Previous Contig 001049:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF020O11Sequence549001049 (3)sp|O22607|MSI4_ARATH5e-58WD-40 repeat protein MSI4.>pir|G84577|G84577 probable WD-40 repeat protein, MSI4797009184 (5)gb:AC005917_15331967e-65Arabidopsis thaliana chromosome 2 clone F3P11 map CIC06E08, complete sequence.
JMFF033B06Sequence392001049 (3)sp|O22607|MSI4_ARATH3e-32WD-40 repeat protein MSI4.>pir|G84577|G84577 probable WD-40 repeat protein, MSI4803009184 (5)gb:AC005917_15331962e-67Arabidopsis thaliana chromosome 2 clone F3P11 map CIC06E08, complete sequence.
JMSF015F10Sequence264001049 (3)gb:AP002901_18237359e-10Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P045796009184 (5)gb:AC005917_15331966e-70Arabidopsis thaliana chromosome 2 clone F3P11 map CIC06E08, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF020O11+ TGTCCAGTC
                      ____________________________________________________________
consensus TGTCCAGTC
 
. : . : . : . : . : . :
JMFF020O11+ AATGTCAAATCTGGGAGTGACACAGCAGCTCCAAGAACAGCCTGCCGATTAGGTTGAGCT
                      ____________________________________________________________
consensus AATGTCAAATCTGGGAGTGACACAGCAGCTCCAAGAACAGCCTGCCGATTAGGTTGAGCT
 
. : . : . : . : . : . :
JMFF020O11+ TCAACATCCCATATCAGAACTTCAGGACTATCAGTGTGGGTGGCCACTATGTTTTTATTC
                      ____________________________________________________________
consensus TCAACATCCCATATCAGAACTTCAGGACTATCAGTGTGGGTGGCCACTATGTTTTTATTC
 
. : . : . : . : . : . :
JMFF033B06+ CCTGGGTGGATAATAGTTTTGTACTTTTTG
JMFF020O11+ TGAGGAAGCTCCCTGATTCTGTTCACCTCTCCTGGGTGGATAATAGTTTTGTACTTTTTG
                      ____________________________________________________________
consensus TGAGGAAGCTCCCTGATTCTGTTCACCTCTCCTGGGTGGATAATAGTTTTGTACTTTTTG
 
. : . : . : . : . : . :
JMFF033B06+ ACNTATGGTGAGCGTGCTTCTTCATTGAAATGTGCTATGTGATTCTCTGCTGCAATTCTG
JMFF020O11+ ACATATGGTGAGCGTGCTTCTTCATTGAAATGTGCTATGTGATTCTCTGCTGCAATTCTG
                      ____________________________________________________________
consensus ACATATGGTGAGCGTGCTTCTTCATTGAAATGTGCTATGTGATTCTCTGCTGCAATTCTG
 
. : . : . : . : . : . :
JMFF033B06+ GGCCGAACCACATCACAGTTAGCTATAATCAAAGTGTTTGGTGCTGACTGATCTGTCGGC
JMFF020O11+ GGCCGAACCACATCACAGTTAGCTATAATCAAAGTGTTTGGTGCTGACTGATCTGTCGGC
                      ____________________________________________________________
consensus GGCCGAACCACATCACAGTTAGCTATAATCAAAGTGTTTGGTGCTGACTGATCTGTCGGC
 
. : . : . : . : . : . :
JMFF033B06+ AAGAGAGGGAAGGCCAGACGAGGTTATGATTAGCGAACCAGTCGTAGAGGACCGGAACCA
JMSF015F10+ GAGAGGGAAGNCCAGACGAGGTTATGATTAGCGAACCAGTCGTAGAGGACCGGAACCA
JMFF020O11+ AAGAGAGGGAAGGCCAGACGAGGTTATGATTAGCGAACCAGTCGTAGAGGACCGGAACCA
                      ____________________________________________________________
consensus AAGAGAGGGAAGGCCAGACGAGGTTATGATTAGCGAACCAGTCGTAGAGGACCGGAACCA
 
. : . : . : . : . : . :
JMFF033B06+ GCGACTTCCACTGAGCGTACTTCTCATCAACACCACCGCCGGCCTTCTTGCCACCGCCGG
JMSF015F10+ GCGACTTCCACTGAGCGTACTTCTC
JMFF020O11+ GCGACTTCCACTGAGCGTACTTCTCATCAACACCACCGCCGGCCTTCTTGCCACCGCCGG
                      ____________________________________________________________
consensus GCGACTTCCACTGAGCGTACTTCTCATCAACACCACCGCCGGCCTTCTTGCCACCGCCGG
 
. : . : . : . : . : . :
JMFF033B06+ CCCCGCCTCGCTTCCTAGAGGTGGCGCCACCGGAAGGATGCGAATCGCGTTCTCTGTCCT
JMFF020O11+ CCCCGCCTCGCTTCCTAGAGGTGGCGCCACCGGAAGGATGCGAATCGCGTTCTCTGTCCT
                      ____________________________________________________________
consensus CCCCGCCTCGCTTCCTAGAGGTGGCGCCACCGGAAGGATGCGAATCGCGTTCTCTGTCCT
 
. : . : . : . : . : . :
JMFF033B06+ CTTTGGGCTTGTTGGTTGAGCCCTTCGGCCGGCCACGCTTTCGCGGCTGCTGTTGC
JMFF020O11+ CTTTGGGCTTGTTGGTTGAGCCCTTCGGCCGGCCACGCTTTCGCGGCTGCTGTTGCAGAG
                      ____________________________________________________________
consensus CTTTGGGCTTGTTGGTTGAGCCCTTCGGCCGGCCACGCTTTCGCGGCTGCTGTTGCAGAG