Previous Contig 001064:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF002M08Sequence564001064 (48)gb:AJ849378_18147513e-66Lycopersicon esculentum mRNA for formate dehydrogenase (fdh gene).810001064 (48)pir|JQ2272|JQ2272e-110formate dehydrogenase (EC 1.2.1.2) precursor, mitochondrial - potato
JMFF006N03Sequence574001064 (48)gb:AJ849378_18147513e-75Lycopersicon esculentum mRNA for formate dehydrogenase (fdh gene).808001064 (48)pir|JQ2272|JQ2272e-110formate dehydrogenase (EC 1.2.1.2) precursor, mitochondrial - potato
JMFF008E23Sequence625001064 (48)gb:AJ849378_18147512e-78Lycopersicon esculentum mRNA for formate dehydrogenase (fdh gene).711001064 (48)pir|JQ2272|JQ22723e-97formate dehydrogenase (EC 1.2.1.2) precursor, mitochondrial - potato
JMFF010N01Sequence579001064 (48)gb:QRO577266_17032103e-70Quercus robur mRNA for formate dehydrogenase (ORF1).700001064 (48)pir|JQ2272|JQ22722e-93formate dehydrogenase (EC 1.2.1.2) precursor, mitochondrial - potato
JMFF012L18Sequence507001064 (48)gb:AJ849378_18147518e-62Lycopersicon esculentum mRNA for formate dehydrogenase (fdh gene).697001064 (48)pir|JQ2272|JQ22724e-93formate dehydrogenase (EC 1.2.1.2) precursor, mitochondrial - potato
JMFF013K05Sequence507001064 (48)gb:AJ849378_18147518e-62Lycopersicon esculentum mRNA for formate dehydrogenase (fdh gene).147001064 (48)pir|JQ2272|JQ22721e-22formate dehydrogenase (EC 1.2.1.2) precursor, mitochondrial - potato
JMFF016B07Sequence564001064 (48)gb:AJ849378_18147511e-72Lycopersicon esculentum mRNA for formate dehydrogenase (fdh gene).644001064 (48)pir|JQ2272|JQ22721e-82formate dehydrogenase (EC 1.2.1.2) precursor, mitochondrial - potato
JMFF020E01Sequence559001064 (48)gb:AJ849378_18147517e-72Lycopersicon esculentum mRNA for formate dehydrogenase (fdh gene).763001064 (48)pir|JQ2272|JQ22722e-98formate dehydrogenase (EC 1.2.1.2) precursor, mitochondrial - potato
JMFF021C15Sequence548001064 (48)gb:QRO577266_17032101e-60Quercus robur mRNA for formate dehydrogenase (ORF1).646001064 (48)pir|JQ2272|JQ22722e-79formate dehydrogenase (EC 1.2.1.2) precursor, mitochondrial - potato
JMFF024K17Sequence504001064 (48)gb:AJ849378_18147512e-61Lycopersicon esculentum mRNA for formate dehydrogenase (fdh gene).686001064 (48)pir|JQ2272|JQ22722e-91formate dehydrogenase (EC 1.2.1.2) precursor, mitochondrial - potato
JMFF026E03Sequence574001064 (48)gb:AJ849378_18147511e-77Lycopersicon esculentum mRNA for formate dehydrogenase (fdh gene).768001064 (48)pir|JQ2272|JQ22723e-99formate dehydrogenase (EC 1.2.1.2) precursor, mitochondrial - potato
JMFF029C07Sequence428001064 (48)gb:QRO577266_17032109e-45Quercus robur mRNA for formate dehydrogenase (ORF1).739001064 (48)pir|JQ2272|JQ22726e-98formate dehydrogenase (EC 1.2.1.2) precursor, mitochondrial - potato
JMFF030C09Sequence509001064 (48)gb:AJ849378_18147515e-57Lycopersicon esculentum mRNA for formate dehydrogenase (fdh gene).698001064 (48)pir|JQ2272|JQ22724e-92formate dehydrogenase (EC 1.2.1.2) precursor, mitochondrial - potato
JMFF031F02Sequence509001064 (48)gb:AJ849378_18147513e-65Lycopersicon esculentum mRNA for formate dehydrogenase (fdh gene).
JMFF033N20Sequence508001064 (48)gb:AJ849378_18147512e-62Lycopersicon esculentum mRNA for formate dehydrogenase (fdh gene).723001064 (48)pir|JQ2272|JQ22721e-95formate dehydrogenase (EC 1.2.1.2) precursor, mitochondrial - potato
JMFF036O10Sequence510001064 (48)gb:AJ849378_18147516e-62Lycopersicon esculentum mRNA for formate dehydrogenase (fdh gene).651011064 (7)pir|T06698|T066981e-25hypothetical protein T29H11.40 - Arabidopsis thaliana>gb:ATT29H11_1555656 Arabid
JMFF037D06Sequence566001064 (48)gb:QRO577266_17032106e-73Quercus robur mRNA for formate dehydrogenase (ORF1).
JMFF039J16Sequence570001064 (48)gb:QRO577266_17032107e-74Quercus robur mRNA for formate dehydrogenase (ORF1).649001064 (48)pir|JQ2272|JQ22721e-79formate dehydrogenase (EC 1.2.1.2) precursor, mitochondrial - potato
JMFF041E03Sequence646001064 (48)gb:AJ849378_18147514e-87Lycopersicon esculentum mRNA for formate dehydrogenase (fdh gene).574001064 (48)pir|JQ2272|JQ22721e-66formate dehydrogenase (EC 1.2.1.2) precursor, mitochondrial - potato
JMFF044O23Sequence640001064 (48)gb:AJ849378_18147511e-76Lycopersicon esculentum mRNA for formate dehydrogenase (fdh gene).597001064 (48)pir|JQ2272|JQ22724e-70formate dehydrogenase (EC 1.2.1.2) precursor, mitochondrial - potato
JMFF045D08Sequence602001064 (48)gb:AJ849378_18147511e-79Lycopersicon esculentum mRNA for formate dehydrogenase (fdh gene).398001064 (48)pir|JQ2272|JQ22723e-48formate dehydrogenase (EC 1.2.1.2) precursor, mitochondrial - potato
JMFF045H18Sequence591001064 (48)gb:QRO577266_17032106e-68Quercus robur mRNA for formate dehydrogenase (ORF1).511001064 (48)pir|JQ2272|JQ22723e-55formate dehydrogenase (EC 1.2.1.2) precursor, mitochondrial - potato
JMFF045M14Sequence655001064 (48)pir|JQ2272|JQ2272e-112formate dehydrogenase (EC 1.2.1.2) precursor, mitochondrial - potato616001064 (48)pir|JQ2272|JQ22724e-74formate dehydrogenase (EC 1.2.1.2) precursor, mitochondrial - potato
JMFF051D20Sequence569001064 (48)gb:QRO577266_17032107e-74Quercus robur mRNA for formate dehydrogenase (ORF1).559011064 (7)gb:BT020223_16426181e-10Arabidopsis thaliana At5g63260 mRNA, complete cds.>gb:BT020443_1642838 Arabidops
JMFN014A01Sequence627001064 (48)gb:AJ849378_18147513e-88Lycopersicon esculentum mRNA for formate dehydrogenase (fdh gene).
JMFN018K09Sequence533001064 (48)pir|JQ2272|JQ22722e-62formate dehydrogenase (EC 1.2.1.2) precursor, mitochondrial - potato
JMSF016O10Sequence332001064 (48)gb:QRO577266_17032102e-33Quercus robur mRNA for formate dehydrogenase (ORF1).736001064 (48)pir|JQ2272|JQ2272e-103formate dehydrogenase (EC 1.2.1.2) precursor, mitochondrial - potato

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF020E01- ATTTGATTT
rJMFF026E03- AATTTGATTT
                      ____________________________________________________________
consensus AATTTGATTT
 
. : . : . : . : . : . :
rJMFF045M14- GGCCATCCAGAACATTTTGGGTAATAATTTAATTTCAAGAGATCACAAAGATGGGATTGA
rJMFF044O23- GGCCATCCAGAACATTTTGGGTAATAATTTAATTTCAAGAGATCACAAAGATGGGATTGA
rJMFF041E03- GGCCATCCAGAACATTTTGGGTAATAATTTAATTTCAAGAGATCACAAAGATGGGATTGA
rJMFF045H18- GGCCATCCAGAACATTTTGGGTAATAATTTAATTTCAAGAGATCACAAAGATGGGATTGA
rJMFF020E01- GGCCATCCAGAACATTTTGGGTAATAATTTAATTTCAAGAGATCACAAAGATGGGATTGA
rJMFF026E03- GGCCATCCAGAACATTTTGGGTAATAATTTAATTTCAAGAGATCACAAAGATGGGATTGA
rJMFF006N03- TTTTGGGTAATAATTTAATTTCAAGAGATCACAAAGATGGGATTGA
rJMSF016O10- AAAGATGGGATTGA
rJMFF029C07- TTTTGGGTAATAATTTAATTTCAAGAGATCACAAAGATGGGATTGA
rJMFF033N20- ATAATTTAATTTCAAGAGATCACAAAGATGGGATTGA
rJMFF008E23- CACAAAGATGGGATTGA
rJMFF016B07- ATTTC-AGAGATCACAAAGATGGGATTGA
rJMFF010N01- ATTTAATTTC-AGAGATCACAAAGATGGGATTGA
rJMFF024K17- ATTTC-AGAGATCACAAAGATGGGATTGA
rJMFF012L18- ATTTC-AGAGATCACAAAGATGGGATTGA
rJMFF030C09- TGGGATTGA
rJMFF039J16- TTTTGGGTAATAATTTAATTTCAAGAGATCACAAAGATGGGATTGA
rJMFF021C15- ATAATTTAATTTC-AGAGATCACAAAGATGGGATTGA
JMFN018K09+ GGGTAATAATTTAATTTCAAGAGATCACAAAGATGGGATTGA
rJMFF002M08- TTTTGGGTAATAATTTAATTTCAAGAGATCACAAAGATGGGATTGA
                      ____________________________________________________________
consensus GGCCATCCAGAACATTTTGGGTAATAATTTAATTTCAAGAGATCACAAAGATGGGATTGA
 
. : . : . : . : . : . :
rJMFF045M14- AAGCCACAACAGAGAAATGTTCCTTTTCTCACATTACAAGTGTTCTGAATACACTGTAGA
rJMFF044O23- AAGCCACAACAGAGAAATGTTCCTTTTCTCACATTACAAGTGTTCTGAATACACTGTAGA
rJMFF041E03- AAGCCACAACAGAGAAATGTTCCTTTTCTCACATTACAAGTGTTCTGAATACACTGTAGA
rJMFF045H18- AAGCCACAACAGAGAAATGTTCCTTTTCTCACATTACAAGTGTTCTGAATACACTGTAGA
rJMFF020E01- AAGCCACAACAGAGAAATGTTCCTTTTCTCACATTACAAGTGTTCTGAATACACTGTAGA
rJMFF026E03- AAGCCACAACAGAGAAATGTTCCTTTTCTCACATTACAAGTGTTCTGAATACACTGTAGA
rJMFF006N03- AAGCCACAACAGAGAAATGTTCCTTTTCTCACATTACAAGTGTTCTGAATACACTGTAGA
rJMSF016O10- AAGCCACAACAGAGAAATGTTCCTTTTCTCACATTACAAGTGTTCTGAATACACTGTAGA
rJMFF029C07- AAGCCACAACAGAGAAATGTTCCTTTTCTCACATTACAAGTGTTCTGAATACACTGTAGA
rJMFF033N20- AAGCCACAACAGAGAAATGTTCCTTTTCTCACATTACAAGTGTTCTGAATACACTGTAGA
rJMFF008E23- AAGCCACAACAGAGAAATGTTCCTTTTCTCACATTACAAGTGTTCTGAATACACTGTAGA
rJMFF016B07- AAGCCACAACAGAGAAATGTTCCTTTTCTCACATTACAAGTGTTCTGAATACACTGTAGA
rJMFF010N01- AAGCCACAACAGAGAAATGTTCCTTTTCTCACATTACAAGTGTTCTGAATACACTGTAGA
rJMFF024K17- AAGCCACAACAGAGAAATGTTCCTTTTCTCACATTACAAGTGTTCTGAATACACTGTAGA
rJMFF045D08- AAATGTTCCTTTTCTCACATTACAAGTGTTCTGAATACACTGTAGA
rJMFF012L18- AAGCCACAACAGAGAAATGTTCCTTTTCTCACATTACAAGTGTTCTGAATACACTGTAGA
rJMFF030C09- AAGCCACAACAGAGAAATGTTCCTTTTCTCACATTACAAGTGTTCTGAATACACTGTAGA
rJMFF039J16- AAGCCACAACAGAGAAATGTTCCTTTTCTCACATTACAAGTGTTCTGAATACACTGTAGA
rJMFF021C15- AAGCCACAACAGAGAAATGTTCCTTTTCTCACATTACAAGTGTTCTGAATACACTGTAGA
JMFN018K09+ AAGCCACAACAGAGAAATGTTCCTTTTCTCACATTACAAGTGTTCTGAATACACTGTAGA
rJMFF002M08- AAGCCACAACAGAGAAATGTTCCTTTTCTCACATTACAAGTGTTCTGAATACACTGTAGA
                      ____________________________________________________________
consensus AAGCCACAACAGAGAAATGTTCCTTTTCTCACATTACAAGTGTTCTGAATACACTGTAGA
 
. : . : . : . : . : . :
rJMFF045M14- TAAGGGCCTATTTATTACTGACATTCTGAACAAAAACACCAACAACAACACAGCATCATG
rJMFF044O23- TAAGGGCCTATTTATTACTGACATTCTGAACAAAAACACCAACAACAACACAGCATCATG
rJMFF041E03- TAAGGGCCTATTTATTACTGACATTCTGAACAAAAACACCAACAACAACACAGCATCATG
rJMFF045H18- TAAGGGCCTATTTATTACTGACATTCTGAACAAAAACACCAACAACAACACAGCATCATG
rJMFF020E01- TAAGGGCCTATTTATTACTGACATTCTGAACAAAAACACCAACAACAACACAGCATCATG
rJMFF026E03- TAAGGGCCTATTTATTACTGACATTCTGAACAAAAACACCAACAACAACACAGCATCATG
rJMFF006N03- TAAGGGCCTATTTATTACTGACATTCTGAACAAAAACACCAACAACAACACAGCATCATG
rJMSF016O10- TAAGGGCCTATTTATTACTGACATTCTGAACAAAAACACCAACAACAACACAGCATCATG
rJMFF029C07- TAAGGGCCTATTTATTACTGACATTCTGAACAAAAACACCAACAACAACACAGCATCATG
rJMFF033N20- TAAGGGCCTATTTATTACTGACATTCTGAACAAAAACACCAACAACAACACAGCATCATG
rJMFF008E23- TAAGGGCCTATTTATTACTGACATTCTGAACAAAAACACCAACAACAACACAGCATCATG
rJMFF016B07- TAAGGGCCTATTTATTACTGACATTCTGAACAAAAACACCAACAACAACACAGCATCATG
rJMFF010N01- TAAGGGCCTATTTATTACTGACATTCTGAACAAAAACACCAACAACAACACAGCATCATG
rJMFF024K17- TAAGGGCCTATTTATTACTGACATTCTGAACAAAAACACCAACAACAACACAGCATCATG
rJMFF045D08- TAAGGGCCTATTTATTACTGACATTCTGAACAAAAACACCAACAACAACACAGCATCATG
rJMFF012L18- TAAGGGCCTATTTATTACTGACATTCTGAACAAAAACACCAACAACAACACAGCATCATG
rJMFF030C09- TAAGGGCCTATTTATTACTGACATTCTGAACAAAAACACCAACAACAACACAGCATCATG
rJMFF039J16- TAAGGGCCTATTTATTACTGACATTCTGAACAAAAACACCAACAACAACACAGCATCATG
rJMFF021C15- TAAGGGCCTATTTATTACTGACATTCTGAACAAAAACACCAACAACAACACAGCATCATG
JMFN018K09+ TAAGGGCCTATTTATTACTGACATTCTGAACAAAAACACCAACAACAACACAGCATCATG
rJMFF002M08- TAAGGGCCTATTTATTACTGACATTCTGAACAAAAACACCAACAACAACACAGCATCATG
                      ____________________________________________________________
consensus TAAGGGCCTATTTATTACTGACATTCTGAACAAAAACACCAACAACAACACAGCATCATG
 
. : . : . : . : . : . :
rJMFF045M14- CCGAAGCAGTTTAACGATACTGGCTCGCCAATTGCCCATCCTTTACAATGTAATTCTGGG
rJMFF044O23- CCGAAGCAGTTTAACGATACTGGCTCGCCAATTGCCCATCCTTTACAATGTAATTCTGGG
rJMFF041E03- CCGAAGCAGTTTAACGATACTGGCTCGCCAATTGCCCATCCTTTACAATGTAATTCTGGG
rJMFF045H18- CCGAAGCAGTTTAACGATACTGGCTCGCCAATTGCCCATCCTTTACAATGTAATTCTGGG
rJMFF020E01- CCGAAGCAGTTTAACGATACTGGCTCGCCAATTGCCCATCCTTTACAATGTAATTCTGGG
rJMFF026E03- CCGAAGCAGTTTAACGATACTGGCTCGCCAATTGCCCATCCTTTACAATGTAATTCTGGG
rJMFF006N03- CCGAAGCAGTTTAACGATACTGGCTCGCCAATTGCCCATCCTTTACAATGTAATTCTGGG
rJMSF016O10- CCGAAGCAGTTTAACGATACTGGCTCGCCAATTGCCCATCCTTTACAATGTAATTCTGGG
rJMFF029C07- CCGAAGCAGTTTAACGATACTGGCTCGCCAATTGCCCATCCTTTACAATGTAATTCTGGG
rJMFF033N20- CCGAAGCAGTTTAACGATACTGGCTCGCCAATTGCCCATCCTTTACAATGTAATTCTGGG
rJMFF008E23- CCGAAGCAGTTTAACGATACTGGCTCGCCAATTGCCCATCCTTTACAATGTAATTCTGGG
rJMFF016B07- CCGAAGCAGTTTAACGATACTGGCTCGCCAATTGCCCATCCTTTACAATGTAATTCTGGG
rJMFF010N01- CCGAAGCAGTTTAACGATACTGGCTCGCCAATTGCCCATCCTTTACAATGTAATTCTGGG
rJMFF024K17- CCGAAGCAGTTTAACGATACTGGCTCGCCAAATGCCCATCCTTTACAATGTAATTCTGGG
rJMFF045D08- CCGAAGCAGTTTAACGATACTGGCTCGCCAAATGCCCATCCTTTACAATGTAATTCTGGG
rJMFF012L18- CCGAAGCAGTTTAACGATACTGGCTCGCCAAATGCCCATCCTTTACAATGTAATTCTGGG
rJMFF030C09- CCGAAGCAGTTTAACGATACTGGCTCGCCAAATGCCCATCCTTTACAATGTAATTCTGGG
rJMFF039J16- CCGAAGCAGTTTAACGATACTGGCTCGCCAATTGCCCATCCTTTACAATGTAATTCTGGG
rJMFF021C15- CCGAAGCAGTTTAACGATACTGGCTCGCCAATTGCCCATCCTTTACAATGTAATTCTGGG
JMFN018K09+ CCGAAGCAGTTTAACGATACTGGCTCGCCAATTGCCCATCCTTTACAATGTAATTCTGGG
rJMFF002M08- CCGAAGCAGTTTAACGATACTGGCTCGCCAATTGCCCATCCTTTACAATGTAATTCTGGG
                      ____________________________________________________________
consensus CCGAAGCAGTTTAACGATACTGGCTCGCCAATTGCCCATCCTTTACAATGTAATTCTGGG
 
. : . : . : . : . : . :
rJMFF045M14- CAGGGAATTCTTCACCCTTGAAATACCTGTCCAGCATGTCCTTAGTTCCTGCAGCATACC
rJMFF044O23- CAGGGAATTCTTCACCCTTGAAATACCTGTCCAGCATGTCCTTAGTTCCTGCAGCATACC
rJMFF041E03- CAGGGAATTCTTCACCCTTGAAATACCTGTCCAGCATGTCCTTAGTTCCTGCAGCATACC
rJMFF045H18- CAGGGAATTCTTCACCCTTGAAATACCTGTCCAGCATGTCCTTAGTTCCTGCAGCATACC
rJMFF020E01- CAGGGAATTCTTCACCCTTGAAATACCTGTCCAGCATGTCCTTAGTTCCTGCAGCATACC
rJMFF026E03- CAGGGAATTCTTCACCCTTGAAATACCTGTCCAGCATGTCCTTAGTTCCTGCAGCATACC
rJMFF006N03- CAGGGAATTCTTCACCCTTGAAATACCTGTCCAGCATGTCCTTAGTTCCTGCAGCATACC
rJMSF016O10- CAGGGAATTCTTCACCCTTGAAATACCTGTCCAGCATGTCCTTAGTTCCTGCAGCATACC
rJMFF029C07- CAGGGAATTCTTCACCCTTGAAATACCTGTCCAGCATGTCCTTAGTTCCTGCAGCATACC
rJMFF033N20- CAGGGAATTCTTCACCCTTGAAATACCTGTCCAGCATGTCCTTAGTTCCTGCAGCATACC
rJMFF008E23- CAGGGAATTCTTCACCCTTGAAATACCTGTCCAGCATGTCCTTAGTTCCTGCAGCATACC
rJMFF016B07- CAGGGAATTCTTCACCCTTGAAATACCTGTCCAGCATGTCCTTAGTTCCTGCAGCATACC
rJMFF010N01- CAGGGAATTCTTCACCCTTGAAATACCTGTCCAGCATGTCCTTAGTTCCTGCAGCATACC
rJMFF024K17- CAGGGAATTCTTCACCCTTGAAATACCTGTCCAGCATGTCCTTAGTTCCTGCAGCATACC
rJMFF045D08- CAGGGAATTCTTCACCCTTGAAATACCTGTCCAGCATGTCCTTAGTTCCTGCAGCATACC
rJMFF012L18- CAGGGAATTCTTCACCCTTGAAATACCTGTCCAGCATGTCCTTAGTTCCTGCAGCATACC
rJMFF030C09- CAGGGAATTCTTCACCCTTGAAATACCTGTCCAGCATGTCCTTAGTTCCTGCAGCATACC
rJMFF039J16- CAGGGAATTCTTCACCCTTGAAATACCTGTCCAGCATGTCCTTAGTTCCTGCAGCATACC
rJMFF021C15- CAGGGAATTCTTCACCCTTGAAATACCTGTCCAGCATGTCCTTAGTTCCTGCAGCATACC
rJMFF013K05- GGAATTCTTCACCCTTGAAATACCTGTCCAGCATGTCCTTAGTTCCTGCAGCATACC
JMFN018K09+ CAGGGAATTCTTCACCCTTGAAATACCTGTCCAGCATGTCCTTAGTTCCTGCAGCATACC
rJMFF002M08- CAGGGAATTCTTCACCCTTGAAATACCTGTCCAGCATGTCCTTAGTTCCTGCAGCATACC
JMFF045M14+ TGTCCAGCATGTCCTAGTTTCNTGCAGCATACC
                      ____________________________________________________________
consensus CAGGGAATTCTTCACCCTTGAAATACCTGTCCAGCATGTCCTTAGTTCCTGCAGCATACC
 
. : . : . : . : . : . :
rJMFF045M14- GCAGCTGTGCATCAATGGTCGTCCCGGAAATATGGGGCGTCATGGCTTGATTTGGCATGT
rJMFF044O23- GCAGCTGTGCATCAATGGTCGTCCCGGAAATATGGGGCGTCATGGCTTGATTTGGCATGT
rJMFF041E03- GCAGCTGTGCATCAATGGTCGTCCCGGAAATATGGGGCGTCATGGCTTGATTTGGCATGT
rJMFF045H18- GCAGCTGTGCATCAATGGTCGTCCCGGAAATATGGGGCGTCATGGCTTGATTTGGCATGT
rJMFF020E01- GCAGCTGTGCATCAATGGTCGTCCCGGAAATATGGGGCGTCATGGCTTGATTTGGCATGT
rJMFF026E03- GCAGCTGTGCATCAATGGTCGTCCCGGAAATATGGGGCGTCATGGCTTGATTTGGCATGT
rJMFF006N03- GCAGCTGTGCATCAATGGTCGTCCCGGAAATATGGGGCGTCATGGCTTGATTTGGCATGT
rJMSF016O10- GCAGCTGTGCATCAATGGTCGTCCCGGAAATATGGGGCGTCATGGCTTGATTTGGCATGT
rJMFF029C07- GCAGCTGTGCATCAATGGTCGTCCCGGAAATATGGGGCGTCATGGCTTGATTTGGCATGT
rJMFF033N20- GCAGCTGTGCATCAATGGTCGTCCCGGAAATATGGGGCGTCATGGCTTGATTTGGCATGT
rJMFF008E23- GCAGCTGTGCATCAATGGTCGTCCCGGAAATATGGGGCGTCATGGCTTGATTTGGCATGT
rJMFF016B07- GCAGCTGTGCATCAATGGTCGTCCCGGAAATATGGGGCGTCATGGCTTGATTTGGCATGT
rJMFF010N01- GCAGCTGTGCATCAATGGTCGTCCCGGAAATATGGGGCGTCATGGCTTGATTTGGCATGT
rJMFF024K17- GCAGCTGTGCATCAATGGTCGTCCCGGAAATATGGGGCGTCATGGCTTGATTTGGCATGT
rJMFF045D08- GCAGCTGTGCATCAATGGTCGTCCCGGAAATATGGGGCGTCATGGCTTGATTTGGCATGT
rJMFF012L18- GCAGCTGTGCATCAATGGTCGTCCCGGAAATATGGGGCGTCATGGCTTGATTTGGCATGT
rJMFF030C09- GCAGCTGTGCATCAATGGTCGTCCCGGAAATATGGGGCGTCATGGCTTGATTTGGCATGT
rJMFF039J16- GCAGCTGTGCATCAATGGTCGTCCCGGAAATATGGGGCGTCATGGCTTGATTTGGCATGT
rJMFF021C15- GCAGCTGTGCATCAATGGTCGTCCCGGAAATATGGGGCGTCATGGCTTGATTTGGCATGT
rJMFF013K05- GCAGCTGTGCATCAATGGTCGTCCCGGAAATATGGGGCGTCATGGCTTGATTTGGCATGT
JMFN018K09+ GCAGCTGTGCATCAATGGTCGTCCCGGAAATATGGGGCGTCATGGCTTGATTTGGCATGT
rJMFF002M08- GCAGCTGTGCATCAATGGTCGTCCCGGAAATATGGGGCGTCATGGCTTGATTTGGCATGT
JMFF045M14+ GCAGCTGTGCATCAATGGTCGTCCCGGAAATATGGGGCGTCATGGCTTGATTTGGCATGT
                      ____________________________________________________________
consensus GCAGCTGTGCATCAATGGTCGTCCCGGAAATATGGGGCGTCATGGCTTGATTTGGCATGT
 
. : . : . : . : . : . :
rJMFF045M14- ATCGCCATGGATGGTCCTTGGGAGCTGGTTGTGGGTACCAAACGTCGCCACTGTAGCCTG
rJMFF044O23- ATCGCCATGGATGGTCCTTGGGAGCTGGTTGTGGGTACCAAACGTCGCCACTGTAGCCTG
rJMFF041E03- ATCGCCATGGATGGTCCTTGGGAGCTGGTTGTGGGTACCAAACGTCGCCACTGTAGCCTG
rJMFF045H18- ATCGCCATGGATGGTCCTTGGGAGCTGGTTGTGGGTACCAAACGTCGCCACTGTAGCCTG
rJMFF020E01- ATCGCCATGGATGGTCCTTGGGAGCTGGTTGTGGGTACCAAACGTCGCCACTGTAGCCTG
rJMFF026E03- ATCGCCATGGATGGTCCTTGGGAGCTGGTTGTGGGTACCAAACGTCGCCACTGTAGCCTG
rJMFF006N03- ATCGCCATGGATGGTCCTTGGGAGCTGGTTGTGGGTACCAAACGTCGCCACTGTAGCCTG
rJMSF016O10- ATCGCCATGGATGGTCCTTGGGAGCTGGTTGTGGGTACCAAACGTCGCCACTGTAGCCTG
rJMFF029C07- ATCGCCATGGATGGTCCTTGGGAGCTGGTTGTGGGTACCAAACGTCGCCACTGTAGCCTG
rJMFF033N20- ATCGCCATGGATGGTCCTTGGGAGCTGGTTGTGGGTACCAAACGTCGCCACTGTAGCCTG
rJMFF008E23- ATCGCCATGGATGGTCCTTGGGAGCTGGTTGTGGGTACCAAACGTCGCCACTGTAGCCTG
rJMFF016B07- ATCGCCATGGATGGTCCTTGGGAGCTGGTTGTGGGTACCAAACGTCGCCACTGTAGCCTG
rJMFF010N01- ATCGCCATGGATGGTCCTTGGGAGCTGGTTGTGGGTACCAAACGTCGCCACTGTAGCCTG
rJMFF024K17- ATCGCCATGGATGGTCCTTGGGAGCTGGTTGTGGGTACCAAACGTCGCCACTGTAGCCTG
rJMFF045D08- ATCGCCATGGATGGTCCTTGGGAGCTGGTTGTGGGTACCAAACGTCGCCACTGTAGCCTG
rJMFF012L18- ATCGCCATGGATGGTCCTTGGGAGCTGGTTGTGGGTACCAAACGTCGCCACTGTAGCCTG
rJMFF030C09- ATCGCCATGGATGGTCCTTGGGAGCTGGTTGTGGGTACCAAACGTCGCCACTGTAGCCTG
rJMFF039J16- ATCGCCATGGATGGTCCTTGGGAGCTGGTTGTGGGTACCAAACGTCGCCACTGTAGCCTG
rJMFF021C15- ATCGCCATGGATGGTCCTTGGGAGCTGGTTGTGGGTACCAAACGTCGCCACTGTAGCCTG
rJMFF013K05- ATCGCCATGGATGGTCCTTGGGAGCTGGTT
JMFN018K09+ ATCGCCATGGATGGTCCTTGGGAGCTGGTTGTGGGTACCAAACGTCGCCACTGTAGCCTG
rJMFF002M08- ATCGCCATGGATGGTCCTTGGGAGCTGGTTGTGGGTACCAAACGTCGCCACTGTAGCCTG
JMFF045M14+ ATCGCCATGGATGGTCCTTGGGAGCTGGTTGTGGGTACCAAACGTCGCCACTGTAGCCTG
                      ____________________________________________________________
consensus ATCGCCATGGATGGTCCTTGGGAGCTGGTTGTGGGTACCAAACGTCGCCACTGTAGCCTG
 
. : . : . : . : . : . :
rJMFF045M14- CAATGTGTCCACTGGAACAAGCGTCAGCAACTGCTTGAGTGTCCATGATTGCGCCCCGAG
rJMFF044O23- CAATGTGTCCACTGGAACAAGCGTCAGCAACTGCTTGAGTGTCCATGATTGCGCCCCGAG
rJMFF041E03- CAATGTGTCCACTGGAACAAGCGTCAGCAACTGCTTGAGTGTCCATGATTGCGCCCCGAG
rJMFF045H18- CAATGTGTCCACTGGAACAAGCGTCAGCAACTGCTTGAGTGTCCATGATTGCGCCCCGAG
rJMFF020E01- CAATGTGTCCACTGGAACAAGCGTCAGCAACTGCTTGAGTGTCCATGATTGCGCCCCGAG
rJMFF026E03- CAATGTGTCCACTGGAACAAGCGTCAGCAACTGCTTGAGTGTCCATGATTGCGCCCCGAG
rJMFF006N03- CAATGTGTCCACTGGAACAAGCGTCAGCAACTGCTTGAGTGTCCATGATTGCGCCCCGAG
rJMSF016O10- CAATGTGTCCACTGGAACAAGCGTCAGCAACTGCTTGAGTGTCCATGATTGCGCCCCGAG
rJMFF029C07- CAATGTGTCCACTGGAACAAGCGTCAGCAACTGCTTGAGTGTCCATGATTGCGCCCCGAG
rJMFF033N20- CAATGTGTCCACTGGAACAAGCGTCAGCAACTGCTTGAGTGTCCATGATTGCGCCCCGAG
rJMFF008E23- CAATGTGTCCACTGGAACAAGCGTCAGCAACTGCTTGAGTGTCCATGATTGCGCCCCGAG
rJMFF016B07- CAATGTGTCCACTGGAACAAGCGTCAGCAACTGCTTGAGTGTCCATGATTGCGCCCCGAG
rJMFF010N01- CAATGTGTCCACTGGAACAAGCGTCAGCAACTGCTTGAGTGTCCATGATTGCGCCCCGAG
rJMFF024K17- CAATGTGTCCACTGGAACAAGCGTCAGCAACTGCTTGAGTGTCCATGATTGCGCCCCGAG
rJMFF045D08- CAATGTGTCCACTGGAACAAGCGTCAGCAACTGCTTGAGTGTCCATGATTGC
rJMFF012L18- CAATGTGTCCACTGGAACAAGCGTCAGCAACTGCTTGAGTGTCCATGATTGCGCCCCGAG
rJMFF030C09- CAATGTGTCCACTGGAACAAGCGTCAGCAACTGCTTGAGTGTCCATGATTGCGCCCCGAG
rJMFF039J16- CAATGTGTCCACTGGAACAAGCGTCAGCAACTGCTTGAGTGTCCATGATTGCGCCCCGAG
rJMFF021C15- CAATGTGTCCACTGGAACAAGCGTCAGCAACTGCTTGAGTGTCCATGATTGCGCCCCGAG
JMFN018K09+ CAATGTGTCCACTGGAACAAGCGTCAGCAACTGCTTGAGTGTCCATGATTGCGCCCCGAG
rJMFF002M08- CAATGTGTCCACTGGAACAAGCGTCAGCAACTGCTTGAGTGTCCATGATTGCGCCCCGAG
JMFF045M14+ CAATGTGTCCACTGGAACAAGCGTCAGCAACTGCTTGAGTGTCCATGATTGCGCCCCGAG
                      ____________________________________________________________
consensus CAATGTGTCCACTGGAACAAGCGTCAGCAACTGCTTGAGTGTCCATGATTGCGCCCCGAG
 
. : . : . : . : . : . :
rJMFF045M14- CATTGTTCACCACTAACACTCCCTTCTTCATCTTAGCGATCCTGTTCTTGTCGAACATTC
rJMFF044O23- CATTGTTCACCACTAACACTCCCTTCTTCATCTTAGCGATCCTGTTCTTGTCGAACATTC
rJMFF041E03- CATTGTTCACCACTAACACTCCCTTCTTCATCTTAGCGATCCTGTTCTTGTCGAACATTC
rJMFF045H18- CATTGTTCACCACTAACACTCCCTTCTTCAT
rJMFF020E01- CATTGTTCACCACTAACACTCCCTTCTTCATCTTAGCGATCCTGTTCTTGTCGAACATTC
rJMFF026E03- CATTGTTCACCACTAACACTCCCTTCTTCATCTTAGCGATCCTGTTCTTGTCGAACATTC
rJMFF006N03- CATTGTTCACCACTAACACTCCCTTCTTCATCTTAGCGATCCTGTTCTTGTCGAACATTC
rJMSF016O10- CATTGTTCACCACTAACACTCCCTTCTTCATCTTAGCGATCCTGTTCTTGTCGAACATTC
rJMFF029C07- CATTGTTCACCACTAACACTCCCTTCTTCATCTTAGCGATCCTGTTCTTGTCGAACATTC
rJMFF033N20- CATTGTTCACCACTAACACTCCCTTCTTCATCTTAGCGATCCTGTTCTTGTCGAACATTC
rJMFF008E23- CATTGTTCACCACTAACACTCCCTTCTTCATCTTAGCGATCCTGTTCTTGTCGAACATTC
rJMFF016B07- CATTGTTCACCACTAACACTCCCTTCTTCATCTTAGCGATCCTGTTCTTGTCGAACATTC
rJMFF010N01- CATTGTTCACCACTAACACTCCCTTCTTCATCTTAGCGATCCTGTTCTTGTCGAACATTC
rJMFF024K17- CATTGTTCACCACTAACACTCCCTTCTTCATCTTAGCGATCCTGTTCTTGTCGAACATTC
rJMFF012L18- CATTGTTCACCACTAACACTCCCTTCTTCATCTTAGCGATCCTGTTCTTGTCGAACATTC
rJMFF030C09- CATTGTTCACCACTAACACTCCCTTCTTCATCTTAGCGATCCTGTTCTTGTCGAACATTC
rJMFF039J16- CATTGTTCACCACTAACACTCCCTTCTTCATCTTAGCGATCCTGTTCTTGTCGAACATTC
rJMFF021C15- CATTGTTCACCACTAACACTCCCTTCTTCATCTTAGCGATCCTGTTCTTGTCGAACATTC
JMFN018K09+ CATTGTTCACCACTAACACTCCCTTCTTCATCTTAGCGATCCTGTTCTTGTCGAACATTC
rJMFF002M08- CATTGTTCACCACTAACACTCCCTTCTTCATCTTAGCGATCCTGTTCTTGTCGAACATTC
JMFF045M14+ CATTGTTCACCACTAACACTCCCTTCTTCATCTTAGCGATCCTGTTCTTGTCGAACATTC
                      ____________________________________________________________
consensus CATTGTTCACCACTAACACTCCCTTCTTCATCTTAGCGATCCTGTTCTTGTCGAACATTC
 
. : . : . : . : . : . :
rJMFF045M14- CCTTTGTTTTGTCTGTTAGAGGGGTATTGATGACNACAATGTCGCATTTTGACAGCATAG
rJMFF044O23- CCTTTGTTTTGTCTGTTAGAGGGGTATTGATGACNACNATGTCGCATTTTGACAGCA
rJMFF041E03- CCTTTGTTTTGTCTGTTAGAGGGGTATTGATGAC
rJMFF020E01- CCTTTGTTTTGTCTGTTAGAGGGGTATTGATGACAACAATGTCGCATTTTGACAGCATAG
rJMFF026E03- CCTTTGTTTTGTCTGTTAGAGGGGTATTGATGACAACAATGTCGCATTTTGACAGCATAG
rJMFF006N03- CCTTTGTTTTGTCTGTTAGAGGGGTATTGATGACAACAATGTCGCATTTTGACAGCATAG
rJMSF016O10- CCTTTGTTTTGTCTGTTAGAGGGGTATTGATGACAACAATGTCGCATTTTGACAGCATAG
rJMFF029C07- CCTTTGTTTTGTCTGTTAGAGGGGTATTGATGACAACAATGTCGCATTTCGACAGCATAG
rJMFF033N20- CCTTTGTTTTGTCTGTTAGAGGGGTATTGATGACAACAATGTCGCATTTTGACAGCATAG
rJMFF008E23- CCTTTGTTTTGTCTGTTAGAGGGGTATTGATGACAACAATGTCGCATTTTGACAGCATAG
rJMFF016B07- CCTTTGTTTTGTCTGTTAGAGGGGTATTGATGACAACAATGTCGCATTTTGACAGCATAG
rJMFF010N01- CCTTTGTTTTGTCTGTTAGAGGGGTATTGATGACAACAATGTCGCATTTTGACAGCATAG
rJMFF024K17- CCTTTGTTTTGTCTGTTAGAGGGGTATTGATGACAACAATGTCGCATTTTGACAGCATAG
rJMFF012L18- CCTTTGTTTTGTCTGTTAGAGGGGTATTGATGACAACAATGTCGCATTTTGACAGCATAG
rJMFF030C09- CCTTTGTTTTGTCTGTTAGAGGGGTATTGATGACAACAATGTCGCATTTTGACAGCATAG
rJMFF039J16- CCTTTGTTTTGTCTGTTAGAGGGGTATTGATGACAACAATGTCGCATTTTGACAGCATAG
rJMFF021C15- CCTTTGTTTTGTCTGTTAGAGGGGTATTGATGACAACAATGTCGCATTTTGACAGCATAG
JMFN018K09+ CCTTTGTTTTG
rJMFF002M08- CCTTTGTTTTGTCTGTTAGAGGGGTATTGATGACAACAATGTCGCATTTTGACAGCATAG
JMFF045M14+ CCTTTGTTTTGTCTGTTAGAGGGGTATTGATGACAACAATGTCGCATTTTGACAGCATAG
                      ____________________________________________________________
consensus CCTTTGTTTTGTCTGTTAGAGGGGTATTGATGACAACAATGTCGCATTTTGACAGCATAG
 
. : . : . : . : . : . :
rJMFF045M14- TATCAAGGTCTTCCTC
rJMFF020E01- TATCAAGGTCTTCCTCGAATGTTGCCCCGATTTCCTTCTCCAATGCGGGATCCATCTTGA
rJMFF026E03- TATCAAGGTCTTCCTCGAATGTTGCCCCGATTTCCTTCTCCAATGCGGGATCCATCTTGA
rJMFF006N03- TATCAAGGTCTTCCTCGAATGTTGCCCCGATTTCCTTCTCCAATGCGGGATCCATCTTGA
rJMSF016O10- TATCAAGGTCTTCCTCGAATGTTGCCCCGATTTCCTTCTCCAATGCGGGATCCATCTTGA
rJMFF029C07- TATCAAGGTCTTCCTCGAATGTTGCCCCGATTTCCTTCTCCAATGCGGGATCCATCTTGA
rJMFF033N20- TATCAAGGTCTTCCTCGAATGTTGCCCCGATTTCCTTCTCCAATGCGGGATCCATCTTGA
rJMFF008E23- TATCAAGGTCTTCCTCGAATGTTGCCCCGATTTCCTTCTCCAATGCGGGATCCATCTTGA
rJMFF016B07- TATCAAGGTCTTCCTCGAATGTTGCCCCGATTTCCTTCTCCAATGCGGGATCCATCTTGA
rJMFF010N01- TATCAAGGTCTTCCTCGAATGTTGCCCCGATTTCCTTCTCCAATGCGGGATCCATCTTGA
rJMFF024K17- TATCAAGGTCTTCCTCGAATGTTGCCCCGATTTCCTTCTCCAATGCGGGATCCATCTTGA
rJMFF012L18- TATCAAGGTCTTCCTCGAATGTTGCCCCGATTTCCTTCTCCAATGCGGGATCCATCTTGA
rJMFF030C09- TATCAAGGTCTTCCTCGAATGTTGCCCCGATTTCCTTCTCCAATGCGGGATCCATCTTGA
rJMFF039J16- TATCAAGGTCTTCCTCGAATGTTGCCCCGATTTCCTTCTCCAATGCGGGATCCATCTTGA
rJMFF021C15- TATCAAGGTCTTCCTCGAATGTTGCCCCGACTTCCTTCTCCAATGCGGGATCCATCTTGA
rJMFF002M08- TATCAAGGTCTTCCTCGAATGTTGCCCCGATTTCCTTCTCCAATGCGGGATCCATCTTGA
JMFF045M14+ TATCAAGGTCTTCCTCGAATGTTGCCCCGATTTCCTTCTCCAATGCGGGATCCATCTTGA
                      ____________________________________________________________
consensus TATCAAGGTCTTCCTCGAATGTTGCCCCGATTTCCTTCTCCAATGCGGGATCCATCTTGA
 
. : . : . : . : . : . :
rJMFF020E01- GACGATCGTGGTACAGCAGATTGCAGTTGAAAGGCTTCAATCTCTGGAGT-AAAAGCCTC
rJMFF026E03- GACGATCGTGGTACAGCAGATTGCAGTTGAAAGGCTTCAATCTCTGGAGT-AAAAGCCTC
rJMFF006N03- GACGATCGTGGTACAGCAGATTGCAGTTGAAAGGCTTCAATCTCTGGAGT-AAAAGCCTC
rJMSF016O10- GACGATCGTGGTACAGCAGATTGCAGTTGAAAGGCTTCAATCTCTGGAGT-AAAAGCCTC
rJMFF029C07- GACGATCGTGGTACAGCAGATTGCAGTTGAAAGGCTTCAATCTCTGGAGT-AAAAGCCTC
rJMFF033N20- GACGATCGTGGTACAGCAGATTGCAGTTGAAAGGCTTCAATCTCTGGAGT-AAAAGCCTC
rJMFF008E23- GACGATCGTGGTACAGCAGATTGCAGTTGAAAGGCTTCAATCTCTGGAGT-AAAAGCCTC
rJMFF016B07- GACGATCGTGGTA
rJMFF010N01- GACGATCGTGGTACAGCAGATTGCAGTTGAAAGGCTTCAATCTCTGGAGT-AAAAGCCTC
rJMFF024K17- GACGATCGTGGTACAGCAGATTGCAGTTGAAAGGCTTCAATCTCTGGAGT-AAAAGCCT
rJMFF012L18- GACGATCGTGGTACAGCAGATTGCAGTTGAAAGGCTTCAATCTCTGGAGT-AAAAGCCTC
rJMFF030C09- GACGATCGTGGTACAGCAGATTGCAGTTGAAAGGCTTCAATCTCTGGAGTAAAAAGCCTC
rJMFF039J16- GAC
rJMFF021C15- GA
rJMFF002M08- GACGATCGTGGTACAGCAGATTGCAGTTGAAAGGCTTCAATCTCTGGAGT-AAAAGCCTC
JMFF045M14+ GACGATCGTGGTACAGCAGATTGCAGTTGAAAGGCTTCAATCTCTGGAGT-AAAAGCCTC
                      ____________________________________________________________
consensus GACGATCGTGGTACAGCAGATTGCAGTTGAAAGGCTTCAATCTCTGGAGT-AAAAGCCTC
 
. : . : . : . : . : . :
rJMFF020E01- CCAATTCGACCAGCCCCAACCGTCCCAACGGTTTT
rJMFF026E03- CCAATTCGACCAGCCCCAACCGTCCCAACGGTTTTCCCC
rJMFF006N03- CCTATTCGACCAGCCCCAACCGTCCCAACGGTTTTCCCCTCGAGATCATAAGCTCTGTAA
rJMSF016O10- CCAATTCGACCAGCCCCAACCGTCCCAACGGTTTTCCCCTCGAGATCATAAGCTCTGTAA
rJMFF029C07- CCAATTCGACCAGCCCCAACCGTCCCAACGGTTT
rJMFF033N20- CCAATTCGACCAGCCCCAAC
rJMFF008E23- CCAATTCNACCAGCCCCAACCGTCCCAACGG
rJMFF010N01- CCAATTCG
rJMFF012L18- CCAATTCGA
rJMFF030C09- CCAATTCGACCAGCCCCAACCGTCCCAAC
rJMFF002M08- CCAATTCGACCAGCCCCAACCGTCCCAACGGTTTTCCCCTCGAGATCATAAGCTCTGTAA
JMFF045M14+ CCAATTCGACCAGCCCCAACCGTCCCAACGGTTTTCCCCTCGAGATCATAAGCTCTGTAA
JMFN014A01+ CCCAACCGTCCCAACGGTTTTCCCCTCGAGATCATAAGCTCTGTAA
JMFF008E23+ CCCTCGAGATCATAAGCTCTGTAA
JMFF045D08+ GTAA
JMFF041E03+ CGTCCCAACGGTTTTCCCCTCGAGATCATAAGCTCTGTAA
JMFF044O23+ AGATCATAAGCTCTGTAA
                      ____________________________________________________________
consensus CCAATTCGACCAGCCCCAACCGTCCCAACGGTTTTCCCCTCGAGATCATAAGCTCTGTAA
 
. : . : . : . : . : . :
rJMFF006N03- GCAATTCCCGCAACATCCCACT-CCCCTTTGATGACCTGATGGT
rJMSF016O10- GCA
rJMFF002M08- GCAATTCCCGCAACATCCCACT-CCCCTTTGATGACCTGATGGT
JMFF045M14+ GCAATTCCCGCAACATCCCACT-CCCCTTTGATGACCTGATGGTACCCGGGCAGGAAGTT
JMFN014A01+ GCAATTCCCGCAACATCCCACT-CCCCTTTGATGACCTGATGGTACCCGGGCAGGAAGTT
JMFF008E23+ GCAATTCCCGCAACATCCCACTCCCCCTTTGATGACCTGATGGTACCCGGGCAGGAAGTT
JMFF045D08+ GCAATTCCCGCAACATCCCACT-CCCCTTTGATGACCTGATGGTACCCGGGCAGGAAGTT
JMFF006N03+ TGATGACCTGATGGTACCCGGGCAGGAAGTT
JMFF041E03+ GCAATTCCCGCAACATCCCACT-CCCCTTTGATGACCTGATGGTACCCGGGCAGGAAGTT
JMFF010N01+ TTTGATGACCTGATGGTACCCGGGCAGGAAGTT
JMFF051D20+ GATGGTACCCGGGCAGGAAGTT
JMFF037D06+ GGTACCCGGGCAGGAAGTT
JMFF039J16+ TGATGGTACCCGGGCAGGAAGTT
JMFF026E03+ GACCTGATGGTACCCGGGCAGGAAGTT
JMFF020E01+ GGGCAGGAAGTT
JMFF016B07+ CCCGGGCAGGAAGTT
JMFF044O23+ GCAATTCCCGCAACATCCCACT-CCCCTNTGATGACCTGATGGTACCCGGGCAGGAAGTT
JMFF045H18+ CTGATGGTACCCGGGCAGGAAGTT
JMFF002M08+ CCGGGCAGGAAGTT
                      ____________________________________________________________
consensus GCAATTCCCGCAACATCCCACT-CCCCTTTGATGACCTGATGGTACCCGGGCAGGAAGTT
 
. : . : . : . : . : . :
JMFF045M14+ CCGAACAAGAATGAGGATACGCATCAGTTCGTCCTCTGCAACCGAGACGGTGTTGCTTCC
JMFN014A01+ CCGAACAAGAATGAGGATACGCATCAGTTCGTCCTCTGCAACCGAGACGGTGTTGCTTCC
JMFF008E23+ CCGAACAAGAATGAGGATACGCATCAGTTCGTCCTCTGCAACCGAGACGGTGTTGCTTCC
JMFF045D08+ CCGAACAAGAATGAGGATACGCATCAGTTCGTCCTCTGCAACCGAGACGGTGTTGCTTCC
JMFF006N03+ CCGAACAAGAATGAGGATACGCATCAGTTCGTCCTCTGCAACCGAGACGGTGTTGCTTCC
JMFF041E03+ CCGAACAAGAATGAGGATACGCATCAGTTCGTCCTCTGCAACCGAGACGGTGTTGCTTCC
JMFF010N01+ CCGAACAAGAATGAGGATACGCATCAGTTCGTCCTCTGCAACCGAGACGGTGTTGCTTCC
JMFF051D20+ CCGAACAAGAATGAGGATACGCATCAGTTCGTCCTCTGCAACCGAGACGGTGTTGCTTCC
JMFF037D06+ CCGAACAAGAATGAGGATACGCATCAGTTCGTCCTCTGCAACCGAGACGGTGTTGCTTCC
JMFF039J16+ CCGAACAAGAATGAGGATACGCATCAGTTCGTCCTCTGCAACCGAGACGGTGTTGCTTCC
JMFF031F02+ CAACCGAGACGGTGTTGCTTCC
JMFF026E03+ CCGAACAAGAATGAGGATACGCATCAGTTCGTCCTCTGCAACCGAGACGGTGTTGCTTCC
JMFF020E01+ CCGAACAAGAATGAGGATACGCATCAGTTCGTCCTCTGCAACCGAGACGGTGTTGCTTCC
JMFF036O10+ GCAACCGAGACGGTGTTGCTTCC
JMFF033N20+ AACCGAGACGGTGTTGCTTCC
JMFF016B07+ CCGAACAAGAATGAGGATACGCATCAGTTCGTCCTCTGCAACCGAGACGGTGTTGCTTCC
JMFF013K05+ ACCGAGACGGTGTTGCTTCC
JMFF024K17+ GAGACGGTGTTGCTTCC
JMFF012L18+ ACCGAGACGGTGTTGCTTCC
JMFF030C09+ AACCGAGACGGTGTTGCTTCC
JMFF044O23+ CCGAACAAGAATGAGGATACGCATCAGTTCGTCCTCTGCAACCGAGACGGTGTTGCTTCC
JMFF045H18+ CCGACCAAGAATGAGGATACGCATCAGTTCGTCCTCTGCAACCGAGACGGTGTTGCTTCC
JMFF002M08+ CCGAACAAGAATGAGGATACGCATCAGTTCGTCCTCTGCAACCGAGACGGTGTTGCTTCC
JMFF021C15+ GTTGCTTCC
                      ____________________________________________________________
consensus CCGAACAAGAATGAGGATACGCATCAGTTCGTCCTCTGCAACCGAGACGGTGTTGCTTCC
 
. : . : . : . : . : . :
JMFF045M14+ AGTGACCTCTGCCACTGTCAG
JMFN014A01+ AGTGACCTCTGCCACTGTCAG-CCCAGCAGCAGCTGCAGCATTGAGATCTATGTGATCTG
JMFF008E23+ AGTGACCTCTGCCACTGTCAG-CCCAGCAGCAGCTGCAGCATTGAGATCTATGTGATCTG
JMFF045D08+ AGTGACCTCTGCCACTGTCAG-CCCAGCAGCAGCTGCAGCATTGAGATCTATGTGATCTG
JMFF006N03+ AGTGACCTCTGCCACTGTCAG-CCCAGCAGCAGCTGCAGCATTGAGATCTATGTGATCTG
JMFF041E03+ AGTGACCTCTGCCACTGTCAG-CCCAGCAGCAGCTGCAGCATTGAGATCTATGTGATCTG
JMFF010N01+ AGTGACCTCTGCCACTGTCAG-CCCAGCAGCAGCTGCAGCATTGAGATCTATGTGATCTG
JMFF051D20+ AGTGACCTCTGCCACTGTCAG-CCCAGCAGCAGCTGCAGCATTGAGATCTATGTGATCTG
JMFF037D06+ AGTGACCTCTGCCACTGTCAG-CCCAGCAGCAGCTGCAGCATTGAGATCTATGTGATCTG
JMFF039J16+ AGTGACCTCTGCCACTGTCAG-CCCAGCAGCAGCTGCAGCATTGAGATCTATGTGATCTG
JMFF031F02+ AGTGACCTCTGCCACTGTCAG-CCCAGCAGCAGCTGCAGCATTGAGATCTATGTGATCTG
JMFF026E03+ AGTGACCTCTGCCACTGTCAG-CCCAGCAGCAGCTGCAGCATTGAGATCTATGTGATCTG
JMFF020E01+ AGTGACCTCTGCCACTGTCAG-CCCAGCAGCAGCTGCAGCATTGAGATCTATGTGATCTG
JMFF036O10+ AGTGACCTCTGCCACTGTCAG-CCCAGCAGCAGCTGCAGCATTGAGATCTATGTGATCTG
JMFF033N20+ AGTGACCTCTGCCACTGTCAG-CCCAGCAGCAGCTGCAGCATTGAGATCTATGTGATCTG
JMFF016B07+ AGTGACCTCTGCCACTGTCAG-CCCAGCAGCAGCTGCAGCATTGAGATCTATGTGATCTG
JMFF013K05+ AGTGACCTCTGCCACTGTCAG-CCCAGCAGCAGCTGCAGCATTGAGATCTATGTGATCTG
JMFF024K17+ AGTGACCTCTGCCACTGTCAG-CCCAGCAGCAGCTGCAGCATTGAGATCTATGTGATCTG
JMFF012L18+ AGTGACCTCTGCCACTGTCAG-CCCAGCAGCAGCTGCAGCATTGAGATCTATGTGATCTG
JMFF030C09+ AGTGACCTCTGCCACTGTCAGCCCCAGCAGCAGCTGCAGCATTGAGATCTATGTGATCTG
JMFF044O23+ AGTGAC--CTGCCACTGTCAG-CCCAGCAGCAGCTGCAGCATTGAGATCTATGTGATCTG
JMFF045H18+ AGTGAC--CTGCCACTGTCAG-CCCAGCAGCAGCTGCAGCATTGAGATCTATGTGATCTG
JMFF029C07+ G
JMFF002M08+ AGTGAC--CTGCCACTGTCAG-CCCAGCAGCAGCTGCAGCATTGAGATCTATGTGATCTG
JMFF021C15+ AGTGACCTCTGCCACTGTCAG-CCCAGCAGCAGCTGCAGCATTGAGATCTATGTGATCTG
                      ____________________________________________________________
consensus AGTGACCTCTGCCACTGTCAG-CCCAGCAGCAGCTGCAGCATTGAGATCTATGTGATCTG
 
. : . : . : . : . : . :
JMFN014A01+ AACCAATGCCAGCAGTGAGCAACAGCTGCAAATTCTTGGCTTTCTTGATCCTTTCGGCCG
JMFF008E23+ AACCAATGCCAGCAGTGAGCAACAGCTGCAAATTCTTGGCTTTCTTGATCCTTTCGGCCG
JMFF045D08+ AACCAATGCCAGCAGTGAGCAACAGCTGCAAATTCTTGGCTTTCTTGATCCTTTCGGCCG
JMFF006N03+ AACCAATGCCAGCAGTGAGCAACAGCTGCAAATTCTTGGCTTTCTTGATCCTTTCGGCCG
JMFF041E03+ AACCAATGCCAGCAGTGAGCAACAGCTGCAAATTCTTGGCTTTCTTGATCCTTTCGGCCG
JMFF010N01+ AACCAATGCCAGCAGTGAGCAACAGCTGCAAATTCTTGGCTTTCTTGAT-CTTTCGGCCG
JMFF051D20+ AACCAATGCCAGCAGTGAGCAACAGCTGCAAATTCTTGGCTTTCTTGATCCTTTCGGCCG
JMFF037D06+ AACCAATGCCAGCAGTGAGCAACAGCTGCAAATTCTTGGCTTTCTTGATCCTTTCGGCCG
JMFF039J16+ AACCAATGCCAGCAGTGAGCAACAGCTGCAAATTCTTGGCTTTCTTGATCCTTTCGGCCG
JMFF031F02+ AACCAATGCCAGCAGTGAGCAACAGCTGCAAATCCTTGGCTTTCTTGATCCTTTCGGCCG
JMFF026E03+ AACCAATGCCAGCAGTGAGCAACAGCTGCAAATCCTTGGCTTTCTTGATCCTTTCGGCCG
JMFF020E01+ AACCAATGCCAGCAGTGAGCAACAGCTGCAAATTCTTGGCTTTCTTGATCCTTTCGGCCG
JMFF036O10+ AACCAATGCCAGCAGTGAGCAACAGCTGCAAATTCTTGGCTTTCTTGATCCTTTCGGCCG
JMFF033N20+ AACCAATGCCAGCAGTGAGCAACAGCTGCAAATTCTTGGCTTTCTTGATCCTTTCGGCCG
JMFF016B07+ AACCAATGCCAGCAGTGAGCAACAGCTGCAAATTCTTGGCTTTCTTGATCCTTTCGGCCG
JMFF013K05+ AACCAATGCCAGCAGTGAGCAACAGCTGCAAATTCTTGGCTTTCTTGATCCTTTCGGCCG
JMFF024K17+ AACCAATGCCAGCAGTGAGCAACAGCTGCAAATTCTTGGCTTTCTTGATCCTTTCGGCCG
JMFF012L18+ AACCAATGCCAGCAGTGAGCAACAGCTGCAAATTCTTGGCTTTCTTGATCCTTTCGGCCG
JMFF030C09+ AACCAATGCCAGCAGTGAGCAACAGCTGCAAATTCTTGGCTTTCTTGATCCTTTCGGCCG
JMFF044O23+ AACCAATGCCAGCAGTGAGCAACAGCTGCAAATTCTTGGCTTTCTTGATCCTTTCGGCCG
JMFF045H18+ AACCAATGCCAGCAGTGAGCAACAGCTGCAAATTCTTGGCTTTCTTGATCCTTTCGGCCG
JMFF029C07+ AACCAATGCCAGCAGTGAGCAACAGCTGCAAATTCTTGGCTTTCTTGATCCTTTCGGCCG
JMFF002M08+ AACCAATGCCAGCAGTGAGCAACAGCTGCAAATTCTTGGCTTTCTTGATCCTTTCGGCCG
JMFF021C15+ AACCAATGCCAGCAGTGAGCAACAGCTGCAAATTCTTGGCTTTCTTGATCCTTTCGGCCG
                      ____________________________________________________________
consensus AACCAATGCCAGCAGTGAGCAACAGCTGCAAATTCTTGGCTTTCTTGATCCTTTCGGCCG
 
. : . : . : . : . : . :
JMFN014A01+ TGACATAGGCAGGATGAAAGGGAGTGGTTATCAACACATGTAGATCGGGAATATGCTTTT
JMFF008E23+ TGACATAGGCAGGATGAAAGGGAGTGGTTATCAACACATGTAGATCGGGAATATGCTTTT
JMFF045D08+ TGACATAGGCAGGATGAAAGGGAGTGGTTATCAACACATGTAGATCGGGAATATGCTTTT
JMFF006N03+ TGACATAGGCAGGATGAAAGGGAGTGGTTATCAACACATGTAGATCGGGAATATGCTTTT
JMFF041E03+ TGACATAGGCAGGATGAAAGGGAGTGGTTATCAACACATGTAGATCGGGAATATGCTTTT
JMFF010N01+ TGACATAGGCAGGATGAAAGGGAGTGGTTATCAACACATGTAGATCGGGAATATGCTTTT
JMFF051D20+ TGACATAGGCAGGATGAAAGGGAGTGGTTATCAACACATGTAGATCGGGAATATGCTTTT
JMFF037D06+ TGACATAGGCAGGATGAAAGGGAGTGGTTATCAACACATGTAGATCGGGAATATGCTTTT
JMFF039J16+ TGACATAGGCAGGATGAAAGGGAGTGGTTATCAACACATGTAGATCGGGAATATGCTTTT
JMFF031F02+ TGACATAGGCAGGATGAAAGGGAGTGGTTATCAACACATGTAGATCGGGAATATGCTTTT
JMFF026E03+ TGACATAGGCAGGATGAAAGGGAGTGGTTATCAACACATGTAGATCGGGAATATGCTTTT
JMFF020E01+ TGACATAGGCAGGATGAAAGGGAGTGGTTATCAACACATGTAGATCGGGAATATGCTTTT
JMFF036O10+ TGACATAGGCAGGATGAAAGGGAGTGGTTATCAACACATGTAGATCGGGAATATGCTTTT
JMFF033N20+ TGACATAGGCAGGATGAAAGGGAGTGGTTATCAACACATGTAGATCGGGAATATGCTTTT
JMFF016B07+ TGACATAGGCAGGATGAAAGGGAGTGGTTATCAACACATGTAGATCGGGAATATGCTTTT
JMFF013K05+ TGACATAGGCAGGATGAAAGGGAGTGGTTATCAACACATGTAGATCGGGAATATGCTTTT
JMFF024K17+ TGACATAGGCAGGATGAAAGGGAGTGGTTATCAACACATGTAGATCGGGAATATGCTTTT
JMFF012L18+ TGACATAGGCAGGATGAAAGGGAGTGGTTATCAACACATGTAGATCGGGAATATGCTTTT
JMFF030C09+ TGACATAGGCAGGATGAAAGGGAGTGGTTATCAACACATGTAGATCGGGAATATGCTTTT
JMFF044O23+ TGACATAGGCAGGATGAAAGGGAGTGGTTATCAACACATGTAGATCGGGAATATGCTTTT
JMFF045H18+ TGACATAGGCAGGATGAAAGGGAGTGGTTATCAACACATGTAGATCGGGAATATGCTTTT
JMFF029C07+ TGACATAGGCAGGATGAAAGGGAGTGGTTATCAACACATGTAGATCGGGAATATGCTTTT
JMSF016O10+ ATGTAGATCGGGAATATGCTTTT
JMFF002M08+ TGACATAGGCAGGATGAAAGGGAGTGGTTATCAACACATGTAGATCGGGAATATGCTTTT
JMFF021C15+ TGACATAGGCAGGATGAAAGGGAGTGGTTATCAACACATGTAGATCGGGAATATGCTTTT
                      ____________________________________________________________
consensus TGACATAGGCAGGATGAAAGGGAGTGGTTATCAACACATGTAGATCGGGAATATGCTTTT
 
. : . : . : . : . : . :
JMFN014A01+ CCAGCTCAGAATCGGGTCCTTCTTTGTCAGGAGTGACTATGTACTGGTGACCTTGGGATT
JMFF008E23+ CCAGCTCAGAATCGGGTCCTTCTTTGTCAGGAGTGACTATGTACTGGTGACCTTGGGATT
JMFF045D08+ CCAGCTCAGGATCGGGTCCTTCTTTGTCAGGAGTGACTATGTACTGGTGACCTTGGGATT
JMFF006N03+ CCAGCTCAGAATCGGGTCCTTCTTTGTCAGGAGTGACTATGTACTGGTGACCTTGGGATT
JMFF041E03+ CCAGCTCAGAATCGGGTCCTTCTTTGTCAGGAGTGACTATGTACTGGTGACCTTGGGATT
JMFF010N01+ CCAGCTCAGAATCGGGTCCTTCTTTGTCAGGAGTGACTATGTACTGGTGACCTTGGGATT
JMFF051D20+ CCAGCTCAGAATCGGGTCCTTCTTTGTCAGGAGTGACTATGTACTGGTGACCTTGGGATT
JMFF037D06+ CCAGCTCAGAATCGGGTCCTTCTTTGTCAGGAGTGACTATGTACTGGTGACCTTGGGATT
JMFF039J16+ CCAGCTCAGAATCGGGTCCTTCTTTGTCAGGAGTGACTATGTACTGGTGACCTTGGGATT
JMFF031F02+ CCAGCTCAGAATCGGGTCCTTCTTTGTCAGGAGTGACTATGTACTGGTGACCTTGGGATT
JMFF026E03+ CCAGCTCAGAATCGGGTCCTTCTTTGTCAGGAGTGACTATGTACTGGTGACCTTGGGATT
JMFF020E01+ CCAGCTCAGAATCGGGTCCTTCTTTGTCAGGAGTGACTATGTACTGGTGACCTTGGGATT
JMFF036O10+ CCAGCTCAGAATCGGGTCCTTCTTTGTCAGGAGTGACTATGTACTGGTGACCTTGGGATT
JMFF033N20+ CCAGCTCAGAATCGGGTCCTTCTTTGTCAGGAGTGACTATGTACTGGTGACCTTGGGATT
JMFF016B07+ CCAGCTCAGAATCGGGTCCTTCTTTGTCAGGAGTGACTATGTACTGGTGACCTTGGGATT
JMFF013K05+ CCAGCTCAGGATCGGGTCCTTCTTTGTCAGGAGTGACTATGTACTGGTGACCTTGGGATT
JMFF024K17+ CCAGCTCAGGATCGGGTCCTTCTTTGTCAGGAGTGACTATGTACTGGTGACCTTGGGATT
JMFF012L18+ CCAGCTCAGGATCGGGTCCTTCTTTGTCAGGAGTGACTATGTACTGGTGACCTTGGGATT
JMFF030C09+ CCAGCTCAGGATCGGGTCCTTCTTTGTCAGGAGTGACTATGTACTGGTGACCTTGGGATT
JMFF044O23+ CCAGCTCAGAATCGGGTCCTTCTTTGTCAGGAGTGACTATGTACTGGTGACCTTGGGATT
JMFF045H18+ CCAGCTCAGAATCGGGTCCTTCTTTGTCAGGAGTGACTATGTACTGGTGACCTTGGGATT
JMFF029C07+ CCAGCTCAGAATCGGGTCCTTCTTTGTCAGGAGTGACTATGTACTGGTGACCTTGGGATT
JMSF016O10+ CCAGCTCAGAATCGGGTCCTTCTTTGTCAGGAGTGACTATGTACTGGTGACCTTGGGATT
JMFF002M08+ CCAGCTCAGAATCGGGTCCTTCTTTGTCAGGAGTGACTATGTACTGGTGACCTTGGGATT
JMFF021C15+ CCAGCTCAGAATCGGGTCCTTCTTTGTCAGGAGTGACTATGTACTGGTGACCTTGGGATT
                      ____________________________________________________________
consensus CCAGCTCAGAATCGGGTCCTTCTTTGTCAGGAGTGACTATGTACTGGTGACCTTGGGATT
 
. : . : . : . : . : . :
JMFN014A01+ CCAACCAATCACGAATACCCAGTGCATTCTCCACGCAACCCACAAAATTGGGATTCATCG
JMFF008E23+ CCAACCAATCACGAATACCCAGTGCATTCTCCACGCAACCCACAAAATTGGGATTCATCG
JMFF045D08+ CCAACCAATCACGAATACCCAGTGCATTCTCCACGCAACCCACAAAATTGGGATTCATCG
JMFF006N03+ CCAACCAATCACGAATACCCAGTGCATTCTCCACGCAACCCACAAAATTGGGATTCATCG
JMFF041E03+ CCAACCAATCACGAATACCCAGTGCATTCTCCACGCAACCCACAAAATTGGGATTCATCG
JMFF010N01+ CCAACCAATCACGAATACCCAGTGCATTCTCCACGCAACCCACAAAATTGGGATTCATCG
JMFF051D20+ CCAACCAATCACGAATACCCAGTGCATTCTCCACGCAACCCACAAAATTGGGATTCATCG
JMFF037D06+ CCAACCAATCACGAATACCCAGTGCATTCTCCACGCAACCCACAAAATTGGGATTCATCG
JMFF039J16+ CCAACCAATCACGAATACCCAGTGCATTCTCCACGCAACCCACAAAATTGGGATTCATCG
JMFF031F02+ CCAACCAATCACGAATACCCAGTGCATTCTCCACGCAACCCACAAAATTGGGATTCATCG
JMFF026E03+ CCAACCAATCACGAATACCCAGTGCATTCTCCACGCAACCCACAAAATTGGGATTCATCG
JMFF020E01+ CCAACCAATCACGAATACCCAGTGCATTCTCCACGCAACCCACAAAATTGGGATTCATCG
JMFF036O10+ CCAACCAATCACGAATACCCAGTGCATTCTCCACGCAACCCACAAAATTGGGATTCATCG
JMFF033N20+ CCAACCAATCACGAATACCCAGTGCATTCTCCACGCAACCCACAAAATTGGGATTCATCG
JMFF016B07+ CCAACCAATCACGAATACCCAGTGCATTCTCCACGCAACCCACAAAATTGGGATTCATCG
JMFF013K05+ CCAACCAATCACGAATACCCAGTGCATTCTCCACGCAACCCACAAAATTGGGATTCATCG
JMFF024K17+ CCAACCAATCACGAATACCCAGTGCATTCTCCACGCAACCCACAAAATTGGGATTCATCG
JMFF012L18+ CCAACCAATCACGAATACCCAGTGCATTCTCCACGCAACCCACAAAATTGGGATTCATCG
JMFF030C09+ CCAACCAATCACGAATACCCAGTGCATTCTCCACGCAACCCACAAAATTGGGATTCATCG
JMFF044O23+ CCAACCAATCACGAATACCCAGTGCATTCTCCACGCAACCCACAAAATTGGGATTCATCG
JMFF045H18+ CCAACCAATCACGAATACCCAGTGCATTCTCCACGCAACCCACAAAATTGGGATTCATCG
JMFF029C07+ CCAA-CAATCACGAATACCCAGTGCATTCTCCACGCAACCCACAAAATTGGGATTCATCG
JMSF016O10+ CCAACCAATCACGAATACCCAGTGCATTCTCCACGCAACCCACAAAATTGGGATTCATCG
JMFF002M08+ CCAACCAATCACGAATACCCAGTGCATTCTCCACGCAACCCACAAAATTGGGATTCATCG
JMFF021C15+ CCAACCAATCACGAATACCCAGTGCATTCTCCACGCAACCCACAAAATTGGGATTCATCG
                      ____________________________________________________________
consensus CCAACCAATCACGAATACCCAGTGCATTCTCCACGCAACCCACAAAATTGGGATTCATCG
 
. : . : . : . : . : . :
JMFN014A01+ AAGCATACTCATTTGCTTTGTAGAAAACACCGACGATCTTTTTGCTCCCGGGAGAAGCGT
JMFF008E23+ AAGCATACTCATTTGCTTTGTAGAAAACACAGACGATCTTTTTGCTCCCGGGAGAAGCGT
JMFF045D08+ AAGCATACTCATTTGCTTTGTAGAAAACACCGACGATCTTTTTGCTCCCGGGAGAAGCGT
JMFF006N03+ AAGCATACTCATTTGCTTTGTAGAAAACACCGACGATCTTTTTGCTCCCGGGAGAAGCGT
JMFF041E03+ AAGCATACTCATTTGCTTTGTAGAAAACACCGACGATCTTTTTGCTCCCGGGAGAAGCGT
JMFF010N01+ AAGCATACTCATTTGCTTTGTAGAAAACACCGACGATCTTTTTGCTCCCGGGAGAAGCGT
JMFF051D20+ AAGCATACTCATTTGCTTTGTAGAAAACACCGACGATCTTTTTGCTCCCGGGAGAAGCGT
JMFF037D06+ AAGCATACTCATTTGCTTTGTAGAAAACACCGACGATCTTTTTGCTCCCGGGAGAAGCGT
JMFF039J16+ AAGCATACTCATTTGCTTTGTAGAAAACACCGACGATCTTTTTGCTCCCGGGAGAAGCGT
JMFF031F02+ AAGCATACTCATTTGCTTTGTAGAAAACACCGACGATCTTTTTGCTCCCGGGAGAAGCGT
JMFF026E03+ AAGCATACTCATTTGCTTTGTAGAAAACACCGACGATCTTTTTGCTCCCGGGAGAAGCGT
JMFF020E01+ AAGCATACTCATTTGCTTTGTAGAAAACACCGACGATCTTTTTGCTCCCGGGAGAAGCGT
JMFF036O10+ AAGCATACTCATTTGCTTTGTAGAAAACACCGACNATCTTTTTGCTCCCGGGAGAAGCGT
JMFF033N20+ AAGCATACTCATTTGCTTTGTAGAAAACACCGACGATCTTTTTGCTCCCGGGAGAAGCGT
JMFF016B07+ AAGCATACTCATTTGCTTTGTAGAAAACACCGACGATCTTTTTGCTCCCGGGAGAAGCGT
JMFF013K05+ AAGCATACTCATTTGCTTTGTAGAAAACACCGACGATCTTTTTGCTCCCGGGAGAAGCGT
JMFF024K17+ AAGCATACTCATTTGCTTTGTAGAAAACACCGACGATCTTTTTGCTCCCGGGAGAAGCGT
JMFF012L18+ AAGCATACTCATTTGCTTTGTAGAAAACACCGACGATCTTTTTGCTCCCGGGAGAAGCGT
JMFF030C09+ AAGCATACTCATTTGCTTTGTAGAAAACACCGACGATCTTTTTGCTCCCGGGAGAAGCGT
JMFF044O23+ AAGCATACTCATTTGCTTTGTAGAAAACACCGACGATCTTTTTGCTCCCGGGAGAAGCGT
JMFF045H18+ AAGCATACTCATTTGCTTTGTAGAAAACACCGACGATCTTTTTGCTCCCGGGAGAAGCGT
JMFF029C07+ AAGCATACTCATTTGCTTTGTAGAAAACACCGACGATCTTTTTGCTCCCGGGAGAAGCGT
JMSF016O10+ AAGCATACTCATTTGCTTTGTAGAAAACACCGACGATCTTTTTGCTCCCGGGAGAAGCGT
JMFF002M08+ AAGCATACTCATTTGCTTTGTAGAAAACACCGACGATCTTTTTGCTCCCGGGAGAAGCGT
JMFF021C15+ AAGCATACTCATTTGCTTTGTAGAAAACACCGACGATCTTTTTGCTCCCGGGAGAAGCGT
                      ____________________________________________________________
consensus AAGCATACTCATTTGCTTTGTAGAAAACACCGACGATCTTTTTGCTCCCGGGAGAAGCGT
 
. : . : . : . : . : . :
JMFN014A01+ GAAGTTGTCGGGTGAGAAGGGATGGGTTCCCGTAAGAAGCAAAAGCCCGAAGCCCAGAAG
JMFF008E23+ GAAGTTGTCGGGTGAGAAGGGATGGGTTCCCGTAAGAAGCAAAAGCCCGAAGCCCAGAAG
JMFF045D08+ GAAGTTGTCGGGTGAGAAGGGATGGGTTCCCGTAAGAAGCAAAAGCCCGAAGCCCAGAAG
JMFF006N03+ GAAGTTGTCGGGTGAGAAGGGATGGGTTCCCGTAAGAAGCAAAAGCCCGAAGCCCAGAAG
JMFF041E03+ GAAGTTGTCGGGTGAGAAGGGATGGGTTCCCGTAAGAAGCAAAAGCCCGAAGCCCAGAAG
JMFF010N01+ GAAGTTGTCGGGTGAGAAGGGATGGGTTCCCGTAAGAAGCAAAAGCCCGAAGCCCAGAAG
JMFF051D20+ GAAGTTGTCGGGTGAGAAGGGATGGGTTCCCGTAAGAAGCAAAAGCCCGAAGCCCAGAAG
JMFF037D06+ GAAGTTGTCGGGTGAGAAGGGATGGGTTCCCGTAAGAAGCAAAAGCCCGAAGCCCAGAAG
JMFF039J16+ GAAGTTGTCGGGTGAGAAGGGATGGGTTCCCGTAAGAAGCAAAAGCCCGAAGCCCAGAAG
JMFF031F02+ GAAGTTGTCGGGTGAGAAGGGATGGGTTCCCGTAAGAAGCAAAAGCCCGAAGCCCAGAAG
JMFF026E03+ GAAGTTGTCGGGTGAGAAGGGATGGGTTCCCGTAAGAAGCAAAAGCCCGAAGCCCAGAAG
JMFF020E01+ GAAGTTGTCGGGTGAGAAGGGATGGGTTCCCGTAAGAAGCAAAAGCCCGAAGCCCAGAAG
JMFF036O10+ GAAGTTGTCGGGTGAGAAGGGATGGGTTCCCGTAAGAAGCAAAAGCCCGAAGCCCAGAAG
JMFF033N20+ GAAGTTGTCGGGTGAGAAGGGATGGGTTCCCGTAAGAAGCAAAAGCCCGAAGCCCAGAAG
JMFF016B07+ GAAGTTGTCGGGTGAGAAGGGATGGGTTCCCGTAAGAAGCAAAAGCCCGAAGCCCAGAAG
JMFF013K05+ GAAGTTGTCGGGTGAGAAGGGATGGGTTCCCGTAAGAAGCAAAAGCCCGAAGCCCAGAAG
JMFF024K17+ GAAGTTGTCGGGTGAGAAGGGATGGGTTCCCGTAAGAAGCAAAAGCCCGAAGCCCAGAAG
JMFF012L18+ GAAGTTGTCGGGTGAGAAGGGATGGGTTCCCGTAAGAAGCAAAAGCCCGAAGCCCAGAAG
JMFF030C09+ GAAGTTGTCGGGTGAGAAGGGATGGGTTCCCGTAAGAAGCAAAAGCCCGAAGCCCAGAAG
JMFF044O23+ GAAGTTGTCGGGTGAGAAGGGATGGGTTCCCGTAAGAAGCAAAAGCCCGAAGCCCAGAAG
JMFF045H18+ GAAGTTGTCGGGTGAGAAGGGATGGGTTCCCGTAAGAAGCAAAAGCCCGAAGCCCAGAAG
JMFF029C07+ GAAGTTGTCGGGTGAGAAGGGATGGGTTCCCGTAAGAAGCAAAAGCCCGAAGCCCAGAAG
JMSF016O10+ GAAGTTGTCGGGTGAGAAGGGATGGGTTCCCGTAAGAAGCAAAAGCCCGAAGCCCAGAAG
JMFF002M08+ GAAGTTGTCGGGTGAGAAGGGATGGGTTCCCGTAAGAAGCAAAAGCCCGAAGCCCAGAAG
JMFF021C15+ GAAGTTGTCGGGTGAGAAGGGATGGGTTCCCGTAAGAAGCAAAAGCCCGAAGCCCAGAAG
                      ____________________________________________________________
consensus GAAGTTGTCGGGTGAGAAGGGATGGGTTCCCGTAAGAAGCAAAAGCCCGAAGCCCAGAAG
 
. : . : . : . : . : . :
JMFN014A01+ CAGCAACACGCCTCATCGCCATCTCTCTCTCTCTATAACTTCT
JMFF008E23+ CAGCAACACGCCTCATCGCCATCTCTCTCTCTCTATAACTTCTTAGTTGCTTGCTATGAT
JMFF045D08+ CAGCAACACGCCTCATCGCCATCTCTCTCTCTCTATAACTTCTTAGTTGCTTGCTATGAT
JMFF006N03+ CAGCAACACGCCTCATCGCCATCTCTCTCTCTCTATAACTTCTTAGTTGCTTGCTATGAT
JMFF041E03+ CAGCAACACGCCTCATCGCCATCTCTCTCTCTCTATAACTTCTTAGTTGCTTGCTATGAT
JMFF010N01+ CAGCAACACGCCTCATCGCCATCTCTCTCTCTCTATAACTTCTTAGTTGCTTGCTATGAT
JMFF051D20+ CAGCAACACGCCTCATCGCCATCTCTCTCTCTCTATAACTTCTTAGTTGCTTGCTATGAT
JMFF037D06+ CAGCAACACGCCTCATCGCCATCTCTCTCTCTCTATAACTTCTTAGTTGCTTGCTATGAT
JMFF039J16+ CAGCAACACGCCTCATCGCCATCTCTCTCTCTCTATAACTTCTTAGTTGCTTGCTATGAT
JMFF031F02+ CAACAACACGCCTCATCGCCATCTCTCTCTCTCTATAACTTCTTAGTTGCTTGCTATGAT
JMFF026E03+ CAACAACACGCCTCATCGCCATCTCTCTCTCTCTATAACTTCTTAGTTGCTTGCTATGAT
JMFF020E01+ CAGCAACACGCCTCATCGCCATCTCTCTCTCTCTATAACTTCTTAGTTGCTTGCTATGAT
JMFF036O10+ CAGCAACACGCCTCATCGCCATCTCTCTCTCTCTATAACTTCTTAGTTGCTTGCTATGAT
JMFF033N20+ CAGCAACACGCCTCATCGCCATCTCTCTCTCTCTATAACTTCTTAGTTGCTTGCTATGAT
JMFF016B07+ CAGCAACACGCCTCATCGCCATCTCTCTCTCTCTATAACTTCTTAGTTGCTTGCTATGAT
JMFF013K05+ CAGCAACACGCCTCATCGCCATCTCTCTCTCTCTATAACTTCTTAGTTGCTTGCTATGAT
JMFF024K17+ CAGCAACACGCCTCATCGCCATCTCTCTCTCTCTATAACTTCTTAGTTGCTTGCTATGAT
JMFF012L18+ CAGCAACACGCCTCATCGCCATCTCTCTCTCTCTATAACTTCTTAGTTGCTTGCTATGAT
JMFF030C09+ CAGCAACACGCCTCATCGCCATCTCTCTCTCTCTATAACTTCTTAGTTGCTTGCTATGAT
JMFF044O23+ CAGCAACACGCCTCATCGCCATCTCTCTCTCTCTATAACTTCTTAGTTGCTTGCTATGAT
JMFF045H18+ CAGCAACACGCCTCATCGCCATCTCTCTCTCTCTATAACTTCTTAGTTGCTTGCTATGAT
JMFF029C07+ CAGCAACACGCCTCATCGCCATCTCTCTCTCTCTATAACTTCTTAGTTGCTTGCTATGAT
JMSF016O10+ CAGCAACACGCCTCATCGCCATCTCTCTCTCTCTATAACTTCTTAGTTGCTTGCTATGAT
JMFF002M08+ CAGCAACACGCCTCATCGCCATCTCTCTCTCTCTATAACTTCTTAGTTGCTTGCTATGAT
JMFF021C15+ CAGCAACACGCCTCATCGCCATCTCTCTCTCTCTATAACTTCTTAGTTGCTTGCTATGAT
                      ____________________________________________________________
consensus CAGCAACACGCCTCATCGCCATCTCTCTCTCTCTATAACTTCTTAGTTGCTTGCTATGAT
 
. : . : . : . : . : . :
JMFF008E23+ TC
JMFF006N03+ TC
JMFF041E03+ TCGTGAGT
JMFF010N01+ TCGTGAGT
JMFF051D20+ TCG
JMFF037D06+ TCG
JMFF039J16+ TCGTGAGT
JMFF031F02+ TCGTGAGT
JMFF026E03+ TCGTGAGT
JMFF020E01+ TCGTGAGT
JMFF036O10+ TCGTGAGT
JMFF033N20+ TCGTGA
JMFF016B07+ TCGTGAGT
JMFF013K05+ TCGTAAGT
JMFF024K17+ TCGTAAGT
JMFF012L18+ TCGTAAGT
JMFF030C09+ TCGTAAGT
JMFF044O23+ TCGTGAGT
JMFF045H18+ TCGTGAGT
JMFF029C07+ TCGTGAGT
JMSF016O10+ TCGTGAGTC
JMFF002M08+ TCGTGAGTC
JMFF021C15+ TCGTGAGTGAGTGTGAATTGTAAAGCCCGAGCCTATTTGTAGTCGAAACGGATTCGAATT
                      ____________________________________________________________
consensus TCGTGAGTCAGTGTGAATTGTAAAGCCCGAGCCTATTTGTAGTCGAAACGGATTCGAATT