Previous Contig 001057:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF005K19Sequence467001057 (8)sp|Q43432|VAB1_GOSHI2e-70Vacuolar ATP synthase subunit B isoform 1 (EC 3.6.3.14) (V-ATPase B subunit 1) (743008618 (8)gb:AY045609_15612002e-74Arabidopsis thaliana AT4g38510/F20M13_70 mRNA, complete cds.>gb:AY090334_1574086
JMFF009M17Sequence619001057 (8)sp|Q43432|VAB1_GOSHI7e-95Vacuolar ATP synthase subunit B isoform 1 (EC 3.6.3.14) (V-ATPase B subunit 1) (782008618 (8)gb:AY045609_15612008e-63Arabidopsis thaliana AT4g38510/F20M13_70 mRNA, complete cds.>gb:AY090334_1574086
JMFF011B11Sequence536001057 (8)sp|Q43432|VAB1_GOSHI4e-75Vacuolar ATP synthase subunit B isoform 1 (EC 3.6.3.14) (V-ATPase B subunit 1) (784008618 (8)gb:AY045609_15612005e-73Arabidopsis thaliana AT4g38510/F20M13_70 mRNA, complete cds.>gb:AY090334_1574086
JMFF020L14Sequence498001057 (8)sp|Q43432|VAB1_GOSHI6e-67Vacuolar ATP synthase subunit B isoform 1 (EC 3.6.3.14) (V-ATPase B subunit 1) (768008618 (8)gb:AY045609_15612006e-74Arabidopsis thaliana AT4g38510/F20M13_70 mRNA, complete cds.>gb:AY090334_1574086
JMFF021A13Sequence472001057 (8)sp|Q43432|VAB1_GOSHI3e-68Vacuolar ATP synthase subunit B isoform 1 (EC 3.6.3.14) (V-ATPase B subunit 1) (640008618 (8)gb:AY045609_15612002e-53Arabidopsis thaliana AT4g38510/F20M13_70 mRNA, complete cds.>gb:AY090334_1574086
JMFF047G08Sequence428001057 (8)sp|Q43432|VAB1_GOSHI2e-61Vacuolar ATP synthase subunit B isoform 1 (EC 3.6.3.14) (V-ATPase B subunit 1) (315008618 (8)gb:AY045609_15612002e-15Arabidopsis thaliana AT4g38510/F20M13_70 mRNA, complete cds.>gb:AY090334_1574086
JMSF026E11Sequence691001057 (8)sp|Q43432|VAB1_GOSHIe-105Vacuolar ATP synthase subunit B isoform 1 (EC 3.6.3.14) (V-ATPase B subunit 1) (766008618 (8)gb:AY045609_15612002e-74Arabidopsis thaliana AT4g38510/F20M13_70 mRNA, complete cds.>gb:AY090334_1574086
JMSF039B17Sequence660001057 (8)sp|Q43432|VAB1_GOSHIe-101Vacuolar ATP synthase subunit B isoform 1 (EC 3.6.3.14) (V-ATPase B subunit 1) (854008618 (8)gb:AY045609_1561200e-102Arabidopsis thaliana AT4g38510/F20M13_70 mRNA, complete cds.>gb:AY090334_1574086

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF026E11+ CTCTTCAGCATCACC
                      ____________________________________________________________
consensus CTCTTCAGCATCACC
 
. : . : . : . : . : . :
JMFF009M17+ ATCTGTGC
JMSF026E11+ ANGAAGATTATCAGTCTTCTCCAAACGCTTCACCAAACCAGCCTGACGACATATCTGTGC
JMSF039B17+ CTCCAAACGCTTCACCAAACCAGCCTGACGACATATCTGTGC
                      ____________________________________________________________
consensus ANGAAGATTATCAGTCTTCTCCAAACGCTTCACCAAACCAGCCTGACGACATATCTGTGC
 
. : . : . : . : . : . :
JMFF009M17+ AGCAATTTCATTATGAGGAAGTCCAGCAGCAGAAAATAGAGGAATTTTCTGTCCTCTGGC
JMSF026E11+ AGCAATTTCATTATGAGGAAGTCCAGCAGCAGAAAATAGAGGAATTTTCTGTCCTCTGGC
JMSF039B17+ AGCAATTTCATTATGAGGAAGTCCAGCAGCAGAAAATAGAGGAATTTTCTGTCCTCTGGC
                      ____________________________________________________________
consensus AGCAATTTCATTATGAGGAAGTCCAGCAGCAGAAAATAGAGGAATTTTCTGTCCTCTGGC
 
. : . : . : . : . : . :
JMFF011B11+ GTATCATTTCTTCTGGATAGGT
JMFF009M17+ TATTGAATTCATGACATCAATTGTTGAAATTCCTGTTTGTATCATTTCTTCTGGATAGGT
JMSF026E11+ TATTGAATTCATGACATCAATTGTTGAAATTCCTGTTTGTATCATTTCTTCTGGATAGGT
JMSF039B17+ TATTGAATTCATGACATCAATTGTTGAAATTCCTGTTTGTATCATTTCTTCTGGATAGGT
JMFF005K19+ TAGGT
                      ____________________________________________________________
consensus TATTGAATTCATGACATCAATTGTTGAAATTCCTGTTTGTATCATTTCTTCTGGATAGGT
 
. : . : . : . : . : . :
JMFF011B11+ TCTCTCACTAGGATTGATAGAACTCCCAGAAATATCCAAGTAGGCCTCAGGTAGAATAGG
JMFF020L14+ TTGATAGAACTCCCAGAAATATCCAAGTAGGCCTCAGGTAGAATAGG
JMFF009M17+ TCTCTCACTAGGATTGATAGAACTCCCAGAAATATCCAAGTAGGCCTCAGGTAGAATAGG
JMSF026E11+ TCTCTCACTAGGATTGATAGAACTCCCAGAAATATCCAAGTAGGCCTCAGGTAGAATAGG
JMSF039B17+ TCTCTCACTAGGATTGATAGAACTCCCAGAAATATCCAAGTAGGCCTCAGGTAGAATAGG
JMFF005K19+ TCTCTCACTAGGATTGATAGAACTCCCAGAAATATCCAAGTAGGCCTCAGGTAGAATAGG
JMFF047G08+ GTAGGCCTCAGGTAGAATAGG
JMFF021A13+ TAGGATTGATAGAACTCCCAGAAATATCCAAGTAGGCCTCAGGTGGAATAGG
                      ____________________________________________________________
consensus TCTCTCACTAGGATTGATAGAACTCCCAGAAATATCCAAGTAGGCCTCAGGTAGAATAGG
 
. : . : . : . : . : . :
JMFF011B11+ AGGACCATTGTCAATGGGTTTCCCGGAACCATTAAAAATGCGGCCAAGCATATCCAGCGA
JMFF020L14+ AGGACCATTGTCAATGGGTTTCCCGGAACCATTAAAAATGCGGCCAAGCATATCCAGCGA
JMFF009M17+ AGGACCATTGTCAATGGGTTTCCCGGAACCATTAAAAATGCGGCCAAGCATATCCAGCGA
JMSF026E11+ AGGACCATTGTCAATGGGTTTCCCGGAACCATTAAAAATGCGGCCAAGCATATCCAGCGA
JMSF039B17+ AGGACCATTGTCAATGGGTTTCCCGGAACCATTAAAAATGCGGCCAAGCATATCCAGCGA
JMFF005K19+ AGGACCATTGTCAATGGGTTTCCCGGAACCATTAAAAATGCGGCCAAGCATATCCAGCGA
JMFF047G08+ AGGACCATNGTCAATGGGTTCCCCGGAACCATTAAAAATGCGGCCAAGCATATCCAGCGA
JMFF021A13+ AGGACCATTGTCAATGGGTTTCCCGGAACCATTAAAAATGCGGCCAAGCATATCCAGCGA
                      ____________________________________________________________
consensus AGGACCATTGTCAATGGGTTTCCCGGAACCATTAAAAATGCGGCCAAGCATATCCAGCGA
 
. : . : . : . : . : . :
JMFF011B11+ CACAGGAGTTTTTAAAACCTCCCCTGTAAACTGAACAGTTGTATATTTGTTGTCAATTCC
JMFF020L14+ CACAGGAGTTTTTAAAACCTCCCCTGTAAACTGAACAGTTGTATATTTGTTGTCAATTCC
JMFF009M17+ CACAGGAGTTTTTAAAACCTCCCCTGTAAACTGAACAGTTGTATATTTGTTGTCAATTCC
JMSF026E11+ CACAGGAGTTTTTAAAACCTCCCCTGTAAACTGAACAGTTGTATATTTGTTGTCAATTCC
JMSF039B17+ CACAGGAGTTTTTAAAACCTCCCCTGTAAACTGAACAGTTGTATATTTGTTGTCAATTCC
JMFF005K19+ CACAGGAGTTTTTAAAACCTCCCCTGTAAACTGAACAGTTGTATATTTGTTGTCAATTCC
JMFF047G08+ CACAGGAGTTTNTAAAACCTCCCCTGTAAACTGAACAGTTGTATATTTGTTGTCAATTCC
JMFF021A13+ CACAGGAGTTTTTAAAACCTCCCCTGTAAACTGAACAGTTGTATATTTGTTGTCAATTCC
                      ____________________________________________________________
consensus CACAGGAGTTTTTAAAACCTCCCCTGTAAACTGAACAGTTGTATATTTGTTGTCAATTCC
 
. : . : . : . : . : . :
JMFF011B11+ AGAAGTTCCTTCAAAGACCTGAACAACAGCTTTCTCCCCGTCAACTTCCAGAACTTGTCC
JMFF020L14+ AGAAGTTCCTTCAAAGACATGAACAACAGCTTTCTCCCCGTCAACTTCCAGAACTTGTCC
JMFF009M17+ AGAAGTTCCTTCAAAGACCTGAACAACAGCTTTCTCCCCGTCAACTTCCAGAACTTGTCC
JMSF026E11+ AGAAGTTCCTTCAAAGACCTGAACAACAGCTTTCTCCCCGTCAACTTCCAGAACTTGTCC
JMSF039B17+ AGAAGTTCCTTCAAAGACCTGAACAACAGCTTTCTCCCCGTCAACTTCCAGAACTTGTCC
JMFF005K19+ AGAAGTTCCTTCAAAGACCTGAACAACAGCTTTCTCCCCGTCAACTTCCAGAACTTGTCC
JMFF047G08+ AGAAGTTCCTTCAAAGACCTGAACAACAGCTTTCTCCCCGTCAACTTCCAGAACTTGTCC
JMFF021A13+ AGAAGTTCCTTCAAAGACCTGAACAACAGCTTTCTCCCCGTCAACTTCCAGAACTTGTCC
                      ____________________________________________________________
consensus AGAAGTTCCTTCAAAGACCTGAACAACAGCTTTCTCCCCGTCAACTTCCAGAACTTGTCC
 
. : . : . : . : . : . :
JMFF011B11+ ACGTCGGGTTGTTCCATCTCCTAAACGGATGTTAACAATCTCCTGGTACTTGGGTCCCTT
JMFF020L14+ ACGTCGGGTTGTTCCATCTCCTAAACGGATGTTAACAATCTCCTGGTACTTGGGTCCCTT
JMFF009M17+ ACGTCGGGTTGTTCCATCTCCTAAACGGATGTTAACAATCTCCTGGTACTTGGGTCCCTT
JMSF026E11+ ACGTCGGGTTGTTCCATCTCCTAAACGGATGTTAACAATCTCCTGGTACTTGGGTCCCTT
JMSF039B17+ ACGTCGGGTTGTTCCATCTCCTAAACGGATGTTAACAATCTCCTGGTACTTGGGTCCCTT
JMFF005K19+ ACGTCGGGTTGTTCCATCTCCTAAACGGATGTTAACAATCTCCTGGTACTTGGGTCCCTT
JMFF047G08+ ACGTCGGGTTGTTCCATCTCCTAAACGGATGTTAACAATCTCCTGGTACTTGGGTCCCTT
JMFF021A13+ ACGTCGGGTTGTTCCATCTCCTAAACGGATGTTAACAATCTCCTGGTACTTGGGTCCCTT
                      ____________________________________________________________
consensus ACGTCGGGTTGTTCCATCTCCTAAACGGATGTTAACAATCTCCTGGTACTTGGGTCCCTT
 
. : . : . : . : . : . :
JMFF011B11+ CACTTTGTCCAGGATAACCAACGGCCCAGCAACACCAGAGACAGTCCTATATTCCATGCC
JMFF020L14+ CACTTTGTCCAGGATAACCAACGGCCCAGCAACACCAGAGACAGTCCTATATTCCATGCC
JMFF009M17+ CACTTTGTCCAGGATAACCAACGGCCCAGCAACACCAGAGACAGTCCTATATTCCATGCC
JMSF026E11+ CACTTTGTCCAGGATAACCAACGGCCCAGCAACACCAGAGACAGTCCTATATTCCATGCC
JMSF039B17+ CACTTTGTCCAGGATAACCAACGGCCCAGCAACACCAGAGACAGTCCTATATTCCATGCC
JMFF005K19+ CACTTTGTCCAGGATAACCAACGGCCTAGCAACACCAGAGACAGTCCTATATTCCATGCC
JMFF047G08+ CACTTTGTCCAGGATAACCAACGGCCCAGCAACACCAGAGACAGTCCTATATTCCATGCC
JMFF021A13+ CACTTTGTCCAGGATAACCAACGGCCCAGCAACACCAGAGACAGTCCTATATTCCATGCC
                      ____________________________________________________________
consensus CACTTTGTCCAGGATAACCAACGGCCCAGCAACACCAGAGACAGTCCTATATTCCATGCC
 
. : . : . : . : . : . :
JMFF011B11+ AATCTCCAGAGTTCCCTCCTCCATGCCAATAC
JMFF020L14+ AATCTCCAGAGTTCCCTCCTCCATGCCAATAC
JMFF009M17+ AATCTCCAGAGTTCCCTCCTCCATGCCAATACTGTTATCCGCCACACCCATATTATGAAA
JMSF026E11+ AATCTCCAGAGTTCCCTCCTCCATGCCAATACTGTTATCCGCCACACCCATATTATGAAA
JMSF039B17+ AATCTCCAGAGTTCCCTCCTCCATGTCAATACTGTTATCCGCCACACCCATATTATGAAA
JMFF005K19+ AATCTCCAGAGTTCCCTCCTCCATGCCAATACTGTTATCCGCCACACCCATATTATGAAA
JMFF047G08+ AATCTCCAGAGTTCCCTCCTCCATGCCAATACTGTTATCCGCCACACCCATATTATGAAA
JMFF021A13+ AATCTCCAGAGTTCCCTCCTCCATGCCAATACTGTTATCCGCCACACCCATATTATGAAA
                      ____________________________________________________________
consensus AATCTCCAGAGTTCCCTCCTCCATGCCAATACTGTTATCCGCCACACCCATATTATGAAA
 
. : . : . : . : . : . :
JMFF005K19+ CTTTTCGTTTGTTCTTCTCTAATGCCAGATCGAGAGCGAG
JMFF047G08+ CTTTTCGTTTGTTCTTCTCTAATGCCAGATCGAGAGCGAAACAC
JMFF021A13+ CTTTTCGTTTGTTCTTCTCTAATGCCAGATCGAGAGCGAGACACGAAAATGAGATCCAAT
                      ____________________________________________________________
consensus CTTTTCGTTTGTTCTTCTCTAATGCCAGATCGAGAGCGAGACACGAAAATGAGATCCAAT