Previous Contig 001087:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF021L03Sequence349001087 (5)310001087 (5)
JMFF029I10Sequence337001087 (5)301001087 (5)
JMSF012G06Sequence339001087 (5)587011686 (2)gb:AP003843_18341149e-09Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OJ16

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF029I10+ T
                      ____________________________________________________________
consensus T
 
. : . : . : . : . : . :
JMFF029I10+ TTTTTTTTTATTAAAGCAACACACTCTTAAGTTCATTGTGTAAAACTGAAGATTGCAATC
                      ____________________________________________________________
consensus TTTTTTTTTATTAAAGCAACACACTCTTAAGTTCATTGTGTAAAACTGAAGATTGCAATC
 
. : . : . : . : . : . :
JMFF029I10+ TCGACTACTCCACAAAGCAGAAATTCTCGGATTACAGAACGACATGTTACTACTAAAACG
                      ____________________________________________________________
consensus TCGACTACTCCACAAAGCAGAAATTCTCGGATTACAGAACGACATGTTACTACTAAAACG
 
. : . : . : . : . : . :
JMFF029I10+ CTCCGAAACAAAAACAGAAACAGCACAGATAAACCTAAAAAGCCGAAGATAGGAGGAAAC
                      ____________________________________________________________
consensus CTCCGAAACAAAAACAGAAACAGCACAGATAAACCTAAAAAGCCGAAGATAGGAGGAAAC
 
. : . : . : . : . : . :
rJMFF029I10- TTCTACTTGGATCTCTGCCTCATCTTTCGGCGCTTCCTCTTCAACCTCCT
JMSF012G06+ TCTACTTCGATCTCTGCCTCATCTTTCTGCGCTTCCTCTTCAACCTTCT
JMFF029I10+ AGATTCGTGCTTCTACTTGGATCTCTGCCTCATCTTTCGGCGCTTCCTCTTCAACCTCCT
rJMFF021L03- TCTACTTGGATCTCTGCCTCATCTTTCGGCGCTTCCTCTTCAACCTCCT
JMFF021L03+ TCTACTTGGATCTCTGCCTCATCTTTCGGCGCTTCCTCTTCAACCTCCT
                      ____________________________________________________________
consensus AGATTCGTGCTTCTACTTGGATCTCTGCCTCATCTTTCGGCGCTTCCTCTTCAACCTCCT
 
. : . : . : . : . : . :
rJMFF029I10- CATACGCTTCTTCTTCCACTTAACTCTCATGTTGAAC
JMSF012G06+ CATACGCTTCTTCTTCCACTTAGCTCTCAT
JMFF029I10+ CATACGCTTCTTCTTCCACTTAACTCTCATGTTGAAC
rJMFF021L03- CATACGCTTCTTCTTCCACTTAGCTCTCATTTTGAACCGAGAGTCTCGGGAATTCCTTGA
JMFF021L03+ CATACGCTTCTTCTTCCACTTAGCTCTCATTTTGAACCGAGAGTCTCGGGAATTCCTTGA
                      ____________________________________________________________
consensus CATACGCTTCTTCTTCCACTTAGCTCTCATTTTGAACCGAGAGTCTCGGGAATTCCTTGA
 
. : . : . : . : . : . :
rJMFF021L03- CTACTTTCGACCAAATCTCTGATAGCCTCCGACGACGAAGAAAAGCGACAATCGAGAAAC
JMFF021L03+ CTACTTTCGACCAAATCTCTGATAGCCTCCGACGACGAAGAAAAGCGACAATCGAGAAAC
                      ____________________________________________________________
consensus CTACTTTCGACCAAATCTCTGATAGCCTCCGACGACGAAGAAAAGCGACAATCGAGAAAC