Previous Contig 001082:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF021I14Sequence606001082 (2)gb:AP005396_18510811e-17Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC clone:P063748009221 (2)pir|H86295|H862951e-44hypothetical protein T24D18.20 [imported] - Arabidopsis thaliana>gb:AE005172_890
JMSF021K06Sequence686001082 (2)gb:AP005396_18510817e-18Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC clone:P063779009221 (2)pir|H86295|H862958e-58hypothetical protein T24D18.20 [imported] - Arabidopsis thaliana>gb:AE005172_890

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF021K06+ TCAAAAAAGCGGAATTACATCTCTTG
                      ____________________________________________________________
consensus TCAAAAAAGCGGAATTACATCTCTTG
 
. : . : . : . : . : . :
JMSF021K06+ AGATTATCGTTGCTGCCGTCGCTCTGGATTCCCGAATTCGTGAAATTGGCGGTGTAGGAG
JMFF021I14+ TAGGAG
                      ____________________________________________________________
consensus AGATTATCGTTGCTGCCGTCGCTCTGGATTCCCGAATTCGTGAAATTGGCGGTGTAGGAG
 
. : . : . : . : . : . :
JMSF021K06+ GTGAGATCGAAGGGGACGGGAGTTTCGCAACAGTCGATGCCGTAGCATCCGGCGAATCCG
JMFF021I14+ GTGAGATCGAAGGGGACGGGAGTTTCGCAACAGTCGATGCCGTAGCATCCGGCGAATCCG
                      ____________________________________________________________
consensus GTGAGATCGAAGGGGACGGGAGTTTCGCAACAGTCGATGCCGTAGCATCCGGCGAATCCG
 
. : . : . : . : . : . :
JMSF021K06+ GAGCTGATGTTGGCGCCGCAAATGGCGGTGCAGCCGGCGACGACGGTGGAGTTCTGAGTG
JMFF021I14+ GAGCTGATGTTGGCGCCGCAAATGGCGGTGCAGCCGGCGACGACGGTGGAGTTCTGAGTG
                      ____________________________________________________________
consensus GAGCTGATGTTGGCGCCGCAAATGGCGGTGCAGCCGGCGACGACGGTGGAGTTCTGAGTG
 
. : . : . : . : . : . :
JMSF021K06+ AACAGGGAGTTGCCGCATCCGGCGAACAGGAATTTGTTGCGCGATTTGGAGTAGTAGAAA
JMFF021I14+ AACAGGGAGTTGCCGCATCCGGCGAACAGGAATTTGTTGCGCGATTTGGAGTAGTAGAAA
                      ____________________________________________________________
consensus AACAGGGAGTTGCCGCATCCGGCGAACAGGAATTTGTTGCGCGATTTGGAGTAGTAGAAA
 
. : . : . : . : . : . :
JMSF021K06+ GGGGAGCCGGAGAGATCTGTGCCGTTGGTGATGGCGTTCCGACCCGCGGAATCGTCGCAG
JMFF021I14+ GGGGAGCCGGAGAGATCTGTGCCGTTGGTGATGGCGTTCCGACCCGCGGAATCGTCGCAG
                      ____________________________________________________________
consensus GGGGAGCCGGAGAGATCTGTGCCGTTGGTGATGGCGTTCCGACCCGCGGAATCGTCGCAG
 
. : . : . : . : . : . :
JMSF021K06+ AAATTCACAACGGATTTTAGAGTCGTGATGGTTTGATTTTCCAGCGAAACCGCCACCACT
JMFF021I14+ AAATTCACAACGGATTTTAGAGTCGTGATGGTTTGATTTTCCAGCGAAACCGCCACCACT
                      ____________________________________________________________
consensus AAATTCACAACGGATTTTAGAGTCGTGATGGTTTGATTTTCCAGCGAAACCGCCACCACT
 
. : . : . : . : . : . :
JMSF021K06+ TCTCCTTGGAGCTCGATTTGGACGAATGAGTTTAGGTATGCTTTGGGAGGCGCGCTGCTG
JMFF021I14+ TCTCCTTGGAGCTCGATTTGGACGAATGAGTTTAGGTATGCTTTGGGAGGCGCGCTGCTG
                      ____________________________________________________________
consensus TCTCCTTGGAGCTCGATTTGGACGAATGAGTTTAGGTATGCTTTGGGAGGCGCGCTGCTG
 
. : . : . : . : . : . :
JMSF021K06+ TTATCGCAGTTTACTAAGAACCATGGATTGAGAGCGCAGCCCTCGCCGATTCCGAAAGGA
JMFF021I14+ TTATCGCAGTTTACTAAGAACCATGGATTGAGAGCGCAGCCCTCGCCGATTCCGAAAGGA
                      ____________________________________________________________
consensus TTATCGCAGTTTACTAAGAACCATGGATTGAGAGCGCAGCCCTCGCCGATTCCGAAAGGA
 
. : . : . : . : . : . :
JMSF021K06+ AACGGAATTGAGACGTTTCCGCACCGCTGTTCGCAGCGCGGCTTTGCGAGTGACGGCGCC
JMFF021I14+ AACGGAATTGAGACGTTTCCGCACCGCTGTTCGCAGCGCGGCTTTGCGAGTGACGGCGCC
                      ____________________________________________________________
consensus AACGGAATTGAGACGTTTCCGCACCGCTGTTCGCAGCGCGGCTTTGCGAGTGACGGCGCC
 
. : . : . : . : . : . :
JMSF021K06+ GCTGCTGCCGACGGGAACAGCGGCGGCACGTGAAAGAAGAGGAAAGCGAAAAGCAGCAGG
JMFF021I14+ GCTGCTGCCGACGGGAACAGCGGCGGCACGTGAAAGAAGAGGAAAGCGAAAAGCAGCAGG
                      ____________________________________________________________
consensus GCTGCTGCCGACGGGAACAGCGGCGGCACGTGAAAGAAGAGGAAAGCGAAAAGCAGCAGG
 
. : . : . : . : . : . :
JMSF021K06+ CGGCGGAAGATCATTTCCGGCGAGTTAGTTCTTCGTTAATGAAGCTTGACTTGATCAA
JMFF021I14+ CGGCGGAAGATCATTTCCGGCGAGTTAGTTCTTCGTTAATGAAGCTTGACTTGATCAATC
                      ____________________________________________________________
consensus CGGCGGAAGATCATTTCCGGCGAGTTAGTTCTTCGTTAATGAAGCTTGACTTGATCAATC