Previous Contig 001107:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF004G10Sequence656001107 (26)sp|Q9C5D7|CAM3_ARATH2e-66Putative caffeoyl-CoA O-methyltransferase At4g26220 (EC 2.1.1.104) (Trans-caffeo701001107 (26)gb:AY145521_15838732e-65Mesembryanthemum crystallinum O-methyltransferase mRNA, complete cds.
JMFF005J06Sequence461001107 (26)gb:AY145521_15838735e-28Mesembryanthemum crystallinum O-methyltransferase mRNA, complete cds.459001107 (26)gb:AY145521_15838734e-28Mesembryanthemum crystallinum O-methyltransferase mRNA, complete cds.
JMFF022D03Sequence495001107 (26)gb:AY087244_15722781e-46Arabidopsis thaliana clone 33227 mRNA, complete sequence.651001107 (26)gb:AY145521_15838732e-60Mesembryanthemum crystallinum O-methyltransferase mRNA, complete cds.
JMFF022F20Sequence574001107 (26)sp|Q9C5D7|CAM3_ARATH5e-56Putative caffeoyl-CoA O-methyltransferase At4g26220 (EC 2.1.1.104) (Trans-caffeo724001107 (26)gb:AY145521_15838732e-66Mesembryanthemum crystallinum O-methyltransferase mRNA, complete cds.
JMFF032M14Sequence569001107 (26)sp|Q9C5D7|CAM3_ARATH2e-55Putative caffeoyl-CoA O-methyltransferase At4g26220 (EC 2.1.1.104) (Trans-caffeo722001107 (26)gb:AY145521_15838735e-66Mesembryanthemum crystallinum O-methyltransferase mRNA, complete cds.
JMFF043P06Sequence650001107 (26)sp|Q9C5D7|CAM3_ARATH3e-67Putative caffeoyl-CoA O-methyltransferase At4g26220 (EC 2.1.1.104) (Trans-caffeo584001107 (26)gb:AY145521_15838732e-46Mesembryanthemum crystallinum O-methyltransferase mRNA, complete cds.
JMFN002E03Sequence600001107 (26)pir|T06006|T060068e-61caffeoyl-CoA O-methyltransferase (EC 2.1.1.104) T25K17.30 - Arabidopsis thaliana
JMFN007B22Sequence627001107 (26)sp|Q9C5D7|CAM3_ARATH2e-66Putative caffeoyl-CoA O-methyltransferase At4g26220 (EC 2.1.1.104) (Trans-caffeo
JMFN009C15Sequence608001107 (26)sp|Q9C5D7|CAM3_ARATH4e-65Putative caffeoyl-CoA O-methyltransferase At4g26220 (EC 2.1.1.104) (Trans-caffeo
JMFN013K11Sequence627001107 (26)sp|Q9C5D7|CAM3_ARATH2e-66Putative caffeoyl-CoA O-methyltransferase At4g26220 (EC 2.1.1.104) (Trans-caffeo
JMFN014M17Sequence599001107 (26)sp|Q9C5D7|CAM3_ARATH1e-64Putative caffeoyl-CoA O-methyltransferase At4g26220 (EC 2.1.1.104) (Trans-caffeo
JMFN028E13Sequence610001107 (26)sp|Q9C5D7|CAM3_ARATH6e-67Putative caffeoyl-CoA O-methyltransferase At4g26220 (EC 2.1.1.104) (Trans-caffeo
JMFN032D12Sequence625001107 (26)sp|Q9C5D7|CAM3_ARATH2e-66Putative caffeoyl-CoA O-methyltransferase At4g26220 (EC 2.1.1.104) (Trans-caffeo
JMFN033O18Sequence624001107 (26)pir|T06006|T060067e-69caffeoyl-CoA O-methyltransferase (EC 2.1.1.104) T25K17.30 - Arabidopsis thaliana
JMFN038B24Sequence627001107 (26)sp|Q9C5D7|CAM3_ARATH1e-62Putative caffeoyl-CoA O-methyltransferase At4g26220 (EC 2.1.1.104) (Trans-caffeo
JMFN038I06Sequence615001107 (26)sp|Q9C5D7|CAM3_ARATH2e-64Putative caffeoyl-CoA O-methyltransferase At4g26220 (EC 2.1.1.104) (Trans-caffeo
JMFN039E20Sequence634001107 (26)sp|Q9C5D7|CAM3_ARATH2e-66Putative caffeoyl-CoA O-methyltransferase At4g26220 (EC 2.1.1.104) (Trans-caffeo
JMFN042H08Sequence267001107 (26)gb:AY087244_15722780.003Arabidopsis thaliana clone 33227 mRNA, complete sequence.
JMFS084F07Sequence621001107 (26)sp|Q9C5D7|CAM3_ARATH3e-67Putative caffeoyl-CoA O-methyltransferase At4g26220 (EC 2.1.1.104) (Trans-caffeo
JMFS135C08Sequence596001107 (26)sp|Q9C5D7|CAM3_ARATH3e-68Putative caffeoyl-CoA O-methyltransferase At4g26220 (EC 2.1.1.104) (Trans-caffeo

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF005J06- ATTTATT
JMFF005J06+ ATTTATT
rJMFF043P06- ATTTAATTTATT
                      ____________________________________________________________
consensus ATTTAATTTATT
 
. : . : . : . : . : . :
rJMFF005J06- ATTATTATTATATTAATGGTCTGAGCATACACTGGTGACTCTACCAGTACAGAAAATATC
JMFF005J06+ ATTATTATTATATTAATGGTCTGAGCATACACTGGTGACTCTACCAGTACAGAAAATATC
rJMFF043P06- ATTATTATTATATTAATGGTCTGAGCATACACTGGTGACTCTACCAGTACAGAAAATATC
rJMFF032M14- ATATTAATGGTCTGAGCATACACTGGTGACTCTACCAGTACAGAAAATATC
rJMFF022D03- ATACACTGGTGACTCTACCAGTACAGAAAATATC
rJMFF022F20- ATGGTCTGAGCATACACTGGTGACTCTACCAGTACAGAAAATATC
rJMFF004G10- GTGACTCTACCAGTACAGAAAATATC
                      ____________________________________________________________
consensus ATTATTATTATATTAATGGTCTGAGCATACACTGGTGACTCTACCAGTACAGAAAATATC
 
. : . : . : . : . : . :
rJMFF005J06- CAAAGAAGCTAAGAAATCCACGAACACAGATAGATGAGGAGATGAACATACAGTACAGAT
JMFF005J06+ CAAAGAAGCTAAGAAATCCACGAACACAGATAGATGAGGAGATGAACATACAGTACAGAT
rJMFF043P06- CAAAGAAGCTAAGAAATCCACGAACACAGATAGATGAGGAGATGAACATACAGTACAGAT
rJMFF032M14- CAAAGAAGCTAAGAAATCCACGAACACAGATAGATGAGGAGATGAACATACAGTACAGAT
rJMFF022D03- CAAAGAAGCTAAGAAATCCACGAACACAGATAGATGAGGAGATGAACATACAGTACAGAT
JMFN002E03+ AGATAGATGAGGAGATGAACATACAGTACAGAT
rJMFF022F20- CAAAGAAGCTAAGAAATCCACGAACACAGATAGATGAGGAGATGAACATACAGTACAGAT
rJMFF004G10- CAAAGAAGCTAAGAAATCCACGAACACAGATAGATGAGGAGATGAACATACAGTACAGAT
                      ____________________________________________________________
consensus CAAAGAAGCTAAGAAATCCACGAACACAGATAGATGAGGAGATGAACATACAGTACAGAT
 
. : . : . : . : . : . :
rJMFF005J06- TCATCACTCATTTGAGACGCTTACAAATCGTAATCCCATCGCCTACAGGGACGTGAGAGA
JMFF005J06+ TCATCACTCATTTGAGACGCTTACAAATCGTAATCCCATCGCCTACAGGGACGTGAGAGA
rJMFF043P06- TCATCACTCATTTGAGACGCTTACAAATCGTAATCCCATCGCCTACAGGGACGTGAGAGA
rJMFF032M14- TCATCACTCATTTGAGACGCTTACAAATCGTAATCCCATCGCCTACAGGGACGTGAGAGA
rJMFF022D03- TCATCACTCATTTGAGACGCTTACAAATCGTAATCCCATCGCCTACAGGGACGTGAGAGA
JMFN002E03+ TCATCACTCA-TTGAGACGCTTACAAATCGTAATCCCATCGCCTACAGGGACGTGAGAGA
rJMFF022F20- TCATCACTCATTTGAGACGCTTACAAATCGTAATCCCATCGCCTACAGGGACGTGAGAGA
rJMFF004G10- TCATCACTCATTTGAGACGCTTACAAATCGTAATCCCATCGCCTACAGGGACGTGAGAGA
JMFN033O18+ CATTTGAGACGCTTACAAATCGTAATCCCATCGCCTACAGGGACGTGAGAGA
                      ____________________________________________________________
consensus TCATCACTCATTTGAGACGCTTACAAATCGTAATCCCATCGCCTACAGGGACGTGAGAGA
 
. : . : . : . : . : . :
rJMFF005J06- TGTGAACTCGATCATCAGAAGCCAAAAATGCATTAAACTCAATTGTGCTCTGCCGGGCTG
JMFF005J06+ TGTGAACTCGATCATCAGAAGCCAAAAATGCATTAAACTCAATTGTGCTCTGCCGGGCTG
rJMFF043P06- TGTGAACTCGATCATCAGAAGCCAAAAATGCATTAAACTCAATTGTGCTCTGCCGGGCTG
rJMFF032M14- TGTGAACTCGATCATCAGAAGCCAAAAATGCATTAAACTCAATTGTGCTCTGCCGGGCTG
rJMFF022D03- TGTGAACTCGATCATCAGAAGCCAAAAATGCATTAAACTCAATTGTGCTCTGCCGGGCTG
JMFN002E03+ TGTGAACTCGATCATCAGAAGCCAAAAATGCATTAAACTCAATTGTGCTCTGCCGGGCTG
rJMFF022F20- TGTGAACTCGATCATCAGAAGCCAAAAATGCATTAAACTCAATTGTGCTCTGCCGGGCTG
rJMFF004G10- TGTGAACTCGATCATCAGAAGCCAAAAATGCATTAAACTCAATTGTGCTCTGCCGGGCTG
JMFN033O18+ TGTGAACTCGATCATCAGAAGCCAAAAATGCATTAAACTCAATTGTGCTCTGCCGGGCTG
JMFS135C08+ CTCAATTGTGCTCTGCGGGGCTG
JMFN028E13+ G
                      ____________________________________________________________
consensus TGTGAACTCGATCATCAGAAGCCAAAAATGCATTAAACTCAATTGTGCTCTGCCGGGCTG
 
. : . : . : . : . : . :
rJMFF005J06- GTTTCATCCAGCCGGTTACAGACTCCTCCGGCATCACAACAGATCCTCCCAACAGGGTAT
JMFF005J06+ GTTTCATCCAGCCGGTTACAGACTCCTCCGGCATCACAACAGATCCTCCCAACAGGGTAT
rJMFF043P06- GTTTCATCCAGCCGGTTACAGACTCCTCCGGCATCACAACAGATCCTCCCAACAGGGTAT
rJMFF032M14- GTTTCATCCAGCCGGTTACAGACTCCTCCGGCATCACAACAGATCCTCCCAACAGGGTAT
rJMFF022D03- GTTTCATCCAGCCGGTTACAGACTCCTCCGGCATCACAACAGATCCTCCCAACAGGGTAT
JMFN002E03+ GTTTCATCCAGCCGGTTACAGACTCCTCCGGCATCACAACAGATCCTCCCAACAGGGTAT
rJMFF022F20- GTTTCATCCAGCCGGTTACAGACTCCTCCGGCATCACAACAGATCCTCCCAACAGGGTAT
rJMFF004G10- GTTTCATCCAGCCGGTTACAGACTCCTCCGGCATCACAACAGATCCTCCCAACAGGGTAT
JMFN033O18+ GTTTCATCCAGCCGGTTACAGACTCCTCCGGCATCACAACAGATCCTCCCAACAGGGTAT
JMFS135C08+ GTTTCATCCAGCCGGTTACAGACTCCTCGGGCATCACAACAGATCCTCCCAACAGGGTAT
JMFN028E13+ GTTTCATCCAGCCGGTTACAGACTCTCCNGGCATCACAACAGATCCTCCCAACAGGGTAT
JMFN013K11+ ACAGACTCCTCCGGCATCACAACAGATCCTCCCAACAGGGTAT
JMFN007B22+ GGTTACAGACTCCTCCGGCATCACAACAGATCCTCCCAACAGGGTAT
JMFN039E20+ CGGTTACAGACTCCTCCGGCATCACAACAGATCCTCCCAACAGGGTAT
JMFS084F07+ ATCCAGCCGGTTACAGACTCCTCCGGCATCACAACAGATCCTCCCAACAGGGTAT
JMFN038I06+ GGCATCACAACAGATCCTCCCAACAGGGTAT
JMFN009C15+ CAACAGATCCTCCCAACAGGGTAT
JMFN038B24+ CAGCCGGTTACAGACTCCTCCGGCATCACAACAGATCCTCCCAACAGGGTAT
JMFN014M17+ ACAGATCCTCCCAACAGGGTAT
JMFF043P06+ TTTCATCCAGCCGGTTACAGACTCTTCCGGCATCACAACAGATCCTCCCAACAGGGTAT
JMFN032D12+ CGGTTACAGACTCCTCCGGCATCACAACAGATCCTCCCAACAGGGTAT
JMFF004G10+ GTTTCATCCAGCNGGTTACAGACTCCTCCGGCATCACAACAGATCCTCCCAACAGGGTAT
                      ____________________________________________________________
consensus GTTTCATCCAGCCGGTTACAGACTCCTCCGGCATCACAACAGATCCTCCCAACAGGGTAT
 
. : . : . : . : . : . :
rJMFF005J06- TATCGTACACTATGATCCCACCAACCTTAATCAACTGCAATAGCTTTTCATGGTACTCTT
JMFF005J06+ TATCGTACACTATGATCCCACCAACCTTAATCAACTGCAATAGCTTTTCATGGTACTCTT
rJMFF043P06- TATCGTACACTATGATCCCACCAACCTTAATCAACTGCAATAGCTTTTCATGGTACTCTT
rJMFF032M14- TATCGTACACTATGATCCCACCAACCTTAATCAACTGCAATAGCTTTTCATGGTACTCTT
rJMFF022D03- TATCGTACACTATGATCCCACCAACCTTAATCAACTGCAATAGCTTTTCATGGTACTCTT
JMFN002E03+ TATCGTACACTATGATCCCACCAACCTTAATCAACTGCAATAGCTTTTCATGGTACTCTT
rJMFF022F20- TATCGTACACTATGATCCCACCAACCTTAATCAACTGCAATAGCTTTTCATGGTACTCTT
rJMFF004G10- TATCGTACACTATGATCCCACCAACCTTAATCAACTGCAATAGCTTTTCATGGTACTCTT
JMFN033O18+ TATCGTACACTATGATCCCACCAACCTTAATCAACTGCAATAGCTTTTCATGGTACTCTT
JMFS135C08+ TATCGTACACTATGATCCCACCAACCTTAATCAACTGCAATAGCTTTTCATGGTACTCTT
JMFN028E13+ TATCGTACACTATGATCCCACCAACCTTAATCAACTGCAATAGCTTTTCATGGTACTCTT
JMFN013K11+ TATCGTACACTATGATCCCACCAACCTTAATCAACTGCAATAGCTTTTCATGGTACTCTT
JMFN007B22+ TATCGTACACTATGATCCCACCAACCTTAATCAACTGCAATAGCTTTTCATGGTACTCTT
JMFN039E20+ TATCGTACACTATGATCCCACCAACCTTAATCAACTGCAATAGCTTTTCATGGTACTCTT
JMFS084F07+ TATCGTACACTATGATCCCACCAACCTTAATCAACTGCAATAGCTTTTCATGGTACTCTT
JMFN038I06+ TATCGTACACTATGATCCCACTAACCTTAATCAACTGCAATAGCTTTTCATGGTACTCTT
JMFN009C15+ TATCGTACACTATGATCCCACCAACCTTAATCAACTGCAATAGCTTTTCATGGTACTCTT
JMFN038B24+ TATCGTACACTATGATCCCACCAACCTTAATCAACTGCAATAGCTTTTCATGGTACTCTT
JMFN014M17+ TATCGTACACTATGATCCCACCAACCTTAATCAACTGCAATAGCTTTTCATGGTACTCTT
JMFF043P06+ TATCGTACACTATGATCCCACCAACCTTAATCAACTGCAATAGCTTTTCATGGTACTCTT
JMFN032D12+ TATCGTACACTATGATCCCACCAACCTTAATCAACTGCAATAGCTTTTCATGGTACTCTT
JMFF004G10+ TATCGTACACTATGATCCCACCAACCTTAATCAACTGCAATAGCTTTTCATGGTACTCTT
JMFF032M14+ CAACTGCAATAGCTTTTCATGGTACTCTT
JMFF022F20+ TTAATCAACTGCAATAGCTTTTCATGGTACTCTT
                      ____________________________________________________________
consensus TATCGTACACTATGATCCCACCAACCTTAATCAACTGCAATAGCTTTTCATGGTACTCTT
 
. : . : . : . : . : . :
rJMFF005J06- TGTAACTCACTTTGTCAGCATCCACAAAAGCATAGTCAACACTCTCCATGTTACTGCTAT
JMFF005J06+ TGTAACTCACTTTGTCAGCATCCACAAAAGCATAGTCAACACTCTCCATGTTACTGCTAT
rJMFF043P06- TGTAACTCACTTTGTCAGCATCCACAAAAGCATAGTCAACACTCTCCATGTTACTGCTAT
rJMFF032M14- TGTAACTCACTTTGTCAGCATCCACAAAAGCATAGTCAACACTCTCCATGTTACTGCTAT
rJMFF022D03- TGTAACTCACTTTGTCAGCATCCACAAAAGCATAGTCAACACTCTCCATGTTACTGCTAT
JMFN002E03+ TGTAACTCACTTTGTCAGCATCCACAAAAGCATAGTCAACACTCTCCATGTTACTGCTAT
rJMFF022F20- TGTAACTCACTTTGTCAGCATCCACAAAAGCATAGTCAACACTCTCCATGTTACTGCTAT
rJMFF004G10- TGTAACTCACTTTGTCAGCATCCACAAAAGCATAGTCAACACTCTCCATGTTACTGCTAT
JMFN033O18+ TGTAACTCACTTTGTCAGCATCCACAAAAGCATAGTCAACACTCTCCATGTTACTGCTAT
JMFS135C08+ TGTAACTCACTTTGTCAGCATCCACAAAAGCATAGTCAACACTCTCCATGTTACTGCTAT
JMFN028E13+ TGTAACTCACTTTGTCAGCATCCACAAAAGCATAGTCAACACTCTCCATGTTACTGCTAT
JMFN013K11+ TGTAACTCACTTTGTCAGCATCCACAAAAGCATAGTCAACACTCTCCATGTTACTGCTAT
JMFN007B22+ TGTAACTCACTTTGTCAGCATCCACAAAAGCATAGTCAACACTCTCCATGTTACTGCTAT
JMFN039E20+ TGTAACTCACTTTGTCAGCATCCACAAAAGCATAGTCAACACTCTCCATGTTACTGCTAT
JMFS084F07+ TGTAACTCACTTTGTCAGCATCCACAAAAGCATAGTCAACACTCTCCATGTTACTGCTAT
JMFN038I06+ TGTAACTCACTTTGTCAGCATCCACAAAAGCATAGTCAACACTCTCCATGTTACTGCTAT
JMFN009C15+ TGTAACTCACTTTGTCAGCATCCACAAAAGCATAGTCAACACTCTCCATGTTACTGCTAT
JMFN038B24+ TGTAACTCACTTTGTCAGCATCCACAAAAGCATAGTCAACACTCTCCATGTTA-----AT
JMFN014M17+ TGTAACTCACTTTGTCAGCATCCACAAAAGCATAGTCAACACTCTCCATGTTACTGCTAT
JMFF043P06+ TGTAACTCACTTTGTCAGCATCCACAAAAGCATAGTCAACACTCTCCATGTTACTGCTAT
JMFN032D12+ TGTAACTCACTTTGTCAGCATCCACAAAAGCATAGTCAACACTCTCCATGTTACTGCTAT
JMFF004G10+ TGTAACTCACTTTGTCAGCATCCACAAAAGCATAGTCAACACTCTCCATGTTACTGCTAT
JMFF032M14+ TGTAACTCACTTTGTCAGCATCCACAAAAGCATAGTCAACACTCTCCATGTTACTGCTAT
JMFF022F20+ TGTAACTCACTTTGTCAGCATCCACAAAAGCATAGTCAACACTCTCCATGTTACTGCTAT
JMFF022D03+ CCATGTTACTGCTAT
                      ____________________________________________________________
consensus TGTAACTCACTTTGTCAGCATCCACAAAAGCATAGTCAACACTCTCCATGTTACTGCTAT
 
. : . : . : . : . : . :
rJMFF005J06- CTTCGAGGAGGTGATCAAGAGCTGTCAAGGCA
JMFF005J06+ CTTCGAGGAGGTGATCAAGAGCTGTCAAGGCA
rJMFF043P06- CTTCGAGGAGGTGATCAAGAGCTGTCAAGGCATCAGACTCAACAAAAGTGATTTTGTGAT
rJMFF032M14- CTTCGAGGAGGTGATCAAGAGCTGTCAAGGCATCAGACTCAACAAAAGTGATTTTGTGAT
rJMFF022D03- CTTCGAGGAGGTGATCAAGAGCTGTCAAGGCATCAGACTCAACAAAAGTGATTTTGTGAT
JMFN002E03+ CTTCGAGGAGGTGATCAAGAGCTGTCAAGGCATCAGACTCAACAAAAGTGATTTTGTGAT
rJMFF022F20- CTTCGAGGAGGTGATCAAGAGCTGTCAAGGCATCAGACTCAACAAAAGTGATTTTGTGAT
rJMFF004G10- CTTCGAGGAGGTGATCAAGAGCTGTCAAGGCATCAGACTCAACAAAAGTGATTTTGTGAT
JMFN033O18+ CTTCGAGGAGGTGATCAAGAGCTGTCAAGGCATCAGACTCAACAAAAGTGATTTTGTGAT
JMFS135C08+ CTTCGAGGAGGTGATCAAGAGCTGTCAAGGCATCAGACTCAACAAAAGTGATTTTGTGAT
JMFN028E13+ CTTCGAGGAGGTGATCAAGAGCTGTCAAGGCATCAGACTCAACAAAAGTGATTTTGTGAT
JMFN013K11+ CTTCGAGGAGGTGATCAAGAGCTGTCAAGGCATCAGACTCAACAAAAGTGATTTTGTGAT
JMFN007B22+ CTTCGAGGAGGTGATCAAGAGCTGTCAAGGCATCAGACTCAACAAAAGTGATTTTGTGAT
JMFN039E20+ CTTCGAGGAGGTGATCAAGAGCTGTCAAGGCATCAGACTCAACAAAAGTGATTTTGTGAT
JMFS084F07+ CTTCGAGGAGGTGATCAAGAGCTGTCAAGGCATCAGACTCAACAAAAGTGATTTTGTGAT
JMFN038I06+ CTTCGAGGAGGTGATCAAGAGCTGTCAAGGCATCAGACTCAACAAAAGTGATTTTGTGAT
JMFN009C15+ CTTCGAGGAGGTGATCAAGAGCTGTCAAGGCATCAGACTCAACAAAAGTGATTTTGTGAT
JMFN038B24+ CTTCGAGGAGGTGATCAAGAGCTGTCAAGGCATCAGACTCAACAAAAGTGATTTTGTGAT
JMFN014M17+ CTTCGAGGAGGTGATCAAGAGCTGTCAAGGCATCAGACTCAACAAAAGTGATTTTGTGAT
JMFF043P06+ CTTCGAGGAGGTGATCAAGAGCTGTCAAGGCATCAGACTCAACAAAAGTGATTTTGTGAT
JMFN032D12+ CTTCGAGGAGGTGATCAAGAGCTGTCAAGGCATCAGACTCAACAAAAGTGATTTTGTGAT
JMFF004G10+ CTTCGAGGAGGTGATCAAGAGCTGTCAAGGCATCAGACTCAACAAAAGTGATTTTGTGAT
JMFF032M14+ CTTCGAGGAGGTGATCAAGAGCTGTCAAGGCATCAGACTCAACAAAAGTGATTTTGTGAT
JMFF022F20+ CTTCGAGGAGGTGATCAAGAGCTGTCAAGGCATCAGACTCAACAAAAGTGATTTTGTGAT
JMFF022D03+ CTTCGAGGAGGTGATCAAGAGCTGTCAAGGCATCAGACTCAACAAAAGTGATTTTGTGAT
                      ____________________________________________________________
consensus CTTCGAGGAGGTGATCAAGAGCTGTCAAGGCATCAGACTCAACAAAAGTGATTTTGTGAT
 
. : . : . : . : . : . :
rJMFF043P06- CAACTCCAGCTCTTTTAATCACTGGCAATCCATATTCGTATGCTTCTCGGTCACGGTCTA
rJMFF032M14- CAACTCCAGCTCTTTTAATCACTGGCAATCCATATTCGTATGCTTCTCGGTCACGGTCTA
rJMFF022D03- CAACTCCAGCTCTTTTAATCACTGGCAATCCATATTCGTATGCTTCTCGGTCACGGTCTA
JMFN002E03+ CAACTCCAGCTCTTTTAATCACTGGCAATCCATATTCGTATGCTTCTCGGTCACGGTCTA
rJMFF022F20- CAACTCCAGCTCTTTTAATCACTGGCAATCCATATTCGTATGCTTCTCGGTCACGGTCTA
rJMFF004G10- CAACTCCAGCCCTTTTAATCACTGGCAATCCATATTCGTATGCTTCTCGGTCACGGTCTA
JMFN033O18+ CAACTCCAGCTCTTTTAATCACTGGCAATCCATATTCGTATGCTTCTCGGTCACGGTCTA
JMFS135C08+ CAACTCCAGCTCTTTTAATCACTGGCAATCCATATTCGTATGCTTCTCGGTCACGGTCTA
JMFN028E13+ CAACTCCAGCTCTTTTAATCACTGGCAATCCATATTCGTATGCTTCTCGGTCACGGTCTA
JMFN013K11+ CAACTCCAGCTCTTTTAATCACTGGCAATCCATATTCGTATGCTTCTCGGTCACGGTCTA
JMFN007B22+ CAACTCCAGCTCTTTTAATCACTGGCAATCCATATTCGTATGCTTCTCGGTCACGGTCTA
JMFN039E20+ CAACTCCAGCTCTTTTAATCACTGGCAATCCATATTCGTATGCTTCTCGGTCACGGTCTA
JMFS084F07+ CAACTCCAGCTCTTTTAATCACTGGCAATCCATATTCGTATGCTTCTCGGTCACGGTCTA
JMFN038I06+ CAACTCCAGCTCTTTTAATCACTGGCAATCCATATTCGTATGCTTCTCGGTCACGGTCTA
JMFN009C15+ CAACTCCAGCTCTTTTAATCACTGGCAATCCATATTCGTATGCTTCTCGGTCACGGTCTA
JMFN038B24+ CAACTCCAGCTCTTTTAATCACTGGCAATCCATATTCGTATGCTTCTCGGTCACGGTCTA
JMFN014M17+ CAACTCCAGCTCTTTTAATCACTGGCAATCCATATTCGTATGCTTCTCGGTCACGGTCTA
JMFF043P06+ CAACTCCAGCTCTTTTAATCACTGGCAATCCATATTCGTATGCTTCTCGGTCACGGTCTA
JMFN032D12+ CAACTCCAGCTCTTTTAATCACTGGCAATCCATATTCGTATGCTTCTCGGTCACGGTCTA
JMFF004G10+ CAACTCCAGCCCTTTTAATCACTGGCAATCCATATTCGTATGCTTCTCGGTCACGGTCTA
JMFF032M14+ CAACTCCAGCTCTTTTAATCACTGGCAATCCATATTCGTATGCTTCTCGGTCACGGTCTA
JMFF022F20+ CAACTCCAGCTCTTTTAATCACTGGCAATCCATATTCGTATGCTTCTCGGTCACGGTCTA
JMFF022D03+ CAACTCCAGCTCTTTTAATCACTGGCAATCCATATTCGTATGCTTCTCGGTCACGGTCTA
                      ____________________________________________________________
consensus CAACTCCAGCTCTTTTAATCACTGGCAATCCATATTCGTATGCTTCTCGGTCACGGTCTA
 
. : . : . : . : . : . :
rJMFF043P06- TGGCTATAATCTTGCCATCATCAGGAATGTTG
rJMFF032M14- TGGCTATAATCTTGCCATCATCAGGAATGTTGAGAGCTGTGAGGAGCAATGAGTATCCAG
rJMFF022D03- TGGCTATAATCTTGCCATCATCAGGAATGTTGAGAGCTGTGAGGAGCAATGAGTATCCAG
JMFN002E03+ TGGCTATAATCTTGCCATCATCAGGAATGTTGAGAGCTGTGAGGAGCAATGAGTATCCAG
rJMFF022F20- TGGCTATAATCTTGCCATCATCAGGAATGTTGAGAGCTGTGAGGAGCAATGAGTATCCAG
rJMFF004G10- TGGCTATAATCTTGCCATCATCAGGAATGTTGAGAGCTGTGAGGAGCAATGAGTATCCAG
JMFN033O18+ TGGCTATAATCTTGCCATCATCAGGAATGTTGAGAGCTGTGAGGAGCAATGAGTATCCAG
JMFS135C08+ TGGCTATAATCTTGCCATCATCAGGAATGTTGAGAGCTGTGAGGAGCAATGAGTATCCAG
JMFN028E13+ TGGCTATAATCTTGCCATCATCAGGAATGTTGAGAGCTGTGAGGAGCAATGAGTATCCAG
JMFN013K11+ TGGCTATAATCTTGCCATCATCAGGAATGTTGAGAGCTGTGAGGAGCAATGAGTATCCAG
JMFN007B22+ TGGCTATAATCTTGCCATCATCAGGAATGTTGAGAGCTGTGAGGAGCAATGAGTATCCAG
JMFN039E20+ TGGCTATAATCTTGCCATCATCAGGAATGTTGAGAGCTGTGAGGAGCAATGAGTATCCAG
JMFS084F07+ TGGCTATAATCTTGCCATCATCAGGAATGTTGAGAGCTGTGAGGAGCAATGAGTATCCAG
JMFN038I06+ TGGCTATAATCTTGCCATCATCAGGAATGTTGAGAGCTGTGAGGAGCAATGAGTATCCAG
JMFN009C15+ TGGCTATAATCTTGCCATCATCAGGAATGTTGAGAGCTGTGAGGAGCAATGAGTATCCAG
JMFN038B24+ TGGCTATAATCTTGCCATCATCAGGAATGTTGAGAGCTGTGAGGAGCAATGAGTATCCAG
JMFN014M17+ TGGCTATAATCTTGCCATCATCAGGAATGTTGAGAGCTGTGAGGAGCAATGAGTATCCAG
JMFF043P06+ TGGCTATAATCTTGCCATCATCAGGAATGTTGAGAGCTGTGAGGAGCAATGAGTATCCAG
JMFN032D12+ TGGCTATAATCTTGCCATCATCAGGAATGTTGAGAGCTGTGAGGAGCAATGAGTATCCAG
JMFF004G10+ TGGCTATAATCTTGCCATCATCAGGAATGTTGAGAGCTGTGAGGAGCAATGAGTATCCAG
JMFF032M14+ TGGCTATAATCTTGCCATCATCAGGAATGTTGAGAGCTGTGAGGAGCAATGAGTATCCAG
JMFF022F20+ TGGCTATAATCTTGCCATCATCAGGAATGTTGAGAGCTGTGAGGAGCAATGAGTATCCAG
JMFF022D03+ TGGCTATAATCTTGCCATCATCAGGAATGTTGAGAGCTGTGAGGAGCAATGAGTATCCAG
                      ____________________________________________________________
consensus TGGCTATAATCTTGCCATCATCAGGAATGTTGAGAGCTGTGAGGAGCAATGAGTATCCAG
 
. : . : . : . : . : . :
rJMFF032M14- TTAAGACTCCAATTTCAATGGTCCTTTTTGCATTAAGGAGATTCAACAGCATAGATATCA
rJMFF022D03- TTAAGACTCCAATTTCAATGGTCCTTTTTGCATTAAGGAGATTCAACAGCATAGATATCA
JMFN002E03+ TTAAGACTCCAATTTCAATGGTCCTTTTTGCATTAAGGAGATTCAACAGCATAGATATCA
rJMFF022F20- TTAAGACTCCAATTTCAATGGTCCTTTTTGCATTAAGGAGATTCAACAGCATAGATATCA
rJMFF004G10- TTAAGACTCCAATTTCAATGGTCCTTTTTGCATTAANGAGATTCAACAGCATAGATATCA
JMFN033O18+ TTAAGACTCCAATTTCAATGGTCCTTTTTGCATTAAGGAGATTCAACAGCATAGATATCA
JMFS135C08+ TTAAGACTCCAATTTCAATGGTCCTTTTTGCATTAAGGAGATTCAACAGCATAGATATCA
JMFN028E13+ TTAAGACTCCAATTTCAATGGTCCTTTTTGCATTAAGGAGATTCAACAGCATAGATATCA
JMFN013K11+ TTAAGACTCCAATTTCAATGGTCCTTTTTGCATTAAGGAGATTCAACAGCATAGATATCA
JMFN007B22+ TTAAGACTCCAATTTCAATGGTCCTTTTTGCATTAAGGAGATTCAACAGCATAGATATCA
JMFN039E20+ TTAAGACTCCAATTTCAATGGTCCTTTTTGCATTAAGGAGATTCAACAGCATAGATATCA
JMFS084F07+ TTAAGACTCCAATTTCAATGGTCCTTTTTGCATTAAGGAGATTCAACAGCATAGATATCA
JMFN038I06+ TTAAGACTCCAATTTCAATGGTCCTTTTTGCATTAAGGAGATTCAACAGCATAGATATCA
JMFN009C15+ TTAAGACTCCAATTTCAATGGTCCTTTTTGCATTAAGGAGATTCAACAGCATAGATATCA
JMFN038B24+ TTAAGACTCCAATTTCAATGGTCCTTTTTGCATTAAGGAGATTCAACAGCATAGATATCA
JMFN014M17+ TTAAGACTCCAATTTCAATGGTCCTTTTTGCATTAAGGAGATTCAACAGCATAGATATCA
JMFF043P06+ TTAAGACTCCAATTTCAATGGTCCTTTTTGCATTAAGGAGATTCAACAGCATAGATATCA
JMFN032D12+ TTAAGACTCCAATTTCAATGGTCCTTTTTGCATTAAGGAGATTCAACAGCATAGATATCA
JMFF004G10+ TTAAGACTCCAATTTCAATGGTCCTTTTTGCATTAAGGAGATTCAACAGCATAGATATCA
JMFF032M14+ TTAAGACTCCAATTTCAATGGTCCTTTTTGCATTAAGGAGATTCAACAGCATAGATATCA
JMFF022F20+ TTAAGACTCCAATTTCAATGGTCCTTTTTGCATTAAGGAGATTCAACAGCATAGATATCA
JMFN042H08+ CAGCATAGATATCG
JMFF022D03+ TTAAGACTCCAATTTCAATGGTCCTTTTTGCATTAAGGAGATTCAACAGCATAGATATCA
                      ____________________________________________________________
consensus TTAAGACTCCAATTTCAATGGTCCTTTTTGCATTAAGGAGATTCAACAGCATAGATATCA
 
. : . : . : . : . : . :
rJMFF032M14- ATTGGGCTGCATCTGGTGCAGTAGCCATCAGACCACTTGGATGATCAGCATTCATGGCTC
rJMFF022D03- ATTGGGCTGCATCTGGT
JMFN002E03+ ATTGGGCTGCATCTGGTGC
rJMFF022F20- ATTGGGCTGCATCTGGTGCAGTAGCCATCAGACCACTTGGATGATCAGCATTCATGGCTC
rJMFF004G10- ATTGGGCTGCATCTGGTGCAGTAGCCATCAGACCACTTGGATTATCAGCATTCATGGCTC
JMFN033O18+ ATTGGGCTGCATCTGGTGCAGTAGCCATCAGACCACTTGGATGATCAGCATTCATGGCTC
JMFS135C08+ ATTGGGCTGCATCTGGTGCAGTAGCCATCAGACCACTTGGATGATCAGCATTCATGGCTC
JMFN028E13+ ATTGGGCTGCATCTGGTGCAGTAGCCATCAGACCACTTGGATGATCAGCATTCATGGCTC
JMFN013K11+ ATTGGGCTGCATCTGGTGCAGTAGCCATCAGACCACTTGGATGATCAGCATTCATGGCTC
JMFN007B22+ ATTGGGCTGCATCTGGTGCAGTAGCCATCAGACCACTTGGATGATCAGCATTCATGGCTC
JMFN039E20+ ATTGGGCTGCATCTGGTGCAGTAGCCATCAGACCACTTGGATGATCAGCATTCATGGCTC
JMFS084F07+ ATTGGGCTGCATCTGGTGCAGTAGCCATCAGACCACTTGGATGATCAGCATTCATGGCTC
JMFN038I06+ ATTGGGCTGCATCTGGTGCAGTAGCCATCAGACCACTTGGATGATCAGCATTCATGGCTC
JMFN009C15+ ATTGGGCTGCATCTGGTGCAGTAGCCATCAGACCACTTGGATGATCAGCATTCATGGCTC
JMFN038B24+ ATTGGGCTGCATCTGGTGCAGTAGCCATCAGACCACTTGGATGATCAGCATTCATGGCTC
JMFN014M17+ ATTGGGCTGCATCTGGTGCAGTAGCCATCAGACCACTTGGATGATCAGCATTCATGGCTC
JMFF043P06+ ATTGGGCTGCATCTGGTGCAGTAGCCATCAGACCACTTGGATGATCAGCATTCATGGCTC
JMFN032D12+ ATTGGGCTGCATCTGGTGCAGTAGCCATCAGACCACTTGGATGATCAGCATTCATGGCTC
JMFF004G10+ ATTGGGCTGCATCTGGTGCAGTAGCCATCAGACCACTTGGATTATCAGCATTCATGGCTC
JMFF032M14+ ATTGGGCTGCATCTGGTGCAGTAGCCATCAGACCACTTGGATGATCAGCATTCATGGCTC
JMFF022F20+ ATTGGGCTGCATCTGGTGCAGTAGCCATCAGACCACTTGGATGATCAGCATTCATGGCTC
JMFN042H08+ ATTGGGTTGCATCTGGTGCAGTAGCCATCAGACCACTTGGATGATGAGCATTCAGGGCTC
JMFF022D03+ ATTGGGCTGCATCTGGTGCAGTAGCCATCAGACCACTTGGATGATCAGCATTCATGGCTC
                      ____________________________________________________________
consensus ATTGGGCTGCATCTGGTGCAGTAGCCATCAGACCACTTGGATGATCAGCATTCATGGCTC
 
. : . : . : . : . : . :
rJMFF032M14- TTAACTCTTTG
rJMFF022F20- TTAACTCTTTGAGGG
rJMFF004G10- TTAACTCTTTGAGGG
JMFN033O18+ TTAACTCTTTGAGGGGTTCAGGTTCACGTGGA
JMFS135C08+ TTAACTCTTTGAGGGGTTCAGGTTCACGTGGATACACGCTAGTCTCCAGAACATACTGAT
JMFN028E13+ TTAACTCTTTGAGGGGTTCAGGTTCACGTGGATACACGCTAGTCTCCAGAACATACTGAT
JMFN013K11+ TTAACTCTTTGAGGGGTTCAGGTTCACGTGGATACACGCTAGTCTCCAGAACATACTGAT
JMFN007B22+ TTAACTCTTTGAGGGGTTCAGGTTCACGTGGATACACGCTAGTCTCCAGAACATACTGAT
JMFN039E20+ TTAACTCTTTGAGGGGTTCAGGTTCACGTGGATACACGCTAGTCTCCAGAACATACTGAT
JMFS084F07+ TTAACTCTTTGAGGGGTTCAGGTTCACGTGGATACACGCTAGTCTCCAGAACATACTGAT
JMFN038I06+ TTAACTCTTTGAGGGGTTCAGGTTCACGTGGATACACGCTAGTCTCCAGAACATACTGAT
JMFN009C15+ TTAACTCTTTGAGGGGTTCAGGTTCACGTGGATACACGCTAGTCTCCAGAACATACTGAT
JMFN038B24+ TTAACTCTTTGAGGGGTTCAGGTTCACGTGGATACACGCTAGTCTCCAGAACATACTGAT
JMFN014M17+ TTAACTCTTTGAGGGGTTCAGGTTCACGTGGATACACGCTAGTCTCCAGAACATACTGAT
JMFF043P06+ TTAACTCTTTGAGGGGTTCAGGTTCACGTGGATACACGCTAGTCTCCAGAACATACTGAT
JMFN032D12+ TTAACTCTTTGAGGGGTTCAGGTTCACGTGGATACACGCTAGTCTCCAGAACATACTGAT
JMFF004G10+ TTAACTCTTTGAGGGGTTCAGGTTCACGTGGATACACGCTAGTCTCCAGAACATACTGAT
JMFF032M14+ TTAACTCTTTGAGGGGTTCAGGTTCACGTGGATACACGCTAGTCTCCAGAACATACTGAT
JMFF022F20+ TTAACTCTTTGAGGGGTTCAGGTTCACGTGGATACACGCTAGTCTCCAGAACATACTGAT
JMFN042H08+ TGAGCTCGGGGAGGGGTTCAGGTTCACGGGGATACGCGGTAGTGTCCAGGACATGTTGAT
JMFF022D03+ TTAACTCTTTGAGGGGTTCAGGTTCACGTGGATACACGCTAGTCTCCAGAACATACTGAT
                      ____________________________________________________________
consensus TTAACTCTTTGAGGGGTTCAGGTTCACGTGGATACACGCTAGTCTCCAGAACATACTGAT
 
. : . : . : . : . : . :
JMFS135C08+ ATAACTTTTCACTATGCAACAATCCCTTCTCCA
JMFN028E13+ ATAACTTTTCACTATGCAACAATCCCTTCTCCACCATCGACATTG-TATCCGAT-TTTCC
JMFN013K11+ ATAACTTTTCACTATGCAACAATCCCTTCTCCACCATCGACATTGTTATCCGATATTTCC
JMFN007B22+ ATAACTTTTCACTATGCAACAATCCCTTCTCCACCATCGACATTGTTATCCGATATTTCC
JMFN039E20+ ATAACTTTTCACTATGCAACAATCCCTTCTCCACCATCGACATTGTTATCCGATATTTCC
JMFS084F07+ ATAACTTTTCACTATGCAACAATCCCTTCTCCACCATCGACATTGTTATCCGATATTTCC
JMFN038I06+ ATAACTTTTCACTATGCAACAATCCCTTCTCCACCATCGACATTGTTATCCGATATTTCC
JMFN009C15+ ATAACTTTTCACTATGCAACAATCCCTTCTCCACCATCGACATTGTTATCCGATATTTCC
JMFN038B24+ ATAACTTTTCACTATGCAACAATCCCTTCTCCACCATCGACATTGTTATCCGATATTTCC
JMFN014M17+ ATAACTTTTCACTATGCAACAATCCCTTCTCCACCATCGACATTGTTATCCGATATTTCC
JMFF043P06+ ATAACTTTTCACTATGCAACAATCCCTTCTCCACCATCGACATTGTTATCCGATATTTCC
JMFN032D12+ ATAACTTTTCACTATGCAACAATCCCTTCTCCACCATCGACATTGTTATCCGATATTTCC
JMFF004G10+ ATAACTTTTCACTATGCAACAATCCCTTCTCCACCATCGACATTGTTATCCGATATTTCC
JMFF032M14+ ATAACTTTTCACTATGCAACAATCCCTTCTCCACCATCGACATTGTTATCCGATATTTCC
JMFF022F20+ ATAACTTTTCACTATGCAACAATCCCTTCTCCACCATCGACATTGTTATCCGATATTTCC
JMFN042H08+ ATGTCGTTTCACTAGGCGACAATCCCTTCTCCACCATCGACATTGTTATCCGATATTTCC
JMFF022D03+ ATAACTTTTCACTATGCAACAATCCCTTCTCCACCATCGACATTGTTATCCGATATTTCC
                      ____________________________________________________________
consensus ATAACTTTTCACTATGCAACAATCCCTTCTCCACCATCGACATTGTTATCCGATATTTCC
 
. : . : . : . : . : . :
JMFN028E13+ CAACAAGATCC
JMFN013K11+ CAACAAGATCCTAACTTTTTGTTTTGGGTTCAAAAGAGAAGGGC
JMFN007B22+ CAACAAGATCCTAACTTTTTGTTTTGGGTTCAAAAGAGAA
JMFN039E20+ CAACAAGATCCTAACTTTTTGTTTTGGGTTCAAAAGAGAAGGGCTC
JMFS084F07+ CAACAAGATCCTAACTTTTTGTTTTG
JMFN038I06+ CAACAAGATCCTAACTTTTTGTTTTGGGTTCAAAAGAGAAGGGC
JMFN009C15+ CAACAAGATCCTAACTTTTTGTTTTGGGTTCAAAAGAGAAGGGC
JMFN038B24+ CAACAAGATCCTAACTTTTTGTTTTGGGTTCAAAAGAGAA
JMFN014M17+ CAACAAGATCCTAACTTTTTGTTTTGGGTTCAAAAGA
JMFF043P06+ CAACAAGATCCTAACTTTTTGTTTTGGGTTCAAAAGAGAAGGGCTCTCT
JMFN032D12+ CAACAAGATCCTAACTTTTTGTTTTGGGTTCAAAAGA
JMFF004G10+ CAACAAGATCCTAACTTTTTGTTTTGGGTTCAAAAGAGAAGGGCTCTCTGTCGGGC
JMFF032M14+ CAACAAGATCCTAACTTTTTGTTTTGGGTTCAAAAGAGAAGGGCTCTCTGTCGGGC
JMFF022F20+ CAACAAGATCCTAACTTTTTGTTTTGGGTTCAAAAGAGAAGGGCTCTCTGTCGGGC
JMFN042H08+ CAACAAGATCCTAACTTTTTGTTTTGGGTTCAAAAGAGAAGGG
JMFF022D03+ CAACAAGATCCTAACTTTTTGTTTTGGGTTCAAAAGAGAAGGGCTCTCTGTCGGGCTTTC
                      ____________________________________________________________
consensus CAACAAGATCCTAACTTTTTGTTTTGGGTTCAAAAGAGAAGGGCTCTCTGTCGGGCTTTC