Previous Contig 001048:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF009G04Sequence498001048 (11)pir|F96705|F967051e-27unknown protein, 73543-72303 [imported] - Arabidopsis thaliana>gb:AE005173_89444471001048 (11)pir|F96705|F967058e-28unknown protein, 73543-72303 [imported] - Arabidopsis thaliana>gb:AE005173_89444
JMFF013J07Sequence614001048 (11)pir|F96705|F967059e-47unknown protein, 73543-72303 [imported] - Arabidopsis thaliana>gb:AE005173_89444660001048 (11)pir|F96705|F967053e-46unknown protein, 73543-72303 [imported] - Arabidopsis thaliana>gb:AE005173_89444
JMFF018D08Sequence547001048 (11)pir|F96705|F967058e-38unknown protein, 73543-72303 [imported] - Arabidopsis thaliana>gb:AE005173_89444806001048 (11)pir|F96705|F967052e-57unknown protein, 73543-72303 [imported] - Arabidopsis thaliana>gb:AE005173_89444
JMFF020O08Sequence543001048 (11)pir|F96705|F967052e-37unknown protein, 73543-72303 [imported] - Arabidopsis thaliana>gb:AE005173_89444726001048 (11)pir|F96705|F967058e-47unknown protein, 73543-72303 [imported] - Arabidopsis thaliana>gb:AE005173_89444
JMFF024O20Sequence539001048 (11)pir|F96705|F967052e-37unknown protein, 73543-72303 [imported] - Arabidopsis thaliana>gb:AE005173_89444716001048 (11)pir|F96705|F967052e-51unknown protein, 73543-72303 [imported] - Arabidopsis thaliana>gb:AE005173_89444
JMFN016D11Sequence575001048 (11)pir|F96705|F967057e-53unknown protein, 73543-72303 [imported] - Arabidopsis thaliana>gb:AE005173_89444

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF020O08- GAATGGATAGGAACCCCATTACCA
rJMFF024O20- CCCATTACCA
                      ____________________________________________________________
consensus GAATGGATAGGAACCCCATTACCA
 
. : . : . : . : . : . :
rJMFF013J07- AATACAGAATTATAAATAATACATATTTCTTTTGTACATATATAGATAGATTACTGGAGC
rJMFF020O08- AATACAGAATTATAAATAATACATATTTCTTTTGTACATATATAGATAGATTACTGGAGC
rJMFF024O20- AATACAGAATTATAAATAATACATATTTCTTTTGTACATATATAGATAGATTACTGGAGC
rJMFF018D08- TATTTCTTTTGTACATATATAGATAGATTACTGGAGC
                      ____________________________________________________________
consensus AATACAGAATTATAAATAATACATATTTCTTTTGTACATATATAGATAGATTACTGGAGC
 
. : . : . : . : . : . :
rJMFF013J07- CATATAGGTATATCATATATGTAGCAACCACAATCTCTAGATAAGTTCTTCACACAGTCC
rJMFF009G04+ ATATCATATATGTAGCAACCACAATCTCTAGATAAGTTCTTCACACAGTCC
JMFF009G04- ATATCATATATGTAGCAACCACAATCTCTAGATAAGTTCTTCACACAGTCC
rJMFF020O08- CATATAGGTATATCATATATGTAGCAACCACAATCTCTAGATAAGTTCTTCACACAGTCC
rJMFF024O20- CATATAGGTATATCATATATGTAGCAACCACAATCTCTAGATAAGTTCTTCACACAGTCC
rJMFF018D08- CATATAGGTATATCATATATGTAGCAAGCACAATCTCTAGATAAGTTCTTCACACAGTCC
                      ____________________________________________________________
consensus CATATAGGTATATCATATATGTAGCAACCACAATCTCTAGATAAGTTCTTCACACAGTCC
 
. : . : . : . : . : . :
rJMFF013J07- TGAAAAACACACTACCTATCCAATCCAAAATGACCCAAATTCGTTTTAGACTGATCAGAT
rJMFF009G04+ TGAAAAACACACTACCTATCCAATCCAAAATGACCCAAATTCGTTTTAGACTGATCAGAT
JMFF009G04- TGAAAAACACACTACCTATCCAATCCAAAATGACCCAAATTCGTTTTAGACTGATCAGAT
rJMFF020O08- TGAAAAACACACTACCTATCCAATCCAAAATGACCCAAATTCGTTTTAGACTGATCAGAT
rJMFF024O20- TGAAAAACACACTACCTATCCAATCCAAAATGACCCAAATTCGTTTTAGACTGATCAGAT
rJMFF018D08- TGAAAAACACACTACCTATCCAATCCAAAATGACCCAAATTCGTTTTAGACTGATCAGAT
                      ____________________________________________________________
consensus TGAAAAACACACTACCTATCCAATCCAAAATGACCCAAATTCGTTTTAGACTGATCAGAT
 
. : . : . : . : . : . :
rJMFF013J07- CAACCCTTTCTCTCAGCAGATTCGGGGAAACTGGACATGGTCATTCCAAGTCCTTCGTTC
rJMFF009G04+ CAACCCTTTCTCTCAGCAGATTCGGGGAAACTGGACATGGTCATTCCAAGTCCTTCGTTC
JMFF009G04- CAACCCTTTCTCTCAGCAGATTCGGGGAAACTGGACATGGTCATTCCAAGTCCTTCGTTC
rJMFF020O08- CAACCCTTTCTCTCAGCAGATTCGGGGAAACTGGACATGGTCATTCCAAGTCCTTCGTTC
rJMFF024O20- CAACCCTTTCTCTCAGCAGATTCGGGGAAACTGGACATGGTCATTCCAAGTCCTTCGTTC
rJMFF018D08- CAACCCTTTCTCTCAGCAGATTCGGGGAAACTGGACATGGTCATTCCAAGTCCTTCGTTC
                      ____________________________________________________________
consensus CAACCCTTTCTCTCAGCAGATTCGGGGAAACTGGACATGGTCATTCCAAGTCCTTCGTTC
 
. : . : . : . : . : . :
rJMFF013J07- TCGTGCTTTTGCCACCCACCTGTGTCCGCCTTGGAATGGGACCAGTAGTAGAAAATGGAG
rJMFF009G04+ TCGTGCTTTTGCCACCCACCTGTGTCCGCCTTGGAATGGGACCAGTAGTAGAAAATGGAG
JMFF009G04- TCGTGCTTTTGCCACCCACCTGTGTCCGCCTTGGAATGGGACCAGTAGTAGAAAATGGAG
rJMFF020O08- TCGTGCTTTTGCCACCCACCTGTGTCCGCCTTGGAATGGGACCAGTAGTAGAAAATGGAG
rJMFF024O20- TCGTGCTTTTGCCACCCACCTGTGTCCGCCTTGGAATGGGACCAGTAGTAGAAAATGGAG
JMFN016D11+ CTTTTGCCACCCACCTGTGTCCGCCTTGGAATGGGACCAGTAGTAGAAAATGGAG
rJMFF018D08- TCGTGCTTTTGCCACCCACCTGTGTCCGCCTTGGAATGGGACCAGTAGTAGAAAATGGAG
JMFF013J07+ AGTAGTAGAAAATGGAG
                      ____________________________________________________________
consensus TCGTGCTTTTGCCACCCACCTGTGTCCGCCTTGGAATGGGACCAGTAGTAGAAAATGGAG
 
. : . : . : . : . : . :
rJMFF013J07- GCAATCATTGAGAGTAGCGTGAGTGCTGCTCCCGCAGCAAACACACCTTTACGAAGCGTG
rJMFF009G04+ GCAATCATTGAGAGTAGCGTGAGTGCTGCTCCCGCAGCAAACACACCTTTACGAAGCGTG
JMFF009G04- GCAATCATTGAGAGTAGCGTGAGTGCTGCTCCCGCAGCAAACACACCTTTACGAAGCGTG
rJMFF020O08- GCAATCATTGAGAGTAGCGTGAGTGCTGCTCCCGCAGCAAACACACCTTTACGAAGCGTG
rJMFF024O20- GCAATCATTGAGAGTAGCGTGAGTGCTGCTCCCGCAGCAAACACACCTTTACGAAGCGTG
JMFN016D11+ GCAATCATTGAGAGTAGCGTGAGTGCTGCTCCCGCAGCAAACACACCTTTACGAAGCGTG
rJMFF018D08- GCAATCATTGAGAGTAGCGTGAGTGCTGCTCCCGCAGCAAACACACCTTTACGAAGCGTG
JMFF018D08+ ACGAAGCGTG
JMFF024O20+ TG
JMFF013J07+ GCAATCATTGAGAGTAGCGTGAGTGCTGCTCCCGCAGCAAACACACCTTTACGAAGCGTG
JMFF020O08+ GCGTG
                      ____________________________________________________________
consensus GCAATCATTGAGAGTAGCGTGAGTGCTGCTCCCGCAGCAAACACACCTTTACGAAGCGTG
 
. : . : . : . : . : . :
rJMFF013J07- GCACATGACAAGTGGTCAACACGGAAAAATCCCCGGTATTTTGTGTGGTATGCATTCCTC
rJMFF009G04+ GCACATGACAAGTGGTCAACACGGAAAAATCCCCGGTATTTTGTGTGGTATGCATTCCTC
JMFF009G04- GCACATGACAAGTGGTCAACACGGAAAAATCCCCGGTATTTTGTGTGGTATGCATTCCTC
rJMFF020O08- GCACATGACAAGTGGTCAACACGGAAAAATCCCCGGTATTTTGTGTGGTATGCATTCCTC
rJMFF024O20- GCACATGACAAGTGGTCAACACGGAAAAATCCCCGGTATTTTGTGTGGTATGCATTCCTC
JMFN016D11+ GCACATGACAAGTGGTCAACACGGAAAAATCCCCGGTATTTTGTGTGGTATGCATTCCTC
rJMFF018D08- GCACATGACAAGTGGTCAACACGGAAAAATCCCCGGTATTTTGTGTGGTATGCATTCCTC
JMFF018D08+ GCACATGACAAGTGGTCAACACGGAAAAATCCCCGGTATTTTGTGTGGTATGCATTCCTC
JMFF024O20+ GCACATGACAAGTGGTCAACACGGAAAAATCCCCGGTATTTTGTGTGGTATGCATTCCTC
JMFF013J07+ GCACATGACAAGTGGTCAACACGGAAAAATCCCCGGTATTTTGTGTGGTATGCATTCCTC
JMFF020O08+ GCACATGACAAGTGGTCAACACGGAAAAATCCCCGGTATTTTGTGTGGTATGCATTCCTC
                      ____________________________________________________________
consensus GCACATGACAAGTGGTCAACACGGAAAAATCCCCGGTATTTTGTGTGGTATGCATTCCTC
 
. : . : . : . : . : . :
rJMFF013J07- GCTGATCCTGCCAATAAGCAAGCCTCTGCCCCCAAAAAGCTCACCAAAGAGAAGATGAAG
rJMFF009G04+ GCTGATCCTGCCAATAAGCAAGCCTCTGCCCCCAAAAAGCTCACC
JMFF009G04- GCTGATCCTGCCAATAAGCAAGCCTCTGCCCCCAAAAAGCTCACC
rJMFF020O08- GCTGATCCTGCCAATAAGCAAGCCTCTGCCCCCAAAAAGCTCACCAAAGAGAAGATGAAG
rJMFF024O20- GCTGATCCTGCCAATAAGCAAGCCTCTGCCCCCAAAAAGCTCACCAAAGAGAAGATGAAG
JMFN016D11+ GCTGATACTGCCAATAAGCAAGCCTCTGCCCCCAAAAAGCTCACCAAAGAGAAGATGAAG
rJMFF018D08- GCTGATCCTGCCAATAAGCAAGCCTCTGCCCCCAAAAAGCTCACCAAAGAGAAGATGAAG
JMFF018D08+ GCTGATCCTGCCAATAAGCAAGCCTCTGCCCCCAAAAAGCTCACCAAAGAGAAGATGAAG
JMFF024O20+ GCTGATCCTGCCAATAAGCAAGCCTCTGCCCCCAAAAAGCTCACCAAAGAGAAGATGAAG
JMFF013J07+ GCTGATCCTGCCAATAAGCAAGCCTCTGCCCCCAAAAAGCTCACCAAAGAGAAGATGAAG
JMFF020O08+ GCTGATCCTGCCAATAAGCAAGCCTCTGCCCCCAAAAAGCTCACCAAAGAGAAGATGAAG
                      ____________________________________________________________
consensus GCTGATCCTGCCAATAAGCAAGCCTCTGCCCCCAAAAAGCTCACCAAAGAGAAGATGAAG
 
. : . : . : . : . : . :
rJMFF013J07- AAGAAAATAGCACAAGTGGTAGATTTTCCACCCATCATCCCTCTCCCGCAACACAGGCAC
rJMFF020O08- AAGAAAATAGCACAAGTGGTAGATTTTCCACCCATCATCCCTCTCCCGCAACACAGGCAC
rJMFF024O20- AAGAAAATAGCACAAGTGGTAGATTTTCCACCCATCATCCCTCTCCCGCAACACAGGCAC
JMFN016D11+ AAGAAAATAGCACAAGTGGTAGATTTTCCACCCATCATCCCTCTCCCGCAACACAGGCAC
rJMFF018D08- AAGAAAATAGCACAAGTGGTAGATTTTCCACCCATCATCCCTCTCCCGCAACACAGGCAC
JMFF018D08+ AAGAAAATAGCACAAGTGGTAGATTTTCCACCCATCATCCCTCTCCCGCAACACAGGCAC
JMFF024O20+ AAGAAAATAGCACAAGTGGTAGATTTTCCACCCATCATCCCTCTCCCGCAACACAGGCAC
JMFF013J07+ AAGAAAATAGCACAAGTGGTAGATTTTCCACCCATCATCCCTCTCCCGCAACACAGGCAC
JMFF020O08+ AAGAAAATAGCACAAGTGGTAGATTTTCCACCCATCATCCCTCTCCCGCAACACAGGCAC
                      ____________________________________________________________
consensus AAGAAAATAGCACAAGTGGTAGATTTTCCACCCATCATCCCTCTCCCGCAACACAGGCAC
 
. : . : . : . : . : . :
rJMFF013J07- TTGGTAACGCAGTATAACACAGTTTGGCTAATGAGAAGCAGCCCAAACGCCGACAATCCG
rJMFF020O08- TTGGTAACGCAGTATAACACAGTTTGGCTAATGAGAAGCAGCCCAAACGCCGACAATCCG
rJMFF024O20- TTGGTAACGCAGTATAACACAGTTTGGCTAATGAGAAGCAGCCCAAACGCCGACAATCCG
JMFN016D11+ TTGGTAACGCAGTATAACACAGTTTGGCTAATGAGAAGCAGCCCAAACGCCGACAATCCG
rJMFF018D08- TTGGTAACGCAGTATAACACAGTTTGGCTAATGAGAAGCAGCCCAAACGCCGACAATCCG
JMFF018D08+ TTGGTAACGCAGTATAACACAGTTTGGCTAATGAGAAGCAGCCCAAACGCCGACAATCCG
JMFF024O20+ TTGGTAACGCAGTATAACACAGTTTGGCTAATGAGAAGCAGCCCAAACGCCGACAATCCG
JMFF013J07+ TTGGTAACGCAGTATAACACAGTTTGGCTAATGAGAAGCAGCCCAAACGCCGACAATCCG
JMFF020O08+ TTGGTAACGCAGTATAACACAGTTTGGCTAATGAGAAGCAGCCCAAACGCCGACAATCCG
                      ____________________________________________________________
consensus TTGGTAACGCAGTATAACACAGTTTGGCTAATGAGAAGCAGCCCAAACGCCGACAATCCG
 
. : . : . : . : . : . :
rJMFF013J07- TACGCCGTCGACGCGTCCGTTCCGTACACGCAGTACGTCCTCTCATCGTACTCATCTGGC
rJMFF020O08- TACGCCGTCGACGCGTCCGTTCCGTACACGCAGTACGTCCTCTCATCGTACTCATCTGGC
rJMFF024O20- TACGCCGTCGACGCGTCCGTTCCGTACACGCAGTACGTCCTCTCATCGTACTCATCTGGC
JMFN016D11+ TACGCCGTCGACGCGTCCGTTCCGTACACGCAGTACGTCCTCTCATCGTACTCATCTGGC
rJMFF018D08- TACGCCGTCGACGCGTCCGTTCCGTACACGCAGTACGTCCTCTCATCGTACTCATCTGGC
JMFF018D08+ TACGCCGTCGACGCGTCCGTTCCGTACACGCAGTACGTCCTCTCATCGTACTCATCTGGC
JMFF024O20+ TACGCCGTCGACGCGTCCGTTCCGTACACGCAGTACGTCCTCTCATCGTACTCATCTGGC
JMFF013J07+ TACGCCGTCGACGCGTCCGTTCCGTACACGCAGTACGTCCTCTCATCGTACTCATCTGGC
JMFF020O08+ TACGCCGTCGACGCGTCCGTTCCGTACACGCAGTACGTCCTCTCATCGTACTCATCTGGC
                      ____________________________________________________________
consensus TACGCCGTCGACGCGTCCGTTCCGTACACGCAGTACGTCCTCTCATCGTACTCATCTGGC
 
. : . : . : . : . : . :
rJMFF020O08- ACNAACTTTCGCTGTGCTACGGCGGCGCTCGGCACCAACGGC
rJMFF024O20- AC-AACTTTCGCTGTGCTACGGCGGCGCTCGGCACCAACGGCGAGAA
JMFN016D11+ AC-AACTTTCGCTGTGCTACGGCGGCGCTCGGCACCAACGGCGAGAACGAAGGCGATGAG
rJMFF018D08- AC-AACTTTCGCTGTGCTACGGCGGCGCTCGGCACCAACGGCGAGAACGAAGGCGATGAG
JMFF018D08+ AC-AACTTTCGCTGTGCTACGGCGGCGCTCGGCACCAACGGCGAGAACGAAGGCGATGAG
JMFF024O20+ AC-AACTTTCGCTGTGCTACGGCGGCGCTCGGCACCAACGGCGAGAACGAAGGCGATGAG
JMFF013J07+ AC-AACTTTCGCTGTGCTACGGCGGCGCTCGGCACCAACGGCGAGAACGAAGGCGATGAG
JMFF020O08+ AC-AACTTTCGCTGTGCTACGGCGGCGCTCGGCACCAACGGCGAGAACGAAGGCGATGAG
                      ____________________________________________________________
consensus AC-AACTTTCGCTGTGCTACGGCGGCGCTCGGCACCAACGGCGAGAACGAAGGCGATGAG
 
. : . : . : . : . : . :
JMFN016D11+ GTGAAAGGAGATGAGTAAGACTAGAAGAGGTATGGAGAGCGCCATTAATGGCCAAGTATG
rJMFF018D08- GTGAAAGGAGATGAGTAAGACTAGAAGAGGTATGGAGAGCGCCATTAATGGCCAAGTATG
JMFF018D08+ GTGAAAGGAGATGAGTAAGACTAGAAGAGGTATGGAGAGCGCCATTAATGGCCAAGTATG
JMFF024O20+ GTGAAAGGAGATGAGTAAGACTAGAAGAGGTATGGAGAGCGCCATTAATGGCCAAGTATG
JMFF013J07+ GTGAAAGGAGATGAGTAAGACTAGAAGAGGTATGGAGAGCGCCATTAATGGCCAAGTATG
JMFF020O08+ GTGAAAGGAGATGAGTAAGACTAGAAGAGGTATGGAGAGCGCCATTAATGGCCAAGTATG
                      ____________________________________________________________
consensus GTGAAAGGAGATGAGTAAGACTAGAAGAGGTATGGAGAGCGCCATTAATGGCCAAGTATG
 
. : . : . : . : . : . :
JMFN016D11+ CAGCTTTGTTGATCTGCTTTTCTTCTTCGATTT-GGGAATTT
rJMFF018D08- CAGCTTTGTTGATCTGCTTTTCTTCTTCGATTTGGGGAATTTTGNTGACA
JMFF018D08+ CAGCTTTGTTGATCTGCTTTTCTTCTTCGATTT-GGGAATTTTGTTGACACTAAAACACA
JMFF024O20+ CAGCTTTGTTGATCTGCTTTTCTTCTTCGATTT-GGGAATTTTGTTGACACTAAAACACA
JMFF013J07+ CAGCTTTGTTGATCTGCTTTTCTTCTTCGATTT-GGGAATTTTGTTGACACTAAAACACA
JMFF020O08+ CAGCTTTGTTGATCTGCTTTTCTTCTTCGATTT-GGGAATTTTGTTGACACTAAAACACA
                      ____________________________________________________________
consensus CAGCTTTGTTGATCTGCTTTTCTTCTTCGATTT-GGGAATTTTGTTGACACTAAAACACA
 
. : . : . : . : . : . :
JMFF018D08+ GTAGAGTAGAGGAGCACAGCTTAGCTTTGCTTTGGAGCTTTGGAGCTTTGGCTTTATTT
JMFF024O20+ GTAGAGTAGAGGAGCACAGCTTAGCTTTGCTTTGGAGCTTTGGAGCTTTGGCTTTATTT
JMFF013J07+ GTAGAGTAGAGGAGCACAGCTTAGCTTTGCTTTGGAGCTTTGGAGCTTTGGCTTTATTT
JMFF020O08+ GTAGAGTAGAGGAGCACAGCTTAGCTTTGCTTTGGAGCTTTGGAGCTTTGGCTTTATTTT
                      ____________________________________________________________
consensus GTAGAGTAGAGGAGCACAGCTTAGCTTTGCTTTGGAGCTTTGGAGCTTTGGCTTTATTTT