Previous Contig 001098:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF015I02Sequence541001098 (7)pir|B84905|B849052e-25hypothetical protein At2g46620 [imported] - Arabidopsis thaliana>gb:AC006418_153425010716 (5)
JMFF021O09Sequence501001098 (7)pir|B84905|B849051e-22hypothetical protein At2g46620 [imported] - Arabidopsis thaliana>gb:AC006418_153383021153
JMFF042L01Sequence642001098 (7)pir|B84905|B849052e-33hypothetical protein At2g46620 [imported] - Arabidopsis thaliana>gb:AC006418_153255010716 (5)
JMFF047D18Sequence614001098 (7)pir|B84905|B849051e-36hypothetical protein At2g46620 [imported] - Arabidopsis thaliana>gb:AC006418_153524010716 (5)pir|B84905|B849051e-15hypothetical protein At2g46620 [imported] - Arabidopsis thaliana>gb:AC006418_153
JMFS141A10Sequence621001098 (7)pir|B84905|B849051e-32hypothetical protein At2g46620 [imported] - Arabidopsis thaliana>gb:AC006418_153
JMFS142G10Sequence619001098 (7)pir|B84905|B849051e-32hypothetical protein At2g46620 [imported] - Arabidopsis thaliana>gb:AC006418_153
JMSF040L11Sequence675001098 (7)pir|B84905|B849055e-61hypothetical protein At2g46620 [imported] - Arabidopsis thaliana>gb:AC006418_153618010716 (5)pir|B84905|B849051e-27hypothetical protein At2g46620 [imported] - Arabidopsis thaliana>gb:AC006418_153

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF040L11+ CCGGAAGGGC
                      ____________________________________________________________
consensus CCGGAAGGGC
 
. : . : . : . : . : . :
JMSF040L11+ CGTAGAGGAGAAAACTTCGGCGCCAAACGCGGCCTAGTTTGTGATAATACTGCTGCGATT
                      ____________________________________________________________
consensus CGTAGAGGAGAAAACTTCGGCGCCAAACGCGGCCTAGTTTGTGATAATACTGCTGCGATT
 
. : . : . : . : . : . :
JMSF040L11+ TAAGAAACGTCTCGAGGTCGGACTTGACCCGGTTCTTCAGATCCGACTCCATCACCACCG
                      ____________________________________________________________
consensus TAAGAAACGTCTCGAGGTCGGACTTGACCCGGTTCTTCAGATCCGACTCCATCACCACCG
 
. : . : . : . : . : . :
JMSF040L11+ TCTCGAAAGTGGAAGGATGCGTGAACGGAACGGATCTCCACCGTCCGGCGGCGGAATCAT
JMFF047D18+ AACGGAACGGATCTCCACCGTCCGGCGGCGGAATCAT
                      ____________________________________________________________
consensus TCTCGAAAGTGGAAGGATGCGTGAACGGAACGGATCTCCACCGTCCGGCGGCGGAATCAT
 
. : . : . : . : . : . :
JMSF040L11+ CCGACGCCAGAGAGCGATTCATGAACAGCTTCAACTCCCGTCGGCGCTGCTCGATGTTAT
JMFF047D18+ CCGACGCCAGAGAGCGATTCATGAACAGCTTCAACTCCCGTCGGCGCTGCTCGATGTTAT
JMFS142G10+ CAGCTTCAACTCCCGTCGGCGCTGCTCGATGTTAT
JMFS141A10+ AACAGCTTCAACTCCCGTCGGCGCTGCTCGATGTTAT
JMFF042L01+ GACGCCAGAGAGCGATTCATGAACAGCTTCAACTCCCGTCGGCGCTGCTCGATGTATT
                      ____________________________________________________________
consensus CCGACGCCAGAGAGCGATTCATGAACAGCTTCAACTCCCGTCGGCGCTGCTCGATGTTAT
 
. : . : . : . : . : . :
JMSF040L11+ CGGACACCGTATGAATGTGCTGAAGATACGGGCGGAGAATCCGGCGCTTATCCTTCTTCT
JMFF047D18+ CGGACACCGTATGAATGTGCTGAAGATACGGGCGGAGAATCCGGCGCTTATCCTTCTTCT
JMFS142G10+ CGGACACCGTATGAATGTGCTGAAGATACGGGCGGAGAATCCGGCGCTTATCCTTCTTCT
JMFS141A10+ CGGACACCGTATGAATGTGCTGAAGATACGGGCGGAGAATCCGGCGCTTATCCTTCTTCT
JMFF042L01+ CGGACACCGTATGAATGTGCTGAAGATACGGGCGGAGAATCCGGCGCTTATCCTTCTTCT
JMFF015I02+ TTCTTCT
                      ____________________________________________________________
consensus CGGACACCGTATGAATGTGCTGAAGATACGGGCGGAGAATCCGGCGCTTATCCTTCTTCT
 
. : . : . : . : . : . :
JMSF040L11+ TTATCCTCAACACAAGGCTCCGCCCCCCACCGTCGTGGACCTTGTTCATCCACGAGACTC
JMFF047D18+ TTATCCTCAACACAAGGCTCCGCCCCCCACCGTCGTGGACCTTGTTCATCCACGAGACTC
JMFS142G10+ TTATCCTCAACACAAGGCTCCGCCCCCCACCGTCGTGGACCTTGTTCATCCACGAGACTC
JMFS141A10+ TTATCCTCAACACAAGGCTCCGCCCCCCACCGTCGTGGACCTTGTTCATCCACGAGACTC
JMFF042L01+ TTATCCTCAACACAAGGCTCCGCCCCCCACCGTCGTGGACCTTGTTCATCCACGAGACTC
JMFF015I02+ TTATCCTCAACACAAGGCTCCGCCCCCCACCGTCGTGGACCTTGTTCATCCACGAGACTC
JMFF021O09+ CCTTGTTCATCCACGAGACTC
                      ____________________________________________________________
consensus TTATCCTCAACACAAGGCTCCGCCCCCCACCGTCGTGGACCTTGTTCATCCACGAGACTC
 
. : . : . : . : . : . :
JMSF040L11+ TCGCCCCGAGAAACTGATCCTGAACCACCTGGTTATCGTCGAGGCAGAGCACGATATCGT
JMFF047D18+ TCGCCCCGAGAAACTGATCCTGAACCACCTGGTTATCGTCGAGGCAGAGCACGATATCGT
JMFS142G10+ TCGCCCCGAGAAACTGATCCTGAACCACCTGGTTATCGTCGAGGCAGAGCACGATATCGT
JMFS141A10+ TCGCCCCGAGAAACTGATCCTGAACCACCTGGTTATCGTCGAGGCAGAGCACGATATCGT
JMFF042L01+ TCGCCCCGAGAAACTGATCCTGAACCACCTGGTTATCGTCGAGGCAGAGCACGATATCGT
JMFF015I02+ TCGCCCCGAGAAACTGATCCTGAACCACNTGGTTATCGTCGAGGCAGAGCACGATATCGT
JMFF021O09+ TCGCCCCGAGAAACTGATCCTGAACCACCTGGTTATCGTCGAGGCAGAGCACGATATCGT
                      ____________________________________________________________
consensus TCGCCCCGAGAAACTGATCCTGAACCACCTGGTTATCGTCGAGGCAGAGCACGATATCGT
 
. : . : . : . : . : . :
JMSF040L11+ TGGATTTAACGGCGGCGGAGTTCACCAAATTGGTGAAATCGGAATCCTCGAGGGAGGAGA
JMFF047D18+ TGGATTTAACGGCGGCGGAGTTCACCAAATTGGTGAAATCGGAATCCTCGAGGGAGGAGA
JMFS142G10+ TGGATTTAACGGCGGCGGAGTTCACCAAATTGGTGAAATCGGAATCCTCGAGGGAGGAGA
JMFS141A10+ TGGATTTAACGGCGGCGGAGTTCACCAAATTGGTGAAATCGGAATCCTCGAGGGAGGAGA
JMFF042L01+ TGGATTTAACGGCGGCGGAGTTCACCAAATTGGTGAAATCGGAATCCTCGAGGGAGGAGA
JMFF015I02+ TGGATTTAACGGCGGCGGAGTTCACCAAATTGGTGAAATCGGAATCCTCGAGGGAGGAGA
JMFF021O09+ TGGATTTAACGGCGGCGGAGTTCACCAAATTGGTGAAATCGGAATCCTCGAGGGAGGAGA
                      ____________________________________________________________
consensus TGGATTTAACGGCGGCGGAGTTCACCAAATTGGTGAAATCGGAATCCTCGAGGGAGGAGA
 
. : . : . : . : . : . :
JMSF040L11+ GAGAATTGACGTAGACGAAGACTTTCCTGTACAGCTGATTCTCCTGAGCGTTTTGGTTAA
JMFF047D18+ GAGAATTGACGTAGACGAAGACTTTCCTGTACAGCTGATTCTCCTGAGCGTTTTGGTTAA
JMFS142G10+ GAGAATTGACGTAGACGAAGACTTTCCTGTACAGCTGATTCTCCTGAGCGTTTTGGTTAA
JMFS141A10+ GAGAATTGACGTAGACGAAGACTTTCCTGTACAGCTGATTCTCCTGAGCGTTTTGGTTAA
JMFF042L01+ GAGAATTGACGTAGACGAAGACTTTCCTGTACAGCTGATTCTCCTGAGCGTTTTGGTTAA
JMFF015I02+ GAGAATTGACGTAGACGAAGACTTTCCTGTACAGCTGATTCTCCTGAGCGTTTTGGTTAA
JMFF021O09+ GAGAATTGACGTAGACGAAGACTTTCCTGTACAGCTGATTCTCCTGAGCGTTTTGGTTAA
                      ____________________________________________________________
consensus GAGAATTGACGTAGACGAAGACTTTCCTGTACAGCTGATTCTCCTGAGCGTTTTGGTTAA
 
. : . : . : . : . : . :
JMSF040L11+ GCTGCGGGACTTTGAAGAACTGATGAACATGAAGCTTGTCGTCAATCCAATCCGACCACT
JMFF047D18+ GCTGCGGGACTTTGAAGAACTGATGAACATGAAGCTTGTCGTCAATCCAACCCGACCACT
JMFS142G10+ GCTGCGGGACTTTGAAGAACTGATGAACATGAAGCTTGTCGTCAATCCAATCCGACCACT
JMFS141A10+ GCTGCGGGACTTTGAAGAACTGATGAACATGAAGCTTGTCGTCAATCCAATCCGACCACT
JMFF042L01+ GCTGCGGGACTTTGAAGAACTGATGAACATGAAGCTTGTCGTCAATCCAATCCGACCACT
JMFF015I02+ GCTGCGGGACTTTGAAGAACTGATGAACATGAAGCTTGTCGTCAATCCAATCCGACCACT
JMFF021O09+ GCTGCGGGACTTTGAAGAACTGATGAACATGAAGCTTGTCGTCAATCCAATCCGACCACT
                      ____________________________________________________________
consensus GCTGCGGGACTTTGAAGAACTGATGAACATGAAGCTTGTCGTCAATCCAATCCGACCACT
 
. : . : . : . : . : . :
JMSF040L11+ TCCTCAGAGCGAAAACCAGAGCGCTTCGGTACAAGAACAGCCTCACCGCCGCGAATACCG
JMFF047D18+ TCCTCAGAGCGAAAACCAGAGCGCTTCGGTACAAGAACAGCCTCACCGCCGCGAATACCG
JMFS142G10+ TCCTCAGAGCGAAAACCAGAGCGCTTCGGTACAAGAACAGCCTCACCGCCGCGAATACCG
JMFS141A10+ TCCTCAGAGCGAAAACCAGAGCGCTTCGGTACAAGAACAGCCTCACCGCCGCGAATACCG
JMFF042L01+ TCCTCAGAGCGAAAACCAGAGCGCTTCGGTACAAGAACAGCCTCACCGCCGCGAATACCG
JMFF015I02+ TCCTCAGAGCGAAAACCAGAGCGCTTCGGTACAAGAACAGCCTCACCGCCGCGAATACCG
JMFF021O09+ TCCTCAGAGCGAAAACCAGAGCGCTTCGGTACAAGAACAGCCTCACCGCCGCGAATACCG
                      ____________________________________________________________
consensus TCCTCAGAGCGAAAACCAGAGCGCTTCGGTACAAGAACAGCCTCACCGCCGCGAATACCG
 
. : . : . : . : . : . :
JMSF040L11+ AGAC
JMFF047D18+ AGACGCAGAACGCGAACACGACAACCATGTTTACAATAAACATGGCGACCAAGCTCTGAT
JMFS142G10+ AGACGCAGAACGCGAACACGACAACCATGTTTACAATAAACATGGCGACCAAGCTCTGAT
JMFS141A10+ AGACGCAGAACGCGAACACGACAACCATGTTTACAATAAACATGGCGACCAAGCTCTGAT
JMFF042L01+ AGACGCAGAACGCGAACACGACAACCATGTTTACAATAAACATGGCGACCAAGCTCTGAT
JMFF015I02+ AGACGCAGAACGCGAACACGACAACCATGTTTACAATAAACATGGCGACCAAGCTCTGAT
JMFF021O09+ AGACGCAGAACGCGAACACGACAACCATGTTTACAATAAACATGGCGACCAAGCTCTGAT
                      ____________________________________________________________
consensus AGACGCAGAACGCGAACACGACAACCATGTTTACAATAAACATGGCGACCAAGCTCTGAT
 
. : . : . : . : . : . :
JMFF047D18+ TAAGGCTGGATCCGAGGGTTGATTTACCAAAGAT
JMFS142G10+ TAAGGCTGGATCCGAGGGTTGATTTACCAAAGATAATGAGGATTATTAGTACTGCTCTCC
JMFS141A10+ TAAGGCTGGATCCGAGGGTTGATTTACCAAAGATAATGAGGATTATTAGTACTGCTCTCC
JMFF042L01+ TAAGGCTGGATCCGAGGGTTGATTTACCAAAGATAATGAGGATTATTAGTACTGCTCTCC
JMFF015I02+ TAAGGCTGGATCCGAGGGTTGATTTACCAAAGATAATGAGGATTATTAGTACTGCTCTCC
JMFF021O09+ TAAGGCTGGATCCGAGGGTTGATTTACCAAAGATAATGAGGATTATTAGTACTGCTCTCC
                      ____________________________________________________________
consensus TAAGGCTGGATCCGAGGGTTGATTTACCAAAGATAATGAGGATTATTAGTACTGCTCTCC
 
. : . : . : . : . : . :
JMFS142G10+ AAGGAACACCATTTTTAAGAGTCGAAGCGACTAGTGACGGGGAG
JMFS141A10+ AAGGAACACCATTTTTAAGAGTCGAAGCGACTAGTGACGGGGAG
JMFF042L01+ AAGGAACACCATTTTTAAGAGTCGAAGCGACTAGTGACGGGGAG
JMFF015I02+ AAGGAACACCATTTTTAAGAGTCGAAGCGACTAGTGACGGGGAGAAAAAGAT
JMFF021O09+ AAGGAACACCATTTTTAAGAGTCGAAGCGACTAGTGACGGGGAGAAAAAGATAATCATTT
                      ____________________________________________________________
consensus AAGGAACACCATTTTTAAGAGTCGAAGCGACTAGTGACGGGGAGAAAAAGATAATCATTT