Previous Contig 001072:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF021F06Sequence538001072 (2)gb:AC019018_15385042e-49Arabidopsis thaliana chromosome 1 BAC F14G24 genomic sequence, complete sequence674009209 (2)gb:AC019018_15385042e-47Arabidopsis thaliana chromosome 1 BAC F14G24 genomic sequence, complete sequence
JMSF031M01Sequence626001072 (2)gb:AC019018_15385047e-64Arabidopsis thaliana chromosome 1 BAC F14G24 genomic sequence, complete sequence675009209 (2)gb:AC019018_15385048e-53Arabidopsis thaliana chromosome 1 BAC F14G24 genomic sequence, complete sequence

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF031M01+ CTGGGTTGCTTGCACCAAACTTCTCCTCAAAAGCATCTTGAGAAACATCAG
                      ____________________________________________________________
consensus CTGGGTTGCTTGCACCAAACTTCTCCTCAAAAGCATCTTGAGAAACATCAG
 
. : . : . : . : . : . :
JMSF031M01+ CTTTCTTTGCAAGCGACTCATAATCTGATGCCATAAGCTTTGGGCGTTTCCTCTTCCTTT
                      ____________________________________________________________
consensus CTTTCTTTGCAAGCGACTCATAATCTGATGCCATAAGCTTTGGGCGTTTCCTCTTCCTTT
 
. : . : . : . : . : . :
JMSF031M01+ TAGGACCAAAGGCATCAGCAAAAGGCTCGGTGTCAAGCAGGTGAGCTCTTGCTTGCTTTT
JMFF021F06+ GGACCAAAGGCATCAGCAAAAGGCTCGGTGTCAAGCAGGTGAGCTCTTGCTTGCTTTT
                      ____________________________________________________________
consensus TAGGACCAAAGGCATCAGCAAAAGGCTCGGTGTCAAGCAGGTGAGCTCTTGCTTGCTTTT
 
. : . : . : . : . : . :
JMSF031M01+ GATGATCATTTAAAAGAGACAATGGCAATTTTCTGTCCTTCAAAATTACATTGTAGCTAC
JMFF021F06+ GATGATCATTTAAAAGAGACAATGGCAATTTTCTGTCCTTCAAAATTACATTGTAGCTAC
                      ____________________________________________________________
consensus GATGATCATTTAAAAGAGACAATGGCAATTTTCTGTCCTTCAAAATTACATTGTAGCTAC
 
. : . : . : . : . : . :
JMSF031M01+ TGGACATCCGACTTTGTAGCTCTTCACGGAAGAATTCTAGCTCTTTCTGATTAACTACTC
JMFF021F06+ TGGACATCCGACTTTGTAGCTCTTCACGGAAGAATTCTAGCTCTTTCTGATTAACTACTC
                      ____________________________________________________________
consensus TGGACATCCGACTTTGTAGCTCTTCACGGAAGAATTCTAGCTCTTTCTGATTAACTACTC
 
. : . : . : . : . : . :
JMSF031M01+ GTGTATTGCCGAACCATCGGCGATCGGGTTGAATCCGAGTGGAGGGTAGCTCCTTGGATT
JMFF021F06+ GTGTATTGCCGAACCATCGGCGATCGGGTTGAATCCGAGTGGAGGGTAGCTCCTTGGATT
                      ____________________________________________________________
consensus GTGTATTGCCGAACCATCGGCGATCGGGTTGAATCCGAGTGGAGGGTAGCTCCTTGGATT
 
. : . : . : . : . : . :
JMSF031M01+ GCAAGTCGTGTTTTACGACCTTTCCCCTAGTATCACGCTTAGGTCTCGTATTGTACATCT
JMFF021F06+ GCAAGTCGTGTTTTACGACCTTTCCCCTAGTATCACGCTTAGGTCTCGTATTGTACATCT
                      ____________________________________________________________
consensus GCAAGTCGTGTTTTACGACCTTTCCCCTAGTATCACGCTTAGGTCTCGTATTGTACATCT
 
. : . : . : . : . : . :
JMSF031M01+ TAAGCCGCCGCACAGTGGCGGCGCTACGGCCGCCTTTACTTCCGCTGCCATCTCTATTGC
JMFF021F06+ TAAGCCGCCGCACAGTGGCGGCGCTACGGCCGCCTTTACTTCCGCTGCCATCTCTATTGC
                      ____________________________________________________________
consensus TAAGCCGCCGCACAGTGGCGGCGCTACGGCCGCCTTTACTTCCGCTGCCATCTCTATTGC
 
. : . : . : . : . : . :
JMSF031M01+ TATCAAGGGAATGCTTAGGCTTTCCGGATACGTTCACCGACTTCTCATTCTTCTTCGCCA
JMFF021F06+ TATCAAGGGAATGCTTAGGCTTTCCGGATACGTTCACCGACTTCTCATTCTTCTTCGCCA
                      ____________________________________________________________
consensus TATCAAGGGAATGCTTAGGCTTTCCGGATACGTTCACCGACTTCTCATTCTTCTTCGCCA
 
. : . : . : . : . : . :
JMSF031M01+ TGGTTGTATTAGTCTATGATGCTTGGACAAAATAATAGGGGTTTGGAGGCGGGAGAGAAA
JMFF021F06+ TGGTTGTATTAGTCTATGATGCTTGGACAAAATAATAGGGGTTTGGAGGCGGGAGAGAAA
                      ____________________________________________________________
consensus TGGTTGTATTAGTCTATGATGCTTGGACAAAATAATAGGGGTTTGGAGGCGGGAGAGAAA
 
. : . : . : . : . : . :
JMSF031M01+ CCCTAACAGATAGAGAAAGAAAGATATGGAGGGT
JMFF021F06+ CCCTAACAGATAGAGAAAGAAAGATATGGAGGGTGTGTTTGCCTGTTGGGTTCACCGCTC
                      ____________________________________________________________
consensus CCCTAACAGATAGAGAAAGAAAGATATGGAGGGTGTGTTTGCCTGTTGGGTTCACCGCTC