Previous Contig 001076:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF021G24Sequence486001076 (2)pir|A86186|A861863e-15hypothetical protein [imported] - Arabidopsis thaliana>gb:AE005172_889539 Arabid671009216 (3)pir|A86186|A861867e-41hypothetical protein [imported] - Arabidopsis thaliana>gb:AE005172_889539 Arabid
JMSF034P16Sequence646001076 (2)gb:AY085383_15704535e-41Arabidopsis thaliana clone 149102 mRNA, complete sequence.775009216 (3)pir|A86186|A861861e-65hypothetical protein [imported] - Arabidopsis thaliana>gb:AE005172_889539 Arabid

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF034P16+ TTCGGCTGCTAAAGGCGGTATTTATGCCAACGACCATTAGATATTTTCGTTTCT
                      ____________________________________________________________
consensus TTCGGCTGCTAAAGGCGGTATTTATGCCAACGACCATTAGATATTTTCGTTTCT
 
. : . : . : . : . : . :
JMSF034P16+ TATTCAATTCCGGGATCTTCAAGTCTTCAGATATCGGGGAGCCAGTCAGTATAGAATCCT
                      ____________________________________________________________
consensus TATTCAATTCCGGGATCTTCAAGTCTTCAGATATCGGGGAGCCAGTCAGTATAGAATCCT
 
. : . : . : . : . : . :
JMSF034P16+ GAAAAGCCCTTGCTGCAGCTAACTCCATCTCTAAATTAGATATTGTTTTATCCAGAGTTT
                      ____________________________________________________________
consensus GAAAAGCCCTTGCTGCAGCTAACTCCATCTCTAAATTAGATATTGTTTTATCCAGAGTTT
 
. : . : . : . : . : . :
JMSF034P16+ GTATAGCGTTTTGTGTCTTTGAAACCTCAATAAGAATATCCCGGGATTCCCTTTCTGGGT
                      ____________________________________________________________
consensus GTATAGCGTTTTGTGTCTTTGAAACCTCAATAAGAATATCCCGGGATTCCCTTTCTGGGT
 
. : . : . : . : . : . :
JMSF034P16+ GCTTAATTCCAGTATCACAGCCCTCTGAAACTAACTTTATCTTGTCATCCTCCATCTGTG
JMFF021G24+ CTTAATTCCAGTATCACAGCCTTCTGAAACTAACTTTATCTTGTCATCCTCCATCTGTG
                      ____________________________________________________________
consensus GCTTAATTCCAGTATCACAGCCTTCTGAAACTAACTTTATCTTGTCATCCTCCATCTGTG
 
. : . : . : . : . : . :
JMSF034P16+ TAGGCCGTGATATGCCCTTAGCTTCTGGCACCGTCCACATTCTGTCAGTGAAGAGCATCC
JMFF021G24+ TAGGCCGTGATATGCCCTTAGCTTCTGGCACCGTCCACATTCTGTCAGTGAAGAGCATCC
                      ____________________________________________________________
consensus TAGGCCGTGATATGCCCTTAGCTTCTGGCACCGTCCACATTCTGTCAGTGAAGAGCATCC
 
. : . : . : . : . : . :
JMSF034P16+ CGACACAGAAGCATCCAACACAGAGCAAGATTGTTAATTTTCTTGAAACAACACTCTTTG
JMFF021G24+ CGACACAGAAGCATCCAACACAGAGCAAGATTGTTAATTTTCTTGAAACAACACTCTTTG
                      ____________________________________________________________
consensus CGACACAGAAGCATCCAACACAGAGCAAGATTGTTAATTTTCTTGAAACAACACTCTTTG
 
. : . : . : . : . : . :
JMSF034P16+ GGGTGGAATCAAATCCCCTGCTTTTCCAACCCATTTT
JMFF021G24+ GGGTGGAATCAAATCCCCTGCTTTTCCAACCCATTTTTCTCTTCTTCTTCTTCTTCTCTG
                      ____________________________________________________________
consensus GGGTGGAATCAAATCCCCTGCTTTTCCAACCCATTTTTCTCTTCTTCTTCTTCTTCTCTG
 
. : . : . : . : . : . :
JMFF021G24+ CTCGAAACCAATCAGAATTCAAATTCAAGGAATACCCATCTCAGTTCCCAAGCCAACCTA
                      ____________________________________________________________
consensus CTCGAAACCAATCAGAATTCAAATTCAAGGAATACCCATCTCAGTTCCCAAGCCAACCTA
 
. : . : . : . : . : . :
JMFF021G24+ GCTCAAGAACCAGATTCAGAGTTCCAAGACTAGATTTTTCACTACAAAATTCAAAAACAG
                      ____________________________________________________________
consensus GCTCAAGAACCAGATTCAGAGTTCCAAGACTAGATTTTTCACTACAAAATTCAAAAACAG
 
. : . : . : . : . : . :
JMFF021G24+ AATGAGAAGAAGGTGGTATTGGGGTATTGGTGGTTTGTGGAATTTGAGGACAAGACGACT
                      ____________________________________________________________
consensus AATGAGAAGAAGGTGGTATTGGGGTATTGGTGGTTTGTGGAATTTGAGGACAAGACGACT
 
. : . : . : . : . : . :
JMFF021G24+ CAATTTGCCACCCACCCAAATGGATTCCAACTGAACACCAGGTAGGCTCAAGAGTCAACC
                      ____________________________________________________________
consensus CAATTTGCCACCCACCCAAATGGATTCCAACTGAACACCAGGTAGGCTCAAGAGTCAACC