Previous Contig 001085:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF006H22Sequence514001085 (10)pir|T51181|T511813e-83actin 1 [imported] - small naked oat>gb:AF234528_1779534 Avena nuda actin 1 gene106009458 (4)
JMFF021J24Sequence185001085 (10)
JMFF021K15Sequence553001085 (10)pir|T51181|T511813e-89actin 1 [imported] - small naked oat>gb:AF234528_1779534 Avena nuda actin 1 gene
JMFF026K01Sequence185001085 (10)168009458 (4)
JMFF038P13Sequence354001085 (10)gb:AF281323_17829372e-41Magnolia denudata actin mRNA, complete cds.
JMFF049C11Sequence467001085 (10)gb:BT004315_16373903e-70Arabidopsis thaliana clone RAFL15-43-N11 (R50155) putative actin 4 (At5g59370) m402009458 (4)gb:AF386514_17947104e-06Pyrus communis actin mRNA, partial cds.
JMFN008B20Sequence640001085 (10)pir|T51181|T51181e-107actin 1 [imported] - small naked oat>gb:AF234528_1779534 Avena nuda actin 1 gene
JMFS019C05Sequence546001085 (10)pir|T51175|T511752e-72actin [imported] - upland cotton>gb:AF059484_1765041 Gossypium hirsutum actin ge
JMFS070E07Sequence626001085 (10)sp|P93584|ACT9_SOLTU1e-83Actin 82 (Fragment).>gb:STU60483_1723139 Solanum tuberosum actin (Pot82) gene, p
JMSF007E14Sequence439001085 (10)pir|T51181|T511813e-68actin 1 [imported] - small naked oat>gb:AF234528_1779534 Avena nuda actin 1 gene

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF021K15+ AATGT
JMFN008B20+ CCACATCTGCTGGAATGT
                      ____________________________________________________________
consensus CCACATCTGCTGGAATGT
 
. : . : . : . : . : . :
JMFF021K15+ GCTGAGGGAGGCTAAAATCGATCCTCCGATCCAAACACTGTACTTCCTCTCGGGCGGGGC
JMFN008B20+ GCTGAGGAAGGCTAAAATCGATCCTCCGATCCAAACACTGTACTTCCTCTCGGGCGGGGC
                      ____________________________________________________________
consensus GCTGAGGGAGGCTAAAATCGATCCTCCGATCCAAACACTGTACTTCCTCTCGGGCGGGGC
 
. : . : . : . : . : . :
JMFF021K15+ AACCACCTTGATCTTCATACTACTTGGAGCCAAAGCCGTGATCTCCTTGCTCATCCTATC
JMSF007E14+ TCCTATC
JMFF006H22+ TCTTCATACTACTTGGAGCCAAAGCCGTGATCTCCTTGCTCATCCTATC
JMFN008B20+ AACCACCTTGATCTTCATACTACTTGGAGCCAAAGCCGTGATCTCCTTGCTCATCCTATC
                      ____________________________________________________________
consensus AACCACCTTGATCTTCATACTACTTGGAGCCAAAGCCGTGATCTCCTTGCTCATCCTATC
 
. : . : . : . : . : . :
JMFF021K15+ AGCAATGCCGGTAAACATTGTGGTACCACCACTGAGGACGATATTCCCGTACAGGTCCTT
JMSF007E14+ AGCAATGCCGGTAAACATTGTGGTACCACCACTGAGGACGATATTCCCGTACAGGTCCTT
JMFF006H22+ AGCAATGCCGGTAAACATTGTGGTACCACCACTGAGGACGATATTCCCGTACAGGTCCTT
JMFN008B20+ AGCAATGCCGGTAAACATTGTGGTACCACCACTGAGGACGATATTCCCGTACAGGTCCTT
                      ____________________________________________________________
consensus AGCAATGCCGGTAAACATTGTGGTACCACCACTGAGGACGATATTCCCGTACAGGTCCTT
 
. : . : . : . : . : . :
JMFF021K15+ CCTAATATCGACGTCGCACTTCATGATGGAATTGTATGTTGTCTCGTGGATGCCAGCAGC
JMSF007E14+ CCTAATATCGACGTCGCACTTCATGATGGAATTGTATGTTGTCTCGTGGATGCCAGCAGC
JMFF006H22+ CCTAATATCGACGTCGCACTTCATGATGGAATTGTATGTTGTCTCGTGGATGCCAGCAGC
JMFF038P13+ CGACGTCGCACTTCATGATGGAATTGTATGTTGTCTCGTGGATGCCAGCAGC
JMFN008B20+ CCTAATATCGACGTCGCACTTCATGATGGAATTGTATGTTGTCTCGTGGATGCCAGCAGC
JMFS070E07+ CGACGTCGCACTTCATGATGGAATTGTATGTTGTCTCGTGGATGCCAGCAGC
                      ____________________________________________________________
consensus CCTAATATCGACGTCGCACTTCATGATGGAATTGTATGTTGTCTCGTGGATGCCAGCAGC
 
. : . : . : . : . : . :
JMFF021K15+ TTCCATCCCGATTATGGATGGCTGGAAGAGGACCTCCGGGCAGCGGAATCGCTCGTTGCC
JMSF007E14+ TTCCATCCCGATTATGGATGGCTGGAAGAGGACCTCCGGGCAGCGGAATCGCTCGTTGCC
JMFF006H22+ TTCCATCCCGATTATGGATGGCTGGAAGAGGACCTCCGGGCAGCGGAATCGCTCGTTGCC
JMFF038P13+ TTCCATCCCGATTATGGATGGCTGGAAGAGGACCTCCGGGCAGCGGAATCGCTCGTTGCC
JMFN008B20+ TTCCATCCCGATTATGGATGGCTGGAAGAGGACCTCCGGGCAGCGGAATCGCTCGTTGCC
JMFS070E07+ TTCCATCCCGATTATGGATGGCTGGAAGAGGACCTCCGGGCAGCGGAATCGCTCGTTGCC
                      ____________________________________________________________
consensus TTCCATCCCGATTATGGATGGCTGGAAGAGGACCTCCGGGCAGCGGAATCGCTCGTTGCC
 
. : . : . : . : . : . :
JMFF021K15+ GATAGTGATCACCTGTCCATCGGGCAGCTCGTAGCTCTTTTCCACAGATGAGCTCGTCTT
JMSF007E14+ GATAGTGATCACCTGTCCATCGGGCAGCTCGTAGCTCTTTTCCACAGATGAGCTCGTCTT
JMFF006H22+ GATAGTGATCACCTGTCCATCGGGCAGCTCGTAGCTCTTTTCCACAGATGAGCTCGTCTT
JMFF038P13+ GATAGTGATCACCTGTCCATCGGGCAGCTCGTAGCTCTTTTCCACAGATGAGCTCGTCTT
JMFN008B20+ GATAGTGATCACCTGTCCATCGGGCAGCTCGTAGCTCTTTTCCACAGATGAGCTCGTCTT
JMFS070E07+ GATAGTGATCACCTGTCCATCGGGCAGCTCGTAGCTCTTTTCCACAGATGAGCTCGTCTT
                      ____________________________________________________________
consensus GATAGTGATCACCTGTCCATCGGGCAGCTCGTAGCTCTTTTCCACAGATGAGCTCGTCTT
 
. : . : . : . : . : . :
JMFF021K15+ GGATGTTTCGAGCTCTTGCTCGTAGTCGAGAGCAATGTACGAGAGCTTTTCCTTCATGTC
JMSF007E14+ GGATGTTTCGAGCTCTTGCTCGTAGTCGAGAGCAATGTACGAGAGCTTTTCCTTCATGTC
JMFF006H22+ GGATGTTTCGAGCTCTTGCTCGTAGTCGAGAGCAATGTACGAGAGCTTTTCCTTCATGTC
JMFF038P13+ GGATGTTTCGAGCTCTTGCTCGTAGTCGAGAGCAATGTACGAGAGCTTTTCCTTCATGTC
JMFN008B20+ GGATGTTTCGAGCTCTTGCTCGTAGTCGAGAGCAATGTACGAGAGCTTTTCCTTCATGTC
JMFS070E07+ GGATGTTTCGAGCTCTTGCTCGTAGTCGAGAGCAATGTACGAGAGCTTTTCCTTCATGTC
                      ____________________________________________________________
consensus GGATGTTTCGAGCTCTTGCTCGTAGTCGAGAGCAATGTACGAGAGCTTTTCCTTCATGTC
 
. : . : . : . : . : . :
JMFF021K15+ CCTCACGATTTCCCGCTCCGCGGAAGTGGTGAAAGAATAGCCTCTCTCGGTCAGAATCTT
JMSF007E14+ CCTCACGATTTCCCGCTCCGCGGAAGTGGTGAAAGAATAGCCTCTCTCGGTCAGAATCTT
JMFF006H22+ CCTCACGATTTCCCGCTCCGCGGAAGTGGTGAAAGAATAGCCTCTCTCGGTCAGAATCTT
JMFF038P13+ CCTCACGATTTCCCGCTCCGCGGAAGTGGTGAAAGAATAGCCTCTNTCGGTCAGAATCTT
JMFN008B20+ CCTCACGATTTCCCGCTCCGCGGAAGTGGTGAAAGAATAGCCTCTCTCGGTCAGAATCTT
JMFS070E07+ CCTCACGATTTCCCGCTCCGCGGAAGTGGTGAAAGAATAGCCTCTCTCGGTCAGAATCTT
                      ____________________________________________________________
consensus CCTCACGATTTCCCGCTCCGCGGAAGTGGTGAAAGAATAGCCTCTCTCGGTCAGAATCTT
 
. : . : . : . : . : . :
JMFF021K15+ CATGAGATGGTCGGTGAGATCACGTCCTGCCAAATCAAGACGCAGGATTGCGTGTGGCAG
JMSF007E14+ CATGAGATGGTCGGTGAGATCACGTCCTGCCAAATCAAGACGCAGGATTGCGTGTGGCAG
JMFF006H22+ CATGAGATGGTCGGTGAGATCACGTCCTGCCAAATCAAGACGCAGGATTGCGTGTGGCAG
JMFF038P13+ CATGAGATGGTCGGTGAGATCACGTCNTGCCAAATCAAGACGCAGGATTGNGTGTGGCAG
JMFN008B20+ CATGAGATGGTCGGTGAGATCACGTCCTGCCAAATCAAGACGCAGGATTGCGTGTGGCAG
JMFS070E07+ CATGAGATGGTCGGTGAGATCACGTCCTGCCAAATCAAGACGCAGGATTGCGTGTGGCAG
                      ____________________________________________________________
consensus CATGAGATGGTCGGTGAGATCACGTCCTGCCAAATCAAGACGCAGGATTGCGTGTGGCAG
 
. : . : . : . : . : . :
JMFF021K15+ GGCGTAAC
JMSF007E14+ GGCGTAACC
JMFF006H22+ GGCGTAACCTTCGTAGATTGGAACCGTGTGACTCACACCATC
JMFF038P13+ GG
JMFN008B20+ GGCGTAACCTTCGTAGATTGGAACCGTGTGACTCACACCATCCCCAGAATCCAAAACAAT
JMFS070E07+ GGCGTAACCTTCGTAGATTGGAACCGTGTGACTCACACCATCCCCAGAATCCAAAACAAT
                      ____________________________________________________________
consensus GGCGTAACCTTCGTAGATTGGAACCGTGTGACTCACACCATCCCCAGAATCCAAAACAAT
 
. : . : . : . : . : . :
JMFN008B20+ ACCAGTTGTACGACCACTGGC
JMFS070E07+ ACC--TAAAAC--CCACCAAGTTAATATCAATATTATGACAAATATTCAAATTATTCGCC
                      ____________________________________________________________
consensus ACCAGTTGTACGACCACTGGGTTAATATCAATATTATGACAAATATTCAAATTATTCGCC
 
. : . : . : . : . : . :
JMFS070E07+ TTAATGATAATGCTTACCAGTTGTACGACCACTGGCGTAAAGGGAAAGGACGGCCTGGAT
                      ____________________________________________________________
consensus TTAATGATAATGCTTACCAGTTGTACGACCACTGGCGTAAAGGGAAAGGACGGCCTGGAT
 
. : . : . : . : . : . :
JMFS070E07+ AGCAACATACATAGCAGGGGCATTGAACGTTTCGAACATGATTTGTGTCATTTTCTCACG
JMFS019C05+ GGGGCATTGAACGTTTCGAACATGATNTGTGTCATTTTCTCACG
JMFF049C11+ GAACATGATTTGTGTCATTTTCTCACG
                      ____________________________________________________________
consensus AGCAACATACATAGCAGGGGCATTGAACGTTTCGAACATGATTTGTGTCATTTTCTCACG
 
. : . : . : . : . : . :
JMFS070E07+ ATTAGCCTTGGGGTTAAGAGGAGCTTCCGTGAG
JMFS019C05+ ATTAGCCTTGGGGTTAAGAGGAGCTTCCGTGAGGAGCACCGGGTGCTCCTCGGGAGCCAC
JMFF049C11+ ATTAGCCTTGGGGTTAAGAGGAGCTTCCGTGAGGAGCACCGGGTGCTCCTCGGGAGCCAC
                      ____________________________________________________________
consensus ATTAGCCTTGGGGTTAAGAGGAGCTTCCGTGAGGAGCACCGGGTGCTCCTCGGGAGCCAC
 
. : . : . : . : . : . :
JMFS019C05+ ACGGAGTTCATTGTAGAAAGTATGATGCCATATTTTCTCCATGTCATCCCAGTTGTTGAC
JMFF049C11+ ACGGAGTTCATTGTAGAAAGTATGATGCCATATTTTCTCCATGTCATCCCAGTTGTTGAC
                      ____________________________________________________________
consensus ACGGAGTTCATTGTAGAAAGTATGATGCCATATTTTCTCCATGTCATCCCAGTTGTTGAC
 
. : . : . : . : . : . :
JMFS019C05+ AATTCCATGTTCGATAGGGTACTTCAGAGTCAAAATACCTCTCTTCGATTGAGCCTCGTC
JMFF049C11+ AATTCCATGTTCGATAGGGTACTTCAGAGTCAAAATACCTCTCTTCGATTGAGCCTCGTC
                      ____________________________________________________________
consensus AATTCCATGTTCGATAGGGTACTTCAGAGTCAAAATACCTCTCTTCGATTGAGCCTCGTC
 
. : . : . : . : . : . :
JMFS019C05+ TCCAACATAAGCATCCTTCTGGCCCATGCCAACCATCACTCCCGTGTGACGGGGGCGCCC
JMFF049C11+ TCCAACATAAGCATCCTTCTGGCCCATGCCAACCATCACTCCCGTGTGACGGGGGCGCCC
                      ____________________________________________________________
consensus TCCAACATAAGCATCCTTCTGGCCCATGCCAACCATCACTCCCGTGTGACGGGGGCGCCC
 
. : . : . : . : . : . :
JMFS019C05+ AACAATGCTAGGAAACACAGCTCTCGGAGCATCATCTCCAGCAAATCCGGCCTTGACCAT
JMFF049C11+ AACAATGCTAGGAAACACAGCTCTCGGAGCATCATCTCCAGCAAATCCGGCCTTGACCAT
                      ____________________________________________________________
consensus AACAATGCTAGGAAACACAGCTCTCGGAGCATCATCTCCAGCAAATCCGGCCTTGACCAT
 
. : . : . : . : . : . :
JMFS019C05+ TCCAGTTCCATTGTCACAGACGAGGGGCTGGATATCCTCACCTTCGGCCATCTT
JMFF049C11+ TCCAGTTCCATTGTCACAGACGAGGGGCTGGATATCCTCACCTTCGGCCATCTTTTTTTT
JMFF026K01+ TTTTT
JMFF021J24+ TTTTT
                      ____________________________________________________________
consensus TCCAGTTCCATTGTCACAGACGAGGGGCTGGATATCCTCACCTTCGGCCATCTTTTTTTT
 
. : . : . : . : . : . :
JMFF049C11+ TTTTTATTGGTTCTTTAGGCTTTTGAAGATATGGGTATTGGGTGTGGCGTGATGTTCCTC
JMFF026K01+ TTTTTATTGGTTCTTTAGGCTTTTGAAGATATGGGTATTGGGTGTGGCGTGATGTTCCTC
JMFF021J24+ TTTTTATTGGTTCTTTAGGCTTTTGAAGATATGGGTATTGGGTGTGGCGTGATGTTCCTC
                      ____________________________________________________________
consensus TTTTTATTGGTTCTTTAGGCTTTTGAAGATATGGGTATTGGGTGTGGCGTGATGTTCCTC
 
. : . : . : . : . : . :
JMFF049C11+ TCTCCCGTCTTTCGCACTCT
JMFF026K01+ TCTCCCGTCTTTCGCACTCTTAAAACAGAGCCTGACGCACTCCCTCAGGCTTAAAAGCCG
JMFF021J24+ TCTCCCGTCTTTCGCACTCTTAAAACAGAGCCTGACGCACTCCCTCAGGCTTAAAAGCCG
                      ____________________________________________________________
consensus TCTCCCGTCTTTCGCACTCTTAAAACAGAGCCTGACGCACTCCCTCAGGCTTAAAAGCCG
 
. : . : . : . : . : . :
JMFF026K01+ GAATAACGAAAACTGAGTCTCAGCCTCAAATGAAATTCGGATGAAATGAGCCTCAAATTC
JMFF021J24+ GAATAACGAAAACTGAGTCTCAGCCTCAAATGAAATTCGGATGAAATGAGCCTCAAATTC
                      ____________________________________________________________
consensus GAATAACGAAAACTGAGTCTCAGCCTCAAATGAAATTCGGATGAAATGAGCCTCAAATTC