTCGCCATTGCTGCAATTGCTGGCACCTCTGCAGGGAGAA
rJMSF016J01- CGTCTTTCACAGTTCTCGCCGTCGCCATTGCTGCAATTGCTGGCACCTCTGCAGGGAGAA
JMFN030H20+ CGTCTTTCACAGTTCTCGCCGTCGCCATTGCTGCAATTGCTGGCACCTCTGCAGGGAGAA
JMFN018N16+ CGTCTTTCACAGTTCTCGCCGTCGCCATTGCTGCAATTGCTGGCACCTCTGCAGGGAGAA
JMFN025N03+ CGTCTTTCAC
JMFN031L10+ CGTCTTTCACAGTTCTCGCCGTCGCCATTGCTGCAATTGCTGGCACCTCTGCAGGGAGAA
rJMFF014A16- CGTCTTTCACAGTTCTCGCCGTCGCCATTGCTGCAATTGCTGGCACCTCTGCAGGGAGAA
rJMSF053E05- CGTCTTTCACAGTTCTCGCCGTCGCCATTGCTGCAATTGCTGGCACCTCTGCAGGGAGAA
JMSF053E05+ CGTCTTTCACAGTTCTCGCCGTCGCCATTGCTGCAATTGCTGGCACCTCTGCAGGGAGAA
JMFF029D23+ CGTCTTTCACAGTTCTCGCCGTCGCCATTGCTGCAATTGCTGGCACCTCTGCAGGGAGAA
JMFF021C08+ CGTCTTTCACAGTTCTCGCCGTCGCCATTGCTGCAATTGCTGGCACCTCTGCAGGGAGAA
JMFF022D04+ CGTCTTTCACAGTTCTCGCCGTCGCCATTGCTGCAATTGCTGGCACCTCTGCAGGGAGAA
                      ____________________________________________________________
consensus CGTCTTTCACAGTTCTCGCCGTCGCCATTGCTGCAATTGCTGGCACCTCTGCAGGGAGAA
 
. : . : . : . : . : . :
rJMFF029D23- GCGTTGAGAGGGCGCCGCTGACCAGGATGGAACGACACAACTC
JMSF043A05+ GCGTTGAGAGGGCGCCGCTGACCAGGATGGAACGACACAACTCAGAAGTGTTTC
rJMSF016J01- GCGTTGAGAGGGCGCCGCTGACCAGGATGGAACGACACAACTCAGAAGTGTTTCA
JMFN030H20+ GCGTTGAGAGGGCGCCGCTGACCAGGATGGAACGACACAACTCAGA
JMFN018N16+ GCGTTGAGAGGGCGCCGCTGACCAGGATGGAACGA
JMFN031L10+ GCGTTGAGAGGGCGCCGCTGACCAGGATGGAACGACACAACTCAGAA
rJMFF014A16- GCGTTGAGAGGGCGCCGCTGACCAGGATGGAACGACACAACTCAGAAGTGTTTCAG
rJMSF053E05- GCGTTGAGAGGGCGCCGCTGACCAGGATGGAACGACACAACTCAGAAGTGTTTCAGT
JMSF053E05+ GCGTTGAGAGGGCGCCGCTGACCAGGATGGAACGACACAACTCAGAAGTGTTTCAGT
JMFF029D23+ GCGTTGAGAGGGCGCCGCTGACCAGGATGGAACGACACAACTCAGAAGTGTTTCAGT
JMFF021C08+ GCGTTGAGAGGGCGCCGCTGACCAGGATGGAACGACACAACTCAGAAGTGTTTCAGT
JMFF022D04+ GCGTTGAGAGGGCGCCGCTGACCAGGATGGAACGACACAACTCAGAAGTGTTTCAGTAGT
                      ____________________________________________________________
consensus GCGTTGAGAGGGCGCCGCTGACCAGGATGGAACGACACAACTCAGAAGTGTTTCAGTAGT