Previous Contig 001095:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF021N15Sequence613001095 (2)gb:AB016893_15132526e-09Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MYH9.719004188 (3)gb:AY058141_15642795e-17Arabidopsis thaliana AT5g09850/MYH9_6 mRNA, complete cds.>gb:AY093710_1575370 Ar
JMFN039A24Sequence649001095 (2)gb:AB016893_15132521e-21Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MYH9.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN039A24+ TCAAGGTTTTGT
                      ____________________________________________________________
consensus TCAAGGTTTTGT
 
. : . : . : . : . : . :
JMFN039A24+ AGCAGCTCAATCACAGATTCTTCAGGCTGTTCTGGATCTTCAAGCTGCTCTTTGATTCTG
                      ____________________________________________________________
consensus AGCAGCTCAATCACAGATTCTTCAGGCTGTTCTGGATCTTCAAGCTGCTCTTTGATTCTG
 
. : . : . : . : . : . :
JMFN039A24+ ATAATTTTGGTCTGCTCATCGTCAAACAAGCCTCCATACGGATCAGCCTCTTCTTCTTCT
JMFF021N15+ CTCTTCTTCTTCT
                      ____________________________________________________________
consensus ATAATTTTGGTCTGCTCATCGTCAAACAAGCCTCCATACGGATCAGCCTCTTCTTCTTCT
 
. : . : . : . : . : . :
JMFN039A24+ TCTTCTTCTTCGCCCTCTTCCCGTTCGTTATCATCATGACGGTGATGATTAGACTCGGGA
JMFF021N15+ TCTTCTTCTTCGCCCTCTTCCCGTTCGTTATCATCATGACGGTGATGATTAGACTCGGGA
                      ____________________________________________________________
consensus TCTTCTTCTTCGCCCTCTTCCCGTTCGTTATCATCATGACGGTGATGATTAGACTCGGGA
 
. : . : . : . : . : . :
JMFN039A24+ CTGGAAGGACTCTTACTGATGTGCCTCTCGATATTGGTAACGCTATTGTAATTCGCAACG
JMFF021N15+ CTGGAAGGACTCTTACTGATGTGCCTCTCGATATTGGTAACGCTATTGTAATTCGCAACG
                      ____________________________________________________________
consensus CTGGAAGGACTCTTACTGATGTGCCTCTCGATATTGGTAACGCTATTGTAATTCGCAACG
 
. : . : . : . : . : . :
JMFN039A24+ CCGTTGGGCGCAAAGTGAGCGTTGACTACGTCGTTGCAGTTGCGGCAGCGATTGGAATAC
JMFF021N15+ CCGTTGGGCGCAAAGTGAGCGTTGACTACGTCGTTGCAGTTGCGGCAGCGATTGGAATAC
                      ____________________________________________________________
consensus CCGTTGGGCGCAAAGTGAGCGTTGACTACGTCGTTGCAGTTGCGGCAGCGATTGGAATAC
 
. : . : . : . : . : . :
JMFN039A24+ AACTTCTCGACGATTCCGTCGCGCCGATCCTTGAATTCATCGGCGCAGTCGACGGACGCC
JMFF021N15+ AACTTCTCGACGATTCCGTCGCGCCGATCCTTGAATTCATCGGCGCAGTCGACGGACGCC
                      ____________________________________________________________
consensus AACTTCTCGACGATTCCGTCGCGCCGATCCTTGAATTCATCGGCGCAGTCGACGGACGCC
 
. : . : . : . : . : . :
JMFN039A24+ ACCTCAATCGCCGCCTCTATCAGCGTCCACACATCCGTTTTCGATTTCGACAGAATCAAC
JMFF021N15+ ACCTCAATCGCCGCCTCTATCAGCGTCCACACATCCGTTTTCGATTTCGACAGAATCAAC
                      ____________________________________________________________
consensus ACCTCAATCGCCGCCTCTATCAGCGTCCACACATCCGTTTTCGATTTCGACAGAATCAAC
 
. : . : . : . : . : . :
JMFN039A24+ CGGAGCTCATCCCCGTCCATGCTTGACCAAATCCGTTGGTTAAATTTTGTTTTCACCGAA
JMFF021N15+ CGGAGCTCATCCCCGTCCATGCTTGACCAAATCCGTTGGTTAAATTTTGTTTTCACCGAA
                      ____________________________________________________________
consensus CGGAGCTCATCCCCGTCCATGCTTGACCAAATCCGTTGGTTAAATTTTGTTTTCACCGAA
 
. : . : . : . : . : . :
JMFN039A24+ TTCTCTCAACAGAAAAATAAGATGAAAGGATTGCGCGGTTACGTCACCAGATCTGAGACT
JMFF021N15+ TTCTCTCAACAGAAAAATAAGATGAAAGGATTGCGCGGTTACGTCACCAGATCTGAGACT
                      ____________________________________________________________
consensus TTCTCTCAACAGAAAAATAAGATGAAAGGATTGCGCGGTTACGTCACCAGATCTGAGACT
 
. : . : . : . : . : . :
JMFN039A24+ TCATGGGAGAGGCGTCATGCGATCTACAGAACGACGCCGTACTGATCCCCTTGTCGGAAC
JMFF021N15+ TCATGGGAGAGGCGTCATGCGATCTACAGAACGACGCCGTACTGATCCCCTTGTCGGAAC
                      ____________________________________________________________
consensus TCATGGGAGAGGCGTCATGCGATCTACAGAACGACGCCGTACTGATCCCCTTGTCGGAAC
 
. : . : . : . : . : . :
JMFN039A24+ TTCGAGTTATTGTTGTTGTCCAGAG
JMFF021N15+ TTCGAGTTATTGTTGTTGTCCAGAGACACTGAACCGACGAGAAGGTGGGGTGGAAGGGAA
                      ____________________________________________________________
consensus TTCGAGTTATTGTTGTTGTCCAGAGACACTGAACCGACGAGAAGGTGGGGTGGAAGGGAA
 
. : . : . : . : . : . :
JMFF021N15+ GGGGAGGGGAGAGCTTTTAAGACTGGAATTTTGAGTTATTTTCGTTTTTACCGAATGGAC
                      ____________________________________________________________
consensus GGGGAGGGGAGAGCTTTTAAGACTGGAATTTTGAGTTATTTTCGTTTTTACCGAATGGAC