Previous Contig 001059:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF021B02Sequence499001059 (3)gb:AK118548_18165191e-11Arabidopsis thaliana At5g58960 mRNA for unknown protein, complete cds, clone: RA630021133gb:AB016885_15131222e-72Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K19M22.>gb:AY075634_15
JMSF019O23Sequence274001059 (3)gb:AK118548_18165192e-06Arabidopsis thaliana At5g58960 mRNA for unknown protein, complete cds, clone: RA627001059 (3)gb:AK118548_18165193e-06Arabidopsis thaliana At5g58960 mRNA for unknown protein, complete cds, clone: RA

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF019O23- TTGAGGTTGAGATCGACATACATTGCAAC
                      ____________________________________________________________
consensus TTGAGGTTGAGATCGACATACATTGCAAC
 
. : . : . : . : . : . :
rJMSF019O23- AACCTTGCAAGATTAATCGCAGGGAGATCAATCAGACAATCATACATTGCAAGATCAATC
                      ____________________________________________________________
consensus AACCTTGCAAGATTAATCGCAGGGAGATCAATCAGACAATCATACATTGCAAGATCAATC
 
. : . : . : . : . : . :
rJMSF019O23- TGACAATTCTGAAAATTTGAATCAGACATTGCAACAACCTGGAGTGCTGCAGCTCACTTT
                      ____________________________________________________________
consensus TGACAATTCTGAAAATTTGAATCAGACATTGCAACAACCTGGAGTGCTGCAGCTCACTTT
 
. : . : . : . : . : . :
rJMSF019O23- TCCCTTTGCCTTCCCTTTCTTTCCACTTCCACTACTGCAATGAGCTAAAGACGTCGTCGT
                      ____________________________________________________________
consensus TCCCTTTGCCTTCCCTTTCTTTCCACTTCCACTACTGCAATGAGCTAAAGACGTCGTCGT
 
. : . : . : . : . : . :
rJMSF019O23- TTTGAGCTTTTCCTTCAAGTCATCCACCACCGCCTCGTACGACGCCACCACTTCCTTGAG
                      ____________________________________________________________
consensus TTTGAGCTTTTCCTTCAAGTCATCCACCACCGCCTCGTACGACGCCACCACTTCCTTGAG
 
. : . : . : . : . : . :
rJMSF019O23- CGTCGCCGCCCCTACTTTCCGCCTCCCTCGTCCACTGTCGTCACTACCAACGCTTTTTCA
                      ____________________________________________________________
consensus CGTCGCCGCCCCTACTTTCCGCCTCCCTCGTCCACTGTCGTCACTACCAACGCTTTTTCA
 
. : . : . : . : . : . :
rJMSF019O23- ACACCTCAATCCTCCACACTACCACGTCAGCCACACGCATCTTATCCGGATCCCATGGGT
                      ____________________________________________________________
consensus ACACCTCAATCCTCCACACTACCACGTCAGCCACACGCATCTTATCCGGATCCCATGGGT
 
. : . : . : . : . : . :
rJMSF019O23- AGTGCGTGTTCTAGAGGCTAACGTACGCCCTCTTCCTCAGTTATTGACTCCTCCTTACCG
                      ____________________________________________________________
consensus AGTGCGTGTTCTAGAGGCTAACGTACGCCCTCTTCCTCAGTTATTGACTCCTCCTTACCG
 
. : . : . : . : . : . :
rJMSF019O23- CCGCCTCCTAGAAGCTTGAAATCGGCTTCCTCTTCGGCGTCTTCGTAATGTGTGTTCTCC
JMSF019O23+ CTAGAAGCTTGAAATCGGCTTCCTCTTCGGCGTCTTCGTAATGTGTGTTCTCC
JMFF021B02+ TTCGTAATGTGTGTTCTCC
                      ____________________________________________________________
consensus CCGCCTCCTAGAAGCTTGAAATCGGCTTCCTCTTCGGCGTCTTCGTAATGTGTGTTCTCC
 
. : . : . : . : . : . :
rJMSF019O23- TTCTCCGCCTTGCACTTGTCGTCATCGGAGTCCTCGCCGCCGTGACTAACCGAAACTTCA
JMSF019O23+ TTCTCCGCCTTGCACTTGTCGTCATCGGAGTCCTCGCCGCCGTGACTAACCGAAACTTCA
JMFF021B02+ TTCTCCACCTTGTACTTGTCGTCATCGGAGTCCTCGCCGCCGCGACTAACCGAAACTTCG
                      ____________________________________________________________
consensus TTCTCCGCCTTGCACTTGTCGTCATCGGAGTCCTCGCCGCCGTGACTAACCGAAACTTCA
 
. : . : . : . : . : . :
rJMSF019O23- TCGTCATCGTGGT---TGGCGGTGACCAGTGGGTGGAGCAAGCAAGACG
JMSF019O23+ TCGTCATCGTGGT---TGGCGGTGACCAGTGGGTGGAGCAAGCAAGACG
JMFF021B02+ TCGTCGTCGTGGTGGCCGGCGGTGACCAGCGGGTGGAGCAAACAAGACGCGGTAACGCGC
                      ____________________________________________________________
consensus TCGTCATCGTGGT---TGGCGGTGACCAGTGGGTGGAGCAAGCAAGACGCGGTAACGCGC
 
. : . : . : . : . : . :
JMFF021B02+ TGGATCAGATCGGAGAAATTGGAGACCTTGTTCGCCATTTTCCTGATGCCTCTATTTCTG
                      ____________________________________________________________
consensus TGGATCAGATCGGAGAAATTGGAGACCTTGTTCGCCATTTTCCTGATGCCTCTATTTCTG
 
. : . : . : . : . : . :
JMFF021B02+ TGTTTGGGATTCTCGTGGTGCAATGTGAATTTCCTGTGGTTGGCAGTGATTAGATGAGGA
                      ____________________________________________________________
consensus TGTTTGGGATTCTCGTGGTGCAATGTGAATTTCCTGTGGTTGGCAGTGATTAGATGAGGA
 
. : . : . : . : . : . :
JMFF021B02+ TGAAGTGGTACTGAGTAGGGCAGATGCACGTCCTTGTCTTGTATTCCATCAATGCTGCCG
                      ____________________________________________________________
consensus TGAAGTGGTACTGAGTAGGGCAGATGCACGTCCTTGTCTTGTATTCCATCAATGCTGCCG
 
. : . : . : . : . : . :
JMFF021B02+ GTACTTCTTTTCCTTGATGTCCCATCTCGAAGTGATGGAAATAAGATATTTGGCAACATA
                      ____________________________________________________________
consensus GTACTTCTTTTCCTTGATGTCCCATCTCGAAGTGATGGAAATAAGATATTTGGCAACATA
 
. : . : . : . : . : . :
JMFF021B02+ ATTGGGTGGAGTGGATCTGGAGCACAGTAAGAGTGTGTGAATTGAAGTTGGTGAGTGTTA
                      ____________________________________________________________
consensus ATTGGGTGGAGTGGATCTGGAGCACAGTAAGAGTGTGTGAATTGAAGTTGGTGAGTGTTA
 
. : . : . : . : . : . :
JMFF021B02+ AGTTGTGGGTAAGAAAAGGGAGATACAGAAACAAGACGGAAATGATTCGATGTGCAAACT
                      ____________________________________________________________
consensus AGTTGTGGGTAAGAAAAGGGAGATACAGAAACAAGACGGAAATGATTCGATGTGCAAACT