Previous Contig 001097:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF018K08Sequence509001097 (6)gb:AY048199_15616613e-07Arabidopsis thaliana At1g72160/T9N14_8 mRNA, complete cds.>gb:AY133553_1581376 A735009323 (8)gb:CAR404639_16452602e-59Cicer arietinum partial mRNA for hypothetical protein, clone Can141.
JMFF021O08Sequence500001097 (6)gb:AY048199_15616613e-07Arabidopsis thaliana At1g72160/T9N14_8 mRNA, complete cds.>gb:AY133553_1581376 A540009323 (8)gb:CAR404639_16452602e-32Cicer arietinum partial mRNA for hypothetical protein, clone Can141.
JMFF023N14Sequence554001097 (6)gb:AY048199_15616613e-07Arabidopsis thaliana At1g72160/T9N14_8 mRNA, complete cds.>gb:AY133553_1581376 A703009323 (8)gb:CAR404639_16452604e-54Cicer arietinum partial mRNA for hypothetical protein, clone Can141.
JMFF027O14Sequence551001097 (6)gb:AY048199_15616613e-07Arabidopsis thaliana At1g72160/T9N14_8 mRNA, complete cds.>gb:AY133553_1581376 A680009323 (8)gb:CAR404639_16452602e-50Cicer arietinum partial mRNA for hypothetical protein, clone Can141.
JMFF034F01Sequence515001097 (6)gb:AY048199_15616613e-07Arabidopsis thaliana At1g72160/T9N14_8 mRNA, complete cds.>gb:AY133553_1581376 A683009323 (8)gb:CAR404639_16452608e-51Cicer arietinum partial mRNA for hypothetical protein, clone Can141.
JMFF036K13Sequence406001097 (6)gb:AY048199_15616612e-06Arabidopsis thaliana At1g72160/T9N14_8 mRNA, complete cds.>gb:AY133553_1581376 A402009323 (8)gb:CAR404639_16452607e-07Cicer arietinum partial mRNA for hypothetical protein, clone Can141.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF034F01+ TTNGAGTTTCTCGACAACCACCGAAGGCTCGGCGGACGGC
JMFF018K08+ TTTCTCGACAACCACCGAAGGCTCGGCGGACGGC
                      ____________________________________________________________
consensus TTNGAGTTTCTCGACAACCACCGAAGGCTCGGCGGACGGC
 
. : . : . : . : . : . :
JMFF034F01+ GCCTCCGTGGGTGGCGGTGGAATCTCTTTCTCTGTTTCTTTCACCTCCTCCTTTTTCTCC
JMFF018K08+ GCCTCCGTGGGTGGCGGTGGAATCTCTTTCTCTGTTTCTTTCACCTCCTCCTTTTTCTCC
JMFF027O14+ CCTTTTTCTCC
JMFF023N14+ CCTTTTTCTCC
                      ____________________________________________________________
consensus GCCTCCGTGGGTGGCGGTGGAATCTCTTTCTCTGTTTCTTTCACCTCCTCCTTTTTCTCC
 
. : . : . : . : . : . :
JMFF034F01+ TCCTCCGCCTTGGGCGGCGCTTCCGCGTCTTTCTTCTCTTCCGACACAGGCGCTTCCTTG
JMFF036K13+ TTGGGCGGCGCTTCCGCGTCTTTNTTCTCTTCNGACACAGGCGCTTCATTG
JMFF018K08+ TCCTCCGCCTTGGGCGGCGCTTCCGCGTCTTTCTTCTCTTCCGACACAGGCGCTTCCTTG
JMFF027O14+ TCCTCCGCCTTGGGCGGCGCTTCCGCGTCTTTCTTCTCTTCCGACACAGGCGCTTCCTTG
JMFF023N14+ TCCTCCGCCTTGGGCGGCGCTTCCGCGTCTTTCTTCTCTTCCGACACAGGCGCTTCCTTG
JMFF021O08+ CCGACACAGGCGCTTCCTTG
                      ____________________________________________________________
consensus TCCTCCGCCTTGGGCGGCGCTTCCGCGTCTTTCTTCTCTTCCGACACAGGCGCTTCCTTG
 
. : . : . : . : . : . :
JMFF034F01+ GTCGGCTCCGGCGCAGCCTCGGATTCTTTCTTATCCTCCTCCGGCTTGGGTTGCTCTTCC
JMFF036K13+ GTCGGCTCCGGCGCAGCCTCGGATTCTTTCTTATCCTCCTCCGGCTTGGGTTGCTCTTCC
JMFF018K08+ GTCGGCTCCGGCGCAGCCTCGGATTCTTTCTTATCCTCCTCCGGCTTGGGTTGCTCTTCC
JMFF027O14+ GTCGGCTCCGGCGCAGCCTCGGATTCTTTCTTATCCTCCTCCGGCTTGGGTTGCTCTTCC
JMFF023N14+ GTCGGCTCCGGCGCAGCCTCGGATTCTTTCTTATCCTCCTCCGGCTTGGGTTGCTCTTCC
JMFF021O08+ GTCGGCTCCGGCGCAGCCTCGGATTCTTTCTTATCCTCCTCCGGCTTGGGTTGCTCTTCC
                      ____________________________________________________________
consensus GTCGGCTCCGGCGCAGCCTCGGATTCTTTCTTATCCTCCTCCGGCTTGGGTTGCTCTTCC
 
. : . : . : . : . : . :
JMFF034F01+ GCAACCGGAGCGGCGGCGGCGGCGGGTTTCTTCTCCTCCTCCTTAGGCTTAGCGGTAAAG
JMFF036K13+ GCAACCGGAGCGGCGGCGGCGGCGGGTTTCTTCTCCTCCTCCTTAGGCTTAGCGGTAAAG
JMFF018K08+ GCAACCGGAGCGGCGGCGGCGGCGGGTTTCTTCTCCTCCTCCTTAGGCTTAGCGGTAAAG
JMFF027O14+ GCAACCGGAGCGGCGGCGGCGGCGGGTTTCTTCTCCTCCTCCTTAGGCTTAGCGGTAAAG
JMFF023N14+ GCAACCGGAGCGGCGGCGGCGGCGGGTTTCTTCTCCTCCTCCTTAGGCTTAGCGGTAAAG
JMFF021O08+ GCAACCGGAGCGGCGGCGGCGGCGGGTTTCTTCTCCTCCTCCTTAGGCTTAGCGGTAAAG
                      ____________________________________________________________
consensus GCAACCGGAGCGGCGGCGGCGGCGGGTTTCTTCTCCTCCTCCTTAGGCTTAGCGGTAAAG
 
. : . : . : . : . : . :
JMFF034F01+ TCGTGGTTGTTCAAAGCCTCCTGAACCAACGCCTTAAACTCATCCAACGCCTTCTTCTCC
JMFF036K13+ TCGTGGTTGTTCAAAGCCTCNTGAACCAACGCCTTAAACTCATCCAACGCCTTCTTCTCC
JMFF018K08+ TCGTGGTTGTTCAAAGCCTCCTGAACCAACGCCTTAAACTCATCCAACGCCTTCTTCTCC
JMFF027O14+ TCGTGGTTGTTCAAAGCCTCCTGAACCAACGCCTTAAACTCATCCAACGCCTTCTTCTCC
JMFF023N14+ TCGTGGTTGTTCAAAGCCTCCTGAACCAACGCCTTAAACTCATCCAACGCCTTCTTCTCC
JMFF021O08+ TCGTGGTTGTTCAAAGCCTCCTGAACCAACGCCTTAAACTCATCCAACGCCTTCTTCTCC
                      ____________________________________________________________
consensus TCGTGGTTGTTCAAAGCCTCCTGAACCAACGCCTTAAACTCATCCAACGCCTTCTTCTCC
 
. : . : . : . : . : . :
JMFF034F01+ GGGTTGGGAAGCTCCTCCACCTTGTTGCTCTCCTCCTTAAACGAACCCGACTCCGTAACC
JMFF036K13+ GGGTTGGGAAGCTCCTCCACCTNGTTGCTCTCCTCCTTAAACGAACCCGACTCCGTAACC
JMFF018K08+ GGGTTGGGAAGCTCCTCCACCTTGTTGCTCTCCTCCTTAAACGAACCCGACTCCGTAACC
JMFF027O14+ GGGTTGGGAAGCTCCTCCACCTTGTTGCTCTCCTCCTTAAACGAACCCGACTCCGTAACC
JMFF023N14+ GGGTTGGGAAGCTCCTCCACCTTGTTGCTCTCCTCCTTAAACGAACCCGACTCCGTAACC
JMFF021O08+ GGGTTGGGAAGCTCCTCCACCTTGTTGCTCTCCTCCTTAAACGAACCCGACTCCGTAACC
                      ____________________________________________________________
consensus GGGTTGGGAAGCTCCTCCACCTTGTTGCTCTCCTCCTTAAACGAACCCGACTCCGTAACC
 
. : . : . : . : . : . :
JMFF034F01+ GCAGCCTTCTCCTTCTCCTCCTCAGCCGTCTTCTCAGGCTCCGGCTCCGGCGTCGCCTCC
JMFF036K13+ GCAGCCTTCTCCTTCTCCTCCTCAGCCGTCTTCTCAGGCTCCGGCTCCGGCGTCGCCTCC
JMFF018K08+ GCAGCCTTCTCCTTCTCCTCCTCAGCCGTCTTCTCAGGCTCCGGCTCCGGCGTCGCCTCC
JMFF027O14+ GCAGCCTTCTCCTTCTCCTCCTCAGCCGTCTTCTCAGGCTCCGGCTCCGGCGTCGCCTCC
JMFF023N14+ GCAGCCTTCTCCTTCTCCTCCTCAGCCGTCTTCTCAGGCTCCGGCTCCGGCGTCGCCTCC
JMFF021O08+ GCAGCCTTCTCCTTCTCCTCCTCAGCCGTCTTCTCAGGCTCCGGCTCCGGCGTCGCCTCC
                      ____________________________________________________________
consensus GCAGCCTTCTCCTTCTCCTCCTCAGCCGTCTTCTCAGGCTCCGGCTCCGGCGTCGCCTCC
 
. : . : . : . : . : . :
JMFF034F01+ TTCTCCACAACCTCAGCTGCGGCCTCCGGCACCGGCGCCGTCGCCGGCGCCACTT
JMFF036K13+ TTCTCCACAACCTCAGNTGCGGCCTCCGGCACCGGCGCCGTCGCCGGCGCCACTT
JMFF018K08+ TTCTCCACAACCTCAGCTGCGGCCTCCGGCACCGGCGCCGTCGCCGGCGCCACTT
JMFF027O14+ TTCTCCACAACCTCAGCTGCGGCCTCCGGCACCGGCGCCGTCGCCGGCGCCACTTCTTGT
JMFF023N14+ TTCTCCACAACCTCAGCTGCGGCCTCCGGCACCGGCGCCGTCGCCGGCGCCACTTCTTGT
JMFF021O08+ TTCTCCACAACCTCAGCTGCGGCCTCCGGCACCGGCGCCGTCGCCGGCGCCACTTCTTGT
                      ____________________________________________________________
consensus TTCTCCACAACCTCAGCTGCGGCCTCCGGCACCGGCGCCGTCGCCGGCGCCACTTCTTGT
 
. : . : . : . : . : . :
JMFF027O14+ GCCGGCGTCTCTTGAGCGGGTGCCTTAGTTTCTTCCGCCATATATACCAAGTATCGAATA
JMFF023N14+ GCCGGCGTCTCTTGAGCGGGTGCCTTAGTTTCTTCCGCCATATATACCAAGTATCGAATA
JMFF021O08+ GCCGGCGTCTCTTGAGCGGGTGCCTTAGTTTCTTCCGCCATATATACCAAGTATCGAATA
                      ____________________________________________________________
consensus GCCGGCGTCTCTTGAGCGGGTGCCTTAGTTTCTTCCGCCATATATACCAAGTATCGAATA
 
. : . : . : . : . : . :
JMFF027O14+ CCCAAAAGGAAAACGATAAATTCGAAGAGAAATTAATAAAACTCTGCGAAGAAGAAGAGT
JMFF023N14+ CCCAAAAGGAAAACGATAAATTCGAAGAGAAATTAATAAAACTCTGCGAAGAAGAAGAGT
JMFF021O08+ CCCAAAAGGAAAACGATAAATTCGAAGAGAAATTAATAAAACTCTGCGAAGAAGAAGAGT
                      ____________________________________________________________
consensus CCCAAAAGGAAAACGATAAATTCGAAGAGAAATTAATAAAACTCTGCGAAGAAGAAGAGT