Previous Contig 001070:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF021E07Sequence548001070 (2)pir|T04029|T040293e-39hypothetical protein F17A8.160 - Arabidopsis thaliana>gb:ATCHRIV27_1544695 Arabi731009202 (3)pir|A86464|A864648e-62hypothetical protein F12G12.16 - Arabidopsis thaliana>gb:AE005172_892205 Arabido
JMFN037C08Sequence617001070 (2)pir|T04029|T040295e-67hypothetical protein F17A8.160 - Arabidopsis thaliana>gb:ATCHRIV27_1544695 Arabi

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN037C08+ GCAGACAGCAACACCTAATAGTACCAAAGAAATGC
                      ____________________________________________________________
consensus GCAGACAGCAACACCTAATAGTACCAAAGAAATGC
 
. : . : . : . : . : . :
JMFN037C08+ TGAGCTTGGTGTCTCTTGAATATCGAATCTTGTCAAATACAACTTCCAGCAAGCAGGATA
                      ____________________________________________________________
consensus TGAGCTTGGTGTCTCTTGAATATCGAATCTTGTCAAATACAACTTCCAGCAAGCAGGATA
 
. : . : . : . : . : . :
JMFN037C08+ CAGGGATCATGCTCAACTTTGCAATCTGGTAGAAGCCTACTGAATTCCACATCAAACTGA
JMFF021E07+ CAAACTGA
                      ____________________________________________________________
consensus CAGGGATCATGCTCAACTTTGCAATCTGGTAGAAGCCTACTGAATTCCACATCAAACTGA
 
. : . : . : . : . : . :
JMFN037C08+ CATTCATCCCAACTATAGAGAAGTTTGCAAATAGCACAAATTTCAGAAGGTCTGCAATGG
JMFF021E07+ CATTCATCCCAACTATAGAGAAGTTTGCAAATAGCACAAATTTCAGAAGGTCTGCAATGG
                      ____________________________________________________________
consensus CATTCATCCCAACTATAGAGAAGTTTGCAAATAGCACAAATTTCAGAAGGTCTGCAATGG
 
. : . : . : . : . : . :
JMFN037C08+ GTAGGTGGGAAGTTTGGATGTATCCAAGCCATCTAAGAACACCCGTCATCAAGGTGGTTG
JMFF021E07+ GTAGGTGGGAAGTTTGGATGTATCCAAGCCATNTAAGAACACCCGTCATCAAGGTGGTTG
                      ____________________________________________________________
consensus GTAGGTGGGAAGTTTGGATGTATCCAAGCCATCTAAGAACACCCGTCATCAAGGTGGTTG
 
. : . : . : . : . : . :
JMFN037C08+ TAGCAAAATGCATACCAGTCAATGTTGTAGCAAAGCTGAAGCCATATGTAGCCATTAATG
JMFF021E07+ TAGCAAAATGCATACCAGTCAATGTTGTAGCAAAGCTGAAGCCATATGTAGCCATTAATG
                      ____________________________________________________________
consensus TAGCAAAATGCATACCAGTCAATGTTGTAGCAAAGCTGAAGCCATATGTAGCCATTAATG
 
. : . : . : . : . : . :
JMFN037C08+ CCTTATTGACAATTATAATTCCAACAGAAGTGACCACATTGAACATCCATGCAGCTGCAT
JMFF021E07+ CCTTATTGACAATTATAATTCCAACAGAAGTGACCACATTGAACATCCATGCAGCTGCAT
                      ____________________________________________________________
consensus CCTTATTGACAATTATAATTCCAACAGAAGTGACCACATTGAACATCCATGCAGCTGCAT
 
. : . : . : . : . : . :
JMFN037C08+ CAATTGAAGCCTTCTTCTCAGCCTTGTTTGCAGGAGCC
JMFF021E07+ CAATTGAAGCCTTCTTCTCAGCCTTGTTTGCAGGAGCCATTTTCCTTTATTTCTGTACAA
                      ____________________________________________________________
consensus CAATTGAAGCCTTCTTCTCAGCCTTGTTTGCAGGAGCCATTTTCCTTTATTTCTGTACAA
 
. : . : . : . : . : . :
JMFF021E07+ TCCCTCAGTCTTTTACTCCTCAAATACCATACAGATTTTCACATTTATGTGCTCAAACAA
                      ____________________________________________________________
consensus TCCCTCAGTCTTTTACTCCTCAAATACCATACAGATTTTCACATTTATGTGCTCAAACAA
 
. : . : . : . : . : . :
JMFF021E07+ GGATCTTTTCTTAACTTTCCCACTCAAACTCCCGTTTGGTAATTAACGAGAATGAAAGAG
                      ____________________________________________________________
consensus GGATCTTTTCTTAACTTTCCCACTCAAACTCCCGTTTGGTAATTAACGAGAATGAAAGAG
 
. : . : . : . : . : . :
JMFF021E07+ ACCTCCCAGAAAGTGAAGAATTTAGATCTTCACAGCACCATCCCTCTCTCTCTCTCTCTC
                      ____________________________________________________________
consensus ACCTCCCAGAAAGTGAAGAATTTAGATCTTCACAGCACCATCCCTCTCTCTCTCTCTCTC
 
. : . : . : . : . : . :
JMFF021E07+ TGTCTCTCTCTCTCTCTCTTTCTCTCTCTTTATCTCGCTTTCTCTGTCCAAAGCACAGTT
                      ____________________________________________________________
consensus TGTCTCTCTCTCTCTCTCTTTCTCTCTCTTTATCTCGCTTTCTCTGTCCAAAGCACAGTT